A gene expression regulatory element based on the CRP dual regulation principle and its application

Abstract

The present invention relates to the field of biotechnology and genetic engineering technology, and in particular to a gene expression control element based on the CRP dual control principle and its application. The present invention provides the application of a combined CMDE element or a material containing a combined CMDE element in enhancing gene expression, and the nucleotide sequence of the combined CMDE element is shown in SEQ ID NO.1. The present invention obtains a combined CMDE element with strong transcriptional and translational activity by studying and identifying it from Escherichia coli, and the combined CMDE element with strong transcriptional and translational activity provided by the present invention can increase the expression of exogenous genes. At the same time, the results of the specific embodiments of the present invention prove that the combined CMDE element provided by the present invention can be operably connected to a gene cluster that enhances the synthesis of flavonoid compounds, which can enhance the expression of the gene cluster that synthesizes flavonoid compounds, thereby increasing the yield of flavonoid compounds in the strain, and has a wider application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology and genetic engineering technology, and in particular to a gene expression regulatory element based on the CRP dual regulation principle and its application. Background Art

[0002] Microbial genetic engineering technology is one of the current hot topics in the field of biotechnology. Its goal is to optimize and improve microbial traits and yields by changing the gene expression pattern of microorganisms. Promoters, SBS (S1 binding site) sequences, and RBS (Ribosome Binding Site) sequences are key elements for gene expression regulation and play an important role in microbial genetic engineering. In-depth research on the regulatory mechanisms of different elements on gene expression will help reveal the process of microbial growth and development and the synthesis of secondary metabolites, and provide theoretical support for the use of microbial genetic engineering technology to transform microorganisms.

[0003] Escherichia coli has many advantages as a product synthesis chassis, making it one of the most commonly used host microorganisms in the field of synthetic biology and genetic engineering. Promoters, SBS sequences and RBS sequences play a key role in the synthesis of proteins in the synthetic chassis. Appropriate promoters, SBS sequences and RBS sequences can ensure the correct mRNA transcription and translation process. Promoter refers to a sequence on a DNA molecule that can be recognized, bound and initiated by RNA polymerase. It is an important cis-acting element in the process of gene expression regulation and can control the degree of gene expression. SBS refers to the site that binds to S1. It binds to the 11 nucleotides immediately before the RBS sequence and can regulate the overall protein translation level. RBS, also known as the ribosome binding site, is a specific sequence located on the mRNA molecule that is used to initiate the protein synthesis process. In the field of synthetic biology and genetic engineering, the rational design and optimization of the three are very important for protein transcription and translation.

[0004] However, traditional strategies can no longer meet the increasingly complex synthetic biology systems, and therefore new strategies are urgently needed to design and optimize synthetic biology elements (including promoters, RBS and SBS). Protein acylation modification is a self-metabolism regulation system evolved by bacteria to adapt to complex environments. Currently, researchers attempt to apply acylation modification to the design of high-performance synthetic biology elements. However, because the acylation modification regulation mechanism is not yet clear, it is still challenging to design high-performance elements based on this regulation mechanism. The present invention designs CRP-mediated dual-enhanced CMDE elements based on the acetylation modification regulation principle, which promotes the application of synthetic biology in industrial production. Summary of the invention

[0005] The purpose of the present invention is to provide a gene expression regulatory element based on the CRP dual regulation principle and its application to solve the problems existing in the above-mentioned prior art. The combined CMDE element provided by the present invention has strong transcription and translation activity.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides application of a combined CMDE element or a material containing the combined CMDE element in enhancing gene expression, wherein the nucleotide sequence of the combined CMDE element is shown in SEQ ID NO.1.

[0008] Preferably, the materials include transcription and translation expression cassettes, recombinant vectors and recombinant bacteria.

[0009] The present invention provides the use of a combined CMDE element or a material containing the combined CMDE element in preparing foreign protein or preparing a product for producing foreign protein. The nucleotide sequence of the combined CMDE element is shown in SEQ ID NO.1.

[0010] Preferably, the materials include transcription and translation expression cassettes, recombinant vectors and recombinant bacteria.

[0011] Preferably, the product comprises a reagent or a kit.

[0012] The present invention provides a method for enhancing the transcription and translation of a target gene, comprising the steps of introducing a vector operably linked to a combined CMDE element and a target gene into a basic bacterium, and enhancing the transcription and translation level of the target gene in the basic bacterium;

[0013] The nucleotide sequence of the combined CMDE element is shown in SEQ ID NO.1.

[0014] The present invention provides the use of a combined CMDE element or a material containing the combined CMDE element in producing flavonoid compounds or preparing products for producing flavonoid compounds. The nucleotide sequence of the combined CMDE element is shown in SEQ ID NO.1.

[0015] Preferably, the materials include transcription and translation expression cassettes, recombinant vectors and recombinant bacteria.

[0016] Preferably, the flavonoids include one or more of pinot nobilis, p-coumaric acid and cinnamic acid.

[0017] The present invention provides a method for producing flavonoid compounds, comprising the steps of culturing recombinant bacteria containing combined CMDE elements and collecting the produced flavonoid compounds;

[0018] The nucleotide sequence of the combined CMDE element is shown in SEQ ID NO.1.

[0019] The present invention discloses the following technical effects:

[0020] The present invention obtains a combined CMDE element with strong transcription and translation activity by separation and identification from Escherichia coli. The combined CMDE element with strong transcription and translation activity provided by the present invention can increase the expression of exogenous genes. At the same time, the results of the specific embodiments of the present invention prove that the combined CMDE element provided by the present invention can be operably connected with the flavonoid synthesis enhancing gene cluster, which can enhance the expression of the flavonoid synthesis gene cluster, thereby increasing the yield of flavonoids in the strain, and has a wide range of application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 The transcription levels of RelA (A) and SpoT (B) were detected by qRT-PCR;

[0023] Figure 2 Analysis of the translation levels of RelA (A) and SpoT (B) for RNC-Seq;

[0024] Figure 3 is a schematic diagram of the combined CMDE elements;

[0025] Figure 4 The figure is a statistical diagram of the yield of sutophthora in each recombinant BL21 (DE3) strain in the liquid LB medium supplemented with cerulenin; wherein A is a structural diagram of the fluorescent expression circuit designed by using the combined CMDE element; B is a statistical diagram of the yield of sutophthora in each recombinant BL21 (DE3) strain; C is the chemical structural formula of sutophthora;

[0026] Figure 5 The growth curve of the recombinant BL21 (DE3) strain successfully transformed with three plasmids and the survey statistics of the expression of the sfGFP reporter gene; A is a schematic diagram of the design of the fluorescence expression circuit using the combined CMDE element; B is the growth curve of each recombinant BL21 (DE3) strain and the survey results of the expression of the sfGFP reporter gene;

[0027] Figure 6The figure is a statistical diagram of the production of p-coumaric acid and cinnamic acid in each recombinant BL21 (DE3) strain in liquid LB medium; wherein A is a schematic diagram of the design of a fluorescent expression circuit using a combined CMDE element; B is a statistical diagram of the production of p-coumaric acid in each recombinant BL21 (DE3) strain; C is the chemical structural formula of p-coumaric acid; D is a statistical diagram of the production of cinnamic acid in each recombinant BL21 (DE3) strain; E is the chemical structural formula of cinnamic acid;

[0028] Figure 7 is the standard curve of pinospermone;

[0029] Figure 8 The standard curves are p-coumaric acid (A) and cinnamic acid (B). DETAILED DESCRIPTION

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0033] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0035] The term "combined CMDE element" used in the present invention refers to a nucleic acid molecule comprising a promoter, an SBS sequence and an RBS sequence, referred to as a promoter-SBS-RBS sequence. The promoter-SBS-RBS sequence is usually located upstream of the target gene coding sequence. In the fields of synthetic biology and genetic engineering, the rational design and optimization of the three are very important for the transcription and translation of proteins. The nucleotide sequence of the combined CMDE element of the present invention is shown in SEQ ID NO: 1; the present invention also includes some variants of the above-mentioned nucleic acid molecule with the same function, which have at least 90% homology with the nucleotide sequence shown in SEQ ID NO: 1, preferably at least 95% homology, and preferably at least 96% homology, further preferably at least 97% homology, more preferably at least 98% homology, and most preferably at least 99% homology, and have nucleotides with transcription and translation activity.

[0036] Preferably, the mutation of the variant occurs in the regulatory region of the promoter, or in the SBS region, or in the RBS region, for example, by inserting or deleting some sequences, or performing random or site-directed mutagenesis, etc. In other words, the present invention also includes variants of SEQ ID NO: 1 that retain the function of directing the expression of the target gene, obtained by deleting or mutating one, several or dozens of bases (for example, within 100, or within 80, or within 60, or within 50, or within 40, or within 30, or within 20, or within 15, or within 10, or within 5) on the basis of the nucleotide sequence shown in SEQ ID NO: 1. The present invention also includes fragments of, for example, 15-50 bases added to both ends of the nucleotides shown in SEQ ID NO: 1, more preferably nucleotides of 15-30 bases in length and having transcriptional and translational activity.

[0037] The homology described in the present invention refers to the similarity between the nucleotide sequences of two DNA molecules.

[0038] In some embodiments, the transcription-translation expression cassette includes a promoter region, an SBS region, an RBS region, a structural gene region and a terminator; wherein the promoter-SBS-RBS region contains the promoter, the SBS region and the RBS region; the structural gene can be homologous or heterologous, natural or artificially modified to the host cell; the artificial modification includes random mutation or directed mutation.

[0039] The structural gene described in the present invention refers to a gene encoding protein or RNA.

[0040] The heterologous sequence mentioned in the present invention refers to a sequence from a species other than Escherichia coli.

[0041] The recombinant vector of the present invention refers to a linear or circular DNA molecule, which contains a structural gene and is operably linked to a sequence for controlling the expression of the structural gene.

[0042] The expression of the present invention includes but is not limited to transcription, post-transcriptional modification, translation, post-translational modification and secretion.

[0043] In some embodiments, the expression cassette contains the promoter-SBS-RBS sequence shown in SEQ ID NO: 1, key genes in the flavonoid biosynthesis pathway (such as RgTAL1, Pstrsts2, Sc4cl, Pcpal1), and a terminator. In some embodiments, the expression cassette is transformed into Escherichia coli.

[0044] Example 1 Identification of DNA fragments with transcriptional and translational activity

[0045] The transcription levels of (p)ppGpp synthesis-related genes relA and spoT in the WT strain (Escherichia coli MG1655), the Dcrp strain (disclosed in the document "Regulation ofytfKbycAMP-CRP Contributes to SpoT-Dependent Accumulation of(p)ppGpp in Response toCarbon Starvation YtfKResponds to Glucose Exhaustion", and promised to be released to the outside world for 20 years) and the Ccrp strain (disclosed in the document "Regulation ofytfKby cAMP-CRP Contributes to SpoT-Dependent Accumulation of(p)ppGpp in Response to Carbon StarvationYtfKResponds to Glucose Exhaustion", and promised to be released to the outside world for 20 years) were analyzed by qRT-PCR. The specific steps were: Escherichia coli MG1655, the Δcrp strain and the Ccrp strain were respectively grown in M9 basic medium with a glucose concentration of 5mM. When the growth reaches the late logarithmic phase, the bacterial solution is collected and RNA is extracted. The single-stranded cDNA obtained after reverse transcription is generally diluted 10 times and used as a qRT-PCR template. At the same time, the transcription levels of relA and spoT are detected using a fluorescent quantitative PCR instrument with 16S rRNA-F / R, RT-relA-F / R and RT-spoT-F / R primers. The specific information of 16S rRNA-F / R, RT-relA-F / R and RT-spoT-F / R primers is shown in Table 1.

[0046] Table 116S rRNA-F / R, RT-relA-F / R and RT-spoT-F / R primer details

[0047] Primer name Primer number Primer sequences 16SrRNA-F SEQ ID NO: 2 TCGCGTTGCATCGAATTAAA 16SrRNA-R SEQ ID NO: 3 CCCCCTGGACGAAGACTGAC RT-relA-F SEQ ID NO: 4 ATGCCAACGTAGTCAGCGAA RT-relA-R SEQ ID NO: 5 CGACCTGTTCGGAGGAAACA RT-spoT-F SEQ ID NO: 6 TGGGTTTTGAGGCGCTGTAT RT-spoT-R SEQ ID NO: 7 TCGAGTGAAAACGCTGCTCT

[0048] The results are as follows Figure 1 As shown in the figure, the expression levels of both were significantly reduced in Dcrp, with spoT decreasing to a greater extent, demonstrating that spoT plays a major role in CRP-mediated transcriptional regulation.

[0049] For S1 WT ::MG1655 (hereinafter referred to as S1 WT , published in the paper "Selective recruitment of stress-responsive mRNAs to ribosomes for translation by acetylated protein S1 during nutrient stress in Escherichia coli" and promised to be released to the public for 20 years) and S1 K247Q ::MG1655 (hereinafter referred to as S1 K247Q , published in the paper "Selective recruitment of stress-responsive mRNAs to ribosomes for translation by acetylated protein S1during nutrient stress in Escherichia coli", and promised to release it to the public for 20 years) to analyze the RNC-seq data. YfiQ is a target of cAMP-CRP in Escherichia coli and is positively regulated by cAMP-CRP. The effect of cAMP-CRP's regulation of S1's YfiQ-dependent acetylation catalysis on ppGpp anabolism is not clear. K247 is the only acetylation site, so we constructed an acetylation-mimicking (K247Q) mutant of S1 (published in the paper "Selective recruitment of stress-responsive mRNAs to ribosomes for translation by acetylated protein S1during nutrient stress in Escherichia coli", and promised to release it to the public for 20 years) to strain S1. K247Q and S1 WTRibosome-nascent peptide chain complex sequencing (RNC-Seq) analysis was performed, and the translation levels of RelA and SpoT were analyzed by IGV visualization. Figure 2 The results show that: S1 K247Q The translation level of RelA was significantly enhanced.

[0050] Based on the above results, the spoT promoter and the SBS-RBS sequence of relA were combined to obtain a combined CMDE element with high transcription and translation activity, the nucleotide sequence of which is shown in SEQ ID NO: 1, specifically:

[0051]

[0052]

[0053] The sequence marked with a curve represents the promoter sequence; the sequence marked with a straight line represents the SBS-RBS sequence, as shown in the schematic diagram Figure 3 shown.

[0054] Example 2 Combining CMDE elements to enhance the yield of pine tin

[0055] (1) Construction of plasmid

[0056] Using the wild-type strain MG1655 genomic DNA as a template, the primers CMDE-F / R were used to amplify the gene fragment CMDE; using the plasmid pR-T7-HisPstrsts2-Sc4cl-Pcpal1 (kindly donated by Jan Marienhagen Laboratory, referred to as T7-Pinosylvin, disclosed in the document "Metabolic engineering of Escherichia coli for the synthesis of the plant polyphenol pinosylvin", and promised to be released to the outside for 20 years) as a template, primers pR-F / R were used as primers to amplify the linear plasmid vector pR and primers pR-F / R1 were used as primers to amplify the linear plasmid vector pR1. The gene fragment of the combined CMDE element (SEQ ID NO: 1) was recombined and transformed with the linear plasmid vectors pR and pR1 to obtain plasmid pR-CMDE-HisPstrsts2-Sc4cl-Pcpal1 (abbreviated as T7+CDME-Pinosylvin) and plasmid pR-CMDE-HisPstrsts2-Sc4cl-Pcpal1-1 (abbreviated as CDME-Pinosylvin). T7+CDME-Pinosylvin, CDME-Pinosylvin and T7-Pinosylvin were transformed into competent cells of Escherichia coli BL21 (DE3) to obtain different recombinant BL21 (DE3) strains. The specific primer information is shown in Table 2.

[0057] Table 2 Detailed information of primers CMDE-F / R, primers pR-F / R and primers pR-F / R1

[0058]

[0059] (2) Liquid chromatography determination of pine tin

[0060] The different recombinant BL21(DE3) strains obtained in step (1) were cultured overnight at 37°C. 1 mL of the overnight culture solution was added to 200 mL of LB and cultured at 37°C and 220 rpm for about 3 h. When the culture OD 600 When the concentration reached 0.6, 1 mM IPTG was added to induce the expression of the heterologous gene, and 15 μM cerulenin (a fatty acid synthesis inhibitor) was added to promote the transfer of carbon flow to malonyl-CoA and increase the yield of safflower oil.

[0061] Cultivate at 27°C for another 36 hours to obtain the fermentation broth; centrifuge at 4°C and 8000 rpm for 5 minutes to obtain the supernatant of the fermentation sample. Take 200 μL of the supernatant of the fermentation sample and mix it with the same volume of acetonitrile, vortex for 2 minutes, centrifuge at 12000 rpm for 5 minutes, and then filter the supernatant after centrifugation into the inner tube of the liquid injection bottle with a 0.22 μm organic phase filter. Set the injection needle to take 80 μL of the filtrate into the reverse phase C 18 Chromatographic column (Diamonsil Plus 5μm C 18 -A, 250×4.6 mm, DiKMA), the detection wavelength of the UV detector (SHIMAZDU) was 308 nm.

[0062] The two mobile phase solvents were buffer A (96.96 / 0.04, water / formic acid, v / v) and buffer B (acetonitrile). The initial gradient was 98% (v / v) solvent A and 2% (v / v) solvent B, with a flow rate of 1 mL / min. After 10 min, solvent B was gradually increased to 70% (v / v); after 15 min, solvent B was gradually decreased to 2% (v / v) and maintained until 16 min.

[0063] According to the concentration of Pinosylvin in the fermentation broth, the appropriate concentration for preparing the standard curve was selected, and finally the standard curve between the mass and peak area of ​​Pinosylvin was obtained, such as Figure 7 As shown, the standard curve of pine tin is Y = 59823x, R 2 =0.9999. The concentration of styraxine in the fermentation broth was further accurately calculated based on the standard curve. The results are as follows: Figure 4 The experimental results showed that the addition of combined CMDE elements significantly enhanced the yield of red pine tin.

[0064] Example 3 Combining CMDE elements to enhance the production of p-coumaric acid and cinnamic acid

[0065] (1) Plasmid construction

[0066] First, the laboratory-preserved strain pPROBE-sfGFP (published in the document "Acylation driven by intracellular metabolites in host cells inhibits Cas9 activity used for genome editing" and promised to be released to the public for 20 years) was used as a template, and the gene fragment sfGFP fragment was amplified using primers GFP-F / R; using the plasmid pET28a-RgTAL1 (preserved in this laboratory, referred to as T7-pinosylvin, published in the document "Metabolically engineering of Yarrowia lipolytica for the biosynthesis of naringenin from a mixture of glucose and xylose", and promised to be released to the public for 20 years) as a template, the linear plasmid vector A was amplified using primers pET28a-F / R, and the gene fragment sfGFP and the linear plasmid vector A were recombined to obtain the plasmid pET28a-RgTAL1-sfGFP-A (referred to as T7-Coumaric / cinnamic acid, published in the document "Metabolically engineering of Yarrowia lipolytica for the biosynthesis of naringenin from a mixture of glucose and xylose" and promised to be released to the public for 20 years) The wild-type strain MG1655 genomic DNA was used as a template to amplify the gene fragment CMDE using primers CMDE-F / R (Table 2); the plasmid pET28a-RgTAL1-sfGFP was used as a template to amplify the linear plasmid vectors pET28a-B and pET28a-C using primers pET28a-F1 / R1 and pET28a-F1 / R2, respectively. The gene fragment of the combined CMDE element (SEQ ID NO: 1) was recombined and transformed with the linear plasmid vectors pET28a-B and pET28a-C to obtain plasmids pET28a-CMED-RgTAL1-sfGFP-B (abbreviated as T7+CDME-p-Coumaric / cinnamic acid) and pET28a-CMED-RgTAL1-sfGFP-C (abbreviated as CDME-p-Coumaric / cinnamic acid); the primers used are shown in Table 3.The three successfully constructed plasmids (T7+CDME-p-Coumaric / cinnamic acid, CDME-p-Coumaric / cinnamic acid and T7-Coumaric / cinnamicacid) were transformed into competent cells of Escherichia coli BL21 (DE3) to obtain recombinant BL21 (DE3) strains. The growth curves and sfGFP reporter genes of the recombinant BL21 (DE3) strains successfully transformed with the three plasmids were investigated, and the results are as follows. Figure 5 The results showed that after loop induction, we observed significantly enhanced fluorescence in the circuit containing the CMDE element relative to the T7-only control, and the circuit containing the CMDE element alone maintained similar reporter activation as the coupled circuit (integrated T7 promoter and CMDE element).

[0067] Table 3 Detailed information of primers GFP-F / R, primers pET28a-F / R and pET28a-F1 / R1

[0068] Primer name Primer number sequence GFP-F SEQ ID NO: 13 ATGCGTAAAGGCGAAGAGCT GFP-R SEQ ID NO: 14 AGCCAACTCAGCTTCCTTTCTTTGTACAGTTCATCCAAAC pET28a-F SEQ ID NO: 15 GAAAGGAAGCTGAGTTGGCT pET28a-R SEQ ID NO: 16 AGCTCTTCGCCTTTACGCATGTGGTGGTGGTGGTGGTGGG pET28a-F1 SEQ ID NO: 17 GGTCCCTAAAGGAGAGGACGATATACCATGGGCAGCAGCC pET28a-R1 SEQ ID NO: 18 TTATGCATCCGGTTGCCCATGGTATATCTCCTTCTTAAAG pET28a-R1 SEQ ID NO: 19 TTATGCATCCGGTTGCCCATATTTCGCGGGATCGAGATCT

[0069] (2) Fluorescence measurement

[0070] Each recombinant BL21(DE3) strain was cultured in LB for different culture times (see Figure 5 ) Take 200 μL of bacterial solution, centrifuge at 12000 rpm for 5 minutes, remove the supernatant, and add the volume of water to resuspend according to the amount of bacteria to obtain the resuspended sample. For example, if the initial amount of bacteria is small, 200 μL of water can be added; if the amount of bacteria is large in the later stage, 600 μL of water can be added. The calculation of fluorescence in the later stage needs to be multiplied by the dilution multiple. Culture for about 5 hours until OD 600 When the concentration of IPTG was 0.6, 1 mM IPTG was added and the culture was continued at 37°C. Samples were taken at the corresponding culture time, and 100 μL of the bacterial solution after IPTG culture was pipetted into a black opaque 384-well plate with reference to the above treatment method, and the fluorescence value was measured using an ELISA reader.

[0071] (3) Liquid chromatography determination

[0072] Each recombinant BL21(DE3) strain was cultured in LB until OD 600 The concentration of cinnamic acid or p-coumaric acid standard and samples taken at different times in the previous step (2) were measured by a reverse phase C 18 Chromatographic column (Diamonsil Plus 5μm C 18 -A, 250×4.6 mm, DiKMA) and the liquid phase of HPLC (SHIMAZDU) with UV-visible detector.

[0073] During the HPLC analysis, phase A was ammonium formate solution (20 mM, pH 3) and phase B was acetonitrile. The initial acetonitrile gradient was 2% (v / v), which linearly increased to 40% (v / v) after 10 min, linearly decreased to 20% (v / v) after 15 min, and decreased to 2% (v / v) after 18 min, and maintained for 20 min. During the whole process, the column temperature was maintained at 40 ° C, and the flow rate was 1 mL / min. The detection of cinnamic acid (Ca) or p-coumaric acid (p-CA) adopted an excitation wavelength of 289 nm. The HPLC peak area was determined according to the standard curve, and the concentration (such as Figure 8 ), the standard curve of p-coumaric acid is Y=59948x, R 2 =0.9991, the standard curve of cinnamic acid is Y=6744x, R 2 =1. The result is Figure 6 The results showed that the addition of the combined CMDE element significantly enhanced the production of cinnamic acid and p-coumaric acid, increasing them to 230 mg / L and 79 mg / L, respectively.

[0074] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a combined CMDE element or a material containing a combined CMDE element in enhancing gene expression in Escherichia coli, characterized in that: The nucleotide sequence of the combined CMDE element is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The materials include transcription and translation expression boxes, recombinant vectors and recombinant bacteria.

3. Use of a combined CMDE element or a material containing a combined CMDE element in preparing exogenous protein or a product for producing exogenous protein in Escherichia coli, characterized in that: The nucleotide sequence of the combined CMDE element is shown in SEQ ID NO.

1.

4. The use according to claim 3, characterized in that: The materials include transcription and translation expression boxes, recombinant vectors and recombinant bacteria.

5. The use according to claim 3, characterized in that: The product includes a reagent or a kit.

6. A method for enhancing transcription and translation of a target gene, characterized in that: The method comprises the steps of introducing a vector operably linked to a combined CMDE element and a target gene into a basic bacterium to enhance the transcription and translation level of the target gene in the basic bacterium; The nucleotide sequence of the combined CMDE element is shown in SEQ ID NO.1; The basic bacteria is Escherichia coli.

7. Use of a combined CMDE element or a material containing a combined CMDE element in producing flavonoids in Escherichia coli or in preparing a product for producing flavonoids, characterized in that: The nucleotide sequence of the combined CMDE element is shown in SEQ ID NO.

1.

8. The use according to claim 7, characterized in that: The materials include transcription and translation expression boxes, recombinant vectors and recombinant bacteria.

9. The use according to claim 7, characterized in that: The flavonoids include one or more of pinot nobilis, p-coumaric acid and cinnamic acid.

10. A method for producing flavonoid compounds, characterized in that: The method comprises the steps of culturing recombinant bacteria containing the combined CMDE elements and collecting the produced flavonoid compounds; The nucleotide sequence of the combined CMDE element is shown in SEQ ID NO.1; The basic bacteria of the recombinant bacteria is Escherichia coli.

Images