Soybean GmSBT1.2b gene and application of soybean GmSBT1.2b gene in increasing number of soybean root nodules and increasing yield of soybean root nodules
By overexpressing the GmSBT1.2b gene in soybeans, the number of soybean rhizombia was significantly increased, the problem of unknown function of subtilisin in the prior art was solved, and the yield of soybeans was improved.
Patent Information
- Application Number
- CN202411304359.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-19
- Publication Date
- 2024-12-20
AI Technical Summary
The prior art has not fully understood the function of subtilisin in legume plants, especially its role in increasing the number and yield of soybean rhizombia.
Soybean GmSBT1.2b gene and its overexpression vector are provided. By transforming Agrobacterium rhizobium, the overexpression of the GmSBT1.2b gene is achieved, thereby significantly increasing the number of soybean rhizobium and enhancing the nodular nitrogen fixation capacity and yield of soybeans.
For the first time, the role of GmSBT1.2b in regulating the number of nodules in soybeans was demonstrated. The number of nodules in soybeans was significantly increased through overexpression technology, enhanced the nitrogen fixation ability of soybeans, and thus increased the yield of soybeans.
Smart Images
Figure CN119162210A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of gene engineering, and in particular relates to a soybean GmSBT1.2b gene and application thereof in improving the number of soybean nodules and yield. Background Art
[0002] Soybean is an important grain and oil economic crop. Through its nodules, it can convert nitrogen in the air into ammonia nitrogen that can be absorbed and utilized by plants, thus providing the necessary nitrogen nutrition for soybean growth and development. The symbiotic nitrogen fixation process mediated by nodules not only affects the normal growth and yield of soybeans, but also helps save energy and reduce environmental chemical pollution. At present, improving the efficiency of symbiotic nitrogen fixation has become one of the important ways to increase soybean yield and ensure the sustainable development of agriculture.
[0003] Symbiotic nitrogen fixation mainly refers to the process of interaction between rhizobia and plants. Specifically, under low nitrogen conditions, leguminous plants secrete flavonoids into the soil, attracting rhizobia in the soil to approach the roots of plants. Rhizobia attach to the root hairs, stimulating the deformation of the root hairs and forming infection lines. Rhizobia enter plant cells through infection lines, induce cell division in the cortex, endoderm and pericycle, and then form nodule primordia, and finally form nodules with nitrogen fixation ability. NIN plays a vital role in every process of symbiotic nitrogen fixation.
[0004] Subtilases (SBTs) are a class of serine peptidases that are widely found in both eukaryotes and prokaryotes. Subtilases play an important role in plants. SBTs are involved in a variety of biological processes, such as: SBTs can act as a regulator of plant immune responses. The first plant SBT cloned and identified from higher plants to participate in plant defense is P69; SBTs also contribute to root development, stem cell maintenance, and reproductive development; SBTs can promote flower organ abscission, etc. Subtilases can mediate plant-microorganism interactions. In recent years, it has been found that a class of subtilases is induced by NIN and by rhizobia in early root hairs. However, its specific function in leguminous plants is still unknown. Summary of the invention
[0005] In view of this, the object of the present invention is to provide a soybean GmSBT1.2b gene and its application in increasing the number of soybean nodules and yield.
[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0007] The present invention provides a soybean GmSBT1.2b gene, and the nucleotide sequence of the GmSBT1.2b gene is shown as SEQ ID NO:1.
[0008] The present invention also provides a protein encoded by the soybean GmSBT1.2b gene, and the amino acid sequence of the protein is shown in SEQ ID NO:2.
[0009] The present invention also provides a recombinant vector for overexpressing the soybean GmSBT1.2b gene, characterized in that it comprises a BS2 vector and the GmSBT1.2b gene.
[0010] The present invention also provides the use of over-expressing the soybean GmSBT1.2b gene in increasing the number of soybean nodules.
[0011] The present invention also provides the use of overexpressing the soybean GmSBT1.2b gene in improving soybean yield.
[0012] Preferably, the method for overexpressing the soybean GmSBT1.2b gene comprises the following steps:
[0013] Cloning the soybean GmSBT1.2b gene into the BS2 vector to obtain the recombinant vector;
[0014] The obtained recombinant vector is transformed into Agrobacterium rhizogenes, and the transformed Agrobacterium rhizogenes is used to infect seeds to obtain transgenic complex plants, thereby achieving overexpression of the GmSBT1.2b gene.
[0015] Preferably, the Agrobacterium rhizogenes is Agrobacterium rhizogenes K599.
[0016] Compared with the prior art, the present invention has the following beneficial effects:
[0017] The present invention identified a class of GmSBT1.2s family members whose expression was induced by rhizobia infection, and proved for the first time that GmSBT1.2b in soybean can regulate soybean nodulation, and overexpression of GmSBT1.2b can significantly increase the number of soybean nodules. This study confirmed for the first time the role of the GmSBT1.2s gene in soybean in positively regulating the number of soybean nodules. This discovery has important guiding value for using the overexpression vector constructed in this study to cultivate GmSBT1.2b overexpressing plants through genetic transformation technology. In this way, the nodulation and nitrogen fixation ability of soybeans can be enhanced, thereby increasing the yield of soybeans. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 To analyze the expression pattern of GmSBT1.2b in early response to rhizobium infection;
[0019] Figure 2 This is the expression level diagram of soybean roots of GmSBT1.2b overexpressing hairy root transformed plants and wild-type plants;
[0020] Figure 3 This is a visual diagram of the number of nodules on the soybean roots of GmSBT1.2b-overexpressing hairy root transformed plants and wild-type plants;
[0021] Figure 4 This is a statistical chart showing the number of nodules on the roots of soybean plants transformed with GmSBT1.2b overexpressing hairy roots and wild-type plants. DETAILED DESCRIPTION
[0022]
[0023] The present invention also provides a protein encoded by the soybean GmSBT1.2b gene, and the amino acid sequence of the protein is shown in SEQ ID NO: 2, which is MFKAHRTKEALLPFPSSRKLLLNMDAFLFIVFTFVLSFQTHFAQGSELPRTTSSSKTYIIHVKGPQDKSLDQTEDLESWYHSFMPPTIMSSEEQPRMIYSYLNVMSGFAARLTEEELIAVEKKDGFISARPERILHRQTTNTPQFLGLQKQTG.
[0024] The present invention also provides a recombinant vector for overexpressing the soybean GmSBT1.2b gene, comprising a BS2 vector and the GmSBT1.2b gene. In the present invention, the BS2 vector is connected to a 35S promoter.
[0025] The present invention also provides the use of over-expressing the soybean GmSBT1.2b gene in increasing the number of soybean nodules.
[0026] The present invention also provides the use of overexpressing the soybean GmSBT1.2b gene in improving soybean yield.
[0027] In the present invention, the method for overexpressing the soybean GmSBT1.2b gene comprises the following steps:
[0028] Cloning the soybean GmSBT1.2b gene into the BS2 vector to obtain the recombinant vector;
[0029] The obtained recombinant vector is transformed into Agrobacterium rhizogenes, and the transformed Agrobacterium rhizogenes is used to infect seeds to obtain transgenic complex plants, thereby achieving overexpression of the GmSBT1.2b gene; the Agrobacterium rhizogenes is preferably Agrobacterium rhizogenes K599.
[0030] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0031] Example 1
[0032] Construction of soybean GmSBT1.2b vector
[0033] (1) The GmSBT1.2b sequence was obtained through the soybean database, and primers were designed. The primer sequences (the underlined sequences are the corresponding restriction sites and protective bases) are:
[0034] GmSBT1.2b-BS2-F:GGAGAGAACACGGGGGAC TCTAGA ATGTTCAA AGCACACC GAAC(SEQ IDNO:3);
[0035] GmSBT1.2b-BS2-R:CTCGCCCTTGCTCACCAT GGATCC TACAAAGCT GATCGAGATAGGG(SEQID NO:4);
[0036] (2) Fragment amplification
[0037] Williams 82 soybean RNA was extracted and converted into cDNA using reverse transcriptase. The cDNA was used as a template and amplified using the primers designed above to obtain the target fragment.
[0038] (3) Recovering the target fragment
[0039] The amplified fragments were subjected to agarose gel electrophoresis, the gel with the target fragment was cut with a knife and placed in a centrifuge tube, and the PCR product was recovered using an agarose gel DNA recovery kit.
[0040] (4) Connect the target fragment to the BS2 vector
[0041] The vector plasmid BS2 was extracted, and the target fragment was connected to the BS2 vector by homologous recombination using restriction enzymes XbaI and BamHI, and then transformed into Escherichia coli DH5α.
[0042] (5) Transformation of target fragment into Agrobacterium rhizogenes K599
[0043] The BS2 plasmid containing the target fragment was extracted from Escherichia coli DH5α, transformed into Agrobacterium K599, and after correct identification, stored in a -80°C ultra-low temperature refrigerator for use.
[0044] Example 2: Soybean hairy root transformation
[0045] 1) Agrobacterium inoculation
[0046] Agrobacterium rhizogenes K599 carrying the target fragment vector was expanded in 50 mL LB liquid medium (with kanamycin and streptomycin) and cultured overnight at 200 rpm at 28°C. The bacterial solution was centrifuged at 4500 rpm for 10 minutes, the supernatant was discarded, and the bacterial solution was resuspended in liquid co-culture medium (CCM) to an OD of 600 The value is around 0.8.
[0047] 2) Co-culture
[0048] Use a sterilized scalpel to cut the germinated seeds from the hypocotyl about 0.5 cm away from the cotyledon node, place them in the prepared liquid co-culture medium (CCM) containing the bacterial solution, shake gently at 150 r / min on a shaker at room temperature for one hour, then place the explants on solid CCM and co-culture with Agrobacterium in the dark for three days.
[0049] 3) Soil movement
[0050] After co-cultivation, the explants were moved to vermiculite soaked in low-nitrogen nutrient solution and covered with a film to keep moisture. The film was removed about six days after transplanting.
[0051] 4) Rhizobium treatment
[0052] Bradyrhizobium diazoefficiens strain USDA110 (donated by Professor Cao Yangrong's research group at the College of Life Sciences and Technology, Huazhong Agricultural University) was cultured in TY medium until the exponential growth phase (OD 600 =0.6-0.8), and diluted with ddH2O to OD600 = 0.08. Each soybean plant was watered with 30 mL of diluted bacterial solution from the root.
[0053] Sample and perform root statistics of single hairy roots.
[0054] The explants were sampled 21 days after inoculation, and a single hairy root was sampled. Each hairy root was numbered and divided into two parts for DNA and RNA extraction. The number of nodules in each hairy root was counted before sampling.
[0055] 5) DNA and RNA extraction
[0056] The samples were used to extract DNA using CTAB reagent, and the transgenic roots were detected and identified using GFP primers. The primer sequences were:
[0057] F:CAAGCAGAAGAACGGCATCAAG (SEQ ID NO:5);
[0058] R: GACCATGTGATCGCGCTTCTC (SEQ ID NO: 6).
[0059] TRIpure Reagent was used to extract RNA from positive hairy root samples.
[0060] 6) Reverse transcription and quantitative detection
[0061] RNA reverse transcriptase was used to convert it into cDNA; qPCR detection was performed using the designed gene expression detection primers, and the primer sequences are as follows:
[0062] GmSBT1.2b-F:ATGCTCTAAAGTCTGTCGAGAG (SEQ ID NO:7);
[0063] GmSBT1.2b-R:GTTAATTACGGAACCAGGGAGA (SEQ ID NO:8).
[0064] The number of single hairy root nodules in the successfully overexpressed materials was further analyzed and compared with the control group to draw conclusions.
[0065] Result analysis: The results are as follows Figures 1 to 4 And as shown in Table 1.
[0066] Table 1 Expression level of GmSBT1.2b in response to rhizobium infection
[0067]
[0068]
[0069] Depend on Figures 1 to 4 As shown in Table 1, GmSBT1.2b was induced by rhizobia in the early stage. Compared with the control group, the number of nodules in the hairy root material overexpressing GmSBT1.2b was significantly increased.
[0070] It can be seen from the above examples that the present invention is the first to prove that GmSBT1.2b in soybean is involved in regulating soybean nodulation, and overexpression of GmSBT1.2b can significantly increase the number of soybean nodules.
[0071] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A soybean GmSBT1.2b gene, characterized in that: The nucleotide sequence of the GmSBT1.2b gene is shown in SEQ ID NO:
1.
2. The protein encoded by the soybean GmSBT1.2b gene according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO:
2.
3. A recombinant vector for overexpressing the soybean GmSBT1.2b gene according to claim 1, characterized in that: Includes BS2 vector and GmSBT1.2b gene.
4. Use of overexpressing the soybean GmSBT1.2b gene according to claim 1 in increasing the number of soybean nodules.
5. Use of overexpressing the soybean GmSBT1.2b gene according to claim 1 in increasing soybean yield.
6. The use according to claim 4 or 5, characterized in that: The method for overexpressing the soybean GmSBT1.2b gene comprises the following steps: Cloning the soybean GmSBT1.2b gene into the BS2 vector to obtain the recombinant vector according to claim 3; The obtained recombinant vector is transformed into Agrobacterium rhizogenes, and the transformed Agrobacterium rhizogenes is used to infect seeds to obtain transgenic complex plants, thereby achieving overexpression of the GmSBT1.2b gene.
7. The use according to claim 6, characterized in that: The Agrobacterium rhizogenes is Agrobacterium rhizogenes K599.