Cloning and application of maize kernel size gene ZmTRX1

Abstract

The application discloses a protein ZmTRX1 related to corn kernel development and application thereof, and focuses on genetic mechanism of corn kernel development. The application specifically discloses application of a protein, a substance for regulating gene expression of the protein or a substance for regulating activity or content of the protein in regulating plant kernel size and / or preparing a product for regulating plant kernel size and / or plant breeding and / or preparing a plant breeding product, wherein the protein is a protein shown in sequence 3 in a sequence table. The application finds and clones a corn histone methyltransferase gene ZmTRX1, and prepares two EMS mutant plant strains of the ZmTRX1 gene. The gene mutation leads to abnormal development of corn kernels, and the kernels are small and the hundred-grain weight is significantly reduced. The application provides a new clue for studying genetic characteristics of corn kernel development, promotes in-depth research on a molecular mechanism of corn kernel development, and provides a new gene resource for improving kernel size and crop yield.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and relates to the cloning and application of a maize kernel size gene, ZmTRX1. Background Technology

[0002] Maize (Zea mays), a globally important food crop, possesses extremely high economic and ecological value. Its kernels contain 70% starch, 10% protein, and 4% oil. These components not only provide crucial nutrients for seed germination and early seedling growth but also serve as a primary source of raw materials for animal feed and ethanol production. Kernel development is a complex biological process influenced by multiple genetic and environmental factors, directly impacting yield and quality. Researching maize kernel size and composition is key to gaining a deep understanding of its developmental mechanisms, thereby improving yield and quality—crucial for food security and sustainable agricultural development.

[0003] As the corn embryo begins to form its initial structure, the endosperm also develops, providing essential nutrients to the embryo. During embryonic development, cell division and expansion promote the formation of parts such as roots, stems, and leaves. The endosperm is the part of the corn kernel responsible for storing nutrients and is crucial for the growth of the entire kernel. During the endosperm development stage, endosperm cells proliferate rapidly and accumulate energy storage substances such as starch, protein, and fat. During the kernel enlargement stage, with the rapid growth of the endosperm, the kernel volume increases significantly, and cells continue to expand and differentiate. Under conditions of sufficient water and nutrients, the kernel expands rapidly, eventually forming a complete kernel structure. Entering the ripening stage, the nutrient supply from the endosperm gradually decreases, and the moisture content of the kernel drops, usually below 30%. During this process, the endosperm gradually dries, and the outer shell hardens, marking the beginning of kernel ripening. Mature kernels typically darken in color, and the outer shell becomes harder.

[0004] Maize kernel development involves three key processes: embryonic development, endosperm cell differentiation, and the accumulation of stored substances, all of which are regulated by numerous genes. Maize kernel mutants are broadly classified into the following categories based on the location of the defect: embryo defect mutants, endosperm defect mutants, mutants with abnormal embryos and endosperm, and ear budding mutants. Mutants with abnormal embryos and endosperm include small kernels, defective kernels, and empty percarps. Currently, researchers have cloned numerous genes related to kernel development. For example, several genes controlling maize kernel development and their biological functions have been identified. For instance, the ZmPPR protein reduces kernel weight by affecting photosynthesis; ZmEXPB15 controls kernel size and weight by interacting with ZmNAC11 / 29 to promote nucleated cell elimination. In addition, genes controlling kernel development, such as ZmGRAS11, opaque2, Smk11, crk2, dek, HSP90.6, and TaDA1, have also been identified. Therefore, it is crucial to elucidate the genetic basis of genes controlling maize kernel size and weight, and to gain a deeper understanding of the molecular mechanisms behind yield-related traits. Summary of the Invention

[0005] The purpose of this invention is to provide a protein related to the size of corn kernels, its encoding gene, and its applications.

[0006] This invention first protects the application of the ZmTRX1 protein, which can be divided into S1) or S2):

[0007] S1) Regulates plant seed size;

[0008] S2) Breed transgenic plants with altered seed size.

[0009] In the above applications, the ZmTRX1 protein is derived from maize (Zea mays L.) of the genus Zea, and is as follows: a1) or a2) or a3):

[0010] a1) The amino acid sequence is that of the protein shown in SEQ ID NO: 3;

[0011] a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3;

[0012] a3) Proteins related to plant seed size obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 3.

[0013] Of these, SEQ ID NO:3 consists of 1025 amino acid residues.

[0014] To facilitate the purification of the protein in a1), a tag as shown in Table 1 can be attached to the amino or carboxyl terminus of the protein shown in SEQ ID NO: 3.

[0015] Table 1. Sequence of Labels

[0016] Poly-Arg 5-6 (usually 5) RRRRR FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL

[0017] The protein in a3) above, wherein the substitution and / or deletion and / or addition of one or more amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0018] The proteins mentioned in a3) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0019] The gene encoding the protein in a3) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID NO: 2, and / or by performing a missense mutation on one or more base pairs, and / or by attaching the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0020] This invention also protects the application of nucleic acid molecules encoding the ZmTRX1 protein, which may be S1) or S2):

[0021] S1) Regulates plant seed size;

[0022] S2) Breed transgenic plants with altered seed size.

[0023] In the above applications, the nucleic acid molecule encoding the ZmTRX1 protein can be a DNA molecule as shown in b1), b2), b3), b4), or b5):

[0024] b1) The coding region is the DNA molecule shown in SEQ ID NO: 2;

[0025] b2) The nucleotide sequence is the DNA molecule shown in SEQ ID NO: 2;

[0026] b3) The nucleotide sequence is the DNA molecule shown in SEQ ID NO: 1;

[0027] b4) has 75% or more identity with the nucleotide sequence defined by b1) or b2) or b3) and is a DNA molecule encoding the TRX1 protein;

[0028] b5) hybridizes under stringent conditions with the nucleotide sequence defined by b1) or b2) or b3) and the DNA molecule encoding the ZmTRX1 protein.

[0029] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0030] Of these, SEQ ID NO:2 consists of 3078 nucleotides, and the nucleotides of SEQ ID NO:2 encode the amino acid sequence shown in SEQ ID NO:3.

[0031] Those skilled in the art can readily mutate the nucleotide sequence encoding the ZmTRX1 protein of this invention using known methods, such as directed evolution and point mutation. Any artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of the ZmTRX1 protein isolated according to this invention, as long as they encode the ZmTRX1 protein, are derived from and equivalent to the nucleotide sequence of this invention.

[0032] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the ZmTRX1 protein shown in SEQ ID NO: 3 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0033] In any of the above-described applications, the regulation of plant seed size can be achieved by increasing or decreasing seed size.

[0034] In any of the above-described applications, the cultivation of transgenic plants with altered seed size can be either the cultivation of transgenic plants with increased seed size or the cultivation of transgenic plants with decreased seed size.

[0035] The present invention also protects a method for cultivating transgenic plants, which may include the following steps: reducing the expression level and / or activity of the ZmTRX1 protein in the starting plant to obtain a transgenic plant; the transgenic plant has smaller seeds compared to the starting plant.

[0036] In the above method, the "reduction of the expression level and / or activity of the ZmTRX1 protein in the starting plant" can be achieved by methods well known in the art, such as RNA interference, homologous recombination, and site-directed gene editing, to reduce the expression level and / or activity of the ZmTRX1 protein in the starting plant.

[0037] In the above method, the "reduction of the expression level and / or activity of the ZmTRX1 protein in the starting plant" can be specifically achieved by introducing a plant genome editing vector into the starting plant;

[0038] The vector for plant genome editing contains an sgRNA-encoding gene;

[0039] The target DNA recognized by the sgRNA in plants is a DNA fragment encoding the ZmTRX1 protein.

[0040] In the above method, the vector for plant genome editing may also contain the gene encoding the Cas9 protein. Attached Figure Description

[0041] Figure 1 This section presents a domain and phylogenetic analysis of ZmTRX1. A shows the protein structure of ZmTRX1 from maize. B shows a phylogenetic tree analysis of TRX1 proteins in representative plants: Maize (Zm; Zea mays); Arabidopsis thaliana (At; Arabidopsis thaliana); Rice (Os; Oryza sativa); Sorghum (Sb; Sorghum bicolor); Millet (Si; Setaria italica); Brachypodium distachyon (Bd; Brachypodium distachyon); Populus trichocarpa (Pt; Populus trichocarpa).

[0042] Figure 2 This is a schematic diagram of the mutation sites in the EMS mutant materials trx1-1 (left) and trx1-2 (right) of maize ZmTRX1.

[0043] Figure 3 Phenotypic comparison of the ZmTRX1 mutants trx1-1 and trx1-2 with the wild type. A to B represent self-pollinated ears of trx1-1 / +(A) and trx1-2 / +(B). Mutant seeds are indicated by arrows. Bar = 1 cm. C shows a phenotypic comparison of mature kernels in wild-type WT, mutant trx1-1, and mutant trx1-2. Bar = 1 cm. D shows the 100-kernel weight of mature kernels in wild-type WT, mutant trx1-1, and mutant trx1-2. Error bars represent ±SD (n = 50 per ear). Three independent measurements were performed using different ears; ***P < 0.001, Student's t-test. Detailed Implementation

[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0045] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0046] The following examples used EXCEL statistical software to process the data. The experimental results are expressed as mean values, and the T-test was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0047] The B73 mutant involved in this invention can be obtained from the maize EMS-induced mutant library (http: / / maizeems.qlnu.edu.cn / ).

[0048] The mutants trx1-1 and trx1-2 of maize ZmTRX1 were collected and preserved in our laboratory.

[0049] Maize genome sequencing information is referenced from the MaizeGDB database, which can be found at: http: / / www.maizegdb.org / .

[0050] Example 1: Cloning, domain and phylogenetic analysis of the ZmTRX1 gene

[0051] 1. The CDS sequence of the ZmTRX1 gene in maize was cloned. The target band, as detected by electrophoresis, was approximately 3000 bp in length, consistent with the 3078 bp CDS sequence retrieved from the maize genome annotation database MaizeGDB, indicating that the target gene had been preliminarily identified. Sequencing results showed that this sequence was consistent with the CDS sequence of the ZmTRX1 gene (Zm00001d019907) retrieved from MaizeGDB. A search in the MaizeGDB database revealed that the ZmTRX1 gene is located on chromosome 7 of maize, includes 24 exons, and encodes 1025 amino acids. SMART (http: / / smart.embl-heidelberg.de / ) was used to predict the protein structure and function. The results showed that ZmTRX1 has one conserved C-terminal histone methyltransferase domain, two histone H3-binding domains, and one DNA-binding domain, etc. Figure 1 A) indicates that the gene encodes a protein associated with histone modification.

[0052] 2. Phylogenetic analysis was performed on the maize ZmTRX1 protein XP_008651793 and its homologous proteins from seven species: Arabidopsis thaliana (At), rice (Os), sorghum (Sb), millet (Si), Brachypodium distachyon (Bd), and poplar (Pt). Multiple sequence alignment of the nine proteins was performed using the ClustaW method on MEGA11, followed by neighbor-joining to construct a phylogenetic tree. The results are shown in the figure. Figure 1 B) The maize ZmTRX1 protein is most closely related to the sorghum SbTRX1 protein, with an amino acid sequence similarity of 92.68%, while its phylogenetic relationship with dicotyledonous plants such as rice and Arabidopsis is relatively distant.

[0053] Example 2: Construction of mutant materials of gene ZmTRX1

[0054] Two independent EMS mutants of the Zm00001d019907 gene with a B73 background, namely EMS4-0972b6 and EMS4-09728f, were obtained from the maize EMS-induced mutant library (http: / / maizeems.qlnu.edu.cn / ). These mutants are sold by the mutant library MEMD and are available to the public. According to the MEMD website, the mutation site of mutant EMS4-0972b6 is located in exon 13 of ZmTRX1, causing a mutation from G to A at 1790 bp of the CDS sequence. This alters the encoded protein, changing from Gly to Asp, resulting in abnormal gene function. Sanger sequencing results confirm that the mutation site is consistent with the description. The mutation site of mutant EMS4-09728f occurs in exon 24, located at 2956 bp of the CDS sequence, causing a mutation from C to T. This prematurely terminates the translation of the encoded protein, resulting in loss of gene function. Sanger sequencing results are consistent with the description. Figure 2 The EMS4-0972b6 and EMS4-09728f mutant materials obtained above were backcrossed with wild-type maize B73 material. After three generations of backcrossing, BC3F1 generation seeds were obtained. Then, the materials were selfcrossed once to obtain BC3F2 generation seeds, and the seeds were retained.

[0055] Primer sequences:

[0056] Sequencing primers for the ZmTRX1 mutant EMS4-0972b6:

[0057] ZmTRX1-EMS(b6)-F:GATCTGGACTATTGCAATGTTTG

[0058] ZmTRX1-EMS(b6)-R:CCATATAGCACATGCGAGATG

[0059] Sequencing primers for the ZmTRX1 mutant EMS4-09728f:

[0060] ZmTRX1-EMS(8f)-F:AGCTGTCAGCCGATGAGTATC

[0061] ZmTRX1-EMS(8f)-R:CCTCGGATCGAACCAGCCTA

[0062] Example 3: Functional verification of gene ZmTRX1

[0063] The homozygous grain mutants of the constructed ZmTRX1 gene, EMS4-0972b6 and EMS4-09728f, were named trx1-1 and trx1-2, respectively. After self-pollination of the heterozygous plants trx1-1 / + and trx1-2 / +, BC3F2 generation seeds were obtained. Observation of the ear and mature grain phenotypes revealed that both trx1-1 and trx1-2 exhibited abnormal grain development compared to normal maize grains. Figure 3 From A to 3C, the seeds of trx1-1 were significantly smaller, while the trx1-2 phenotype was even more pronounced, with shriveled seeds. The 100-seed weight of the two mutant types was only 64% and 19% of that of the wild type, respectively. Figure 3 D). This phenomenon was observed to be consistent in phenotype in Beijing and Hainan for three consecutive years. The mutation of ZmTRX1 significantly affected grain development, indicating that the ZmTRX1 gene is involved in regulating the development process of maize grains.

[0064] Based on the research results of the above embodiments, it can be seen that the ZmTRX1 gene in this invention is a gene that controls the development of maize kernels. Its mutation can lead to abnormal development of maize kernels and can be utilized in the process of maize seed production.

Claims

1. The application of reducing the expression level of ZmTRX1 protein in the starting plant in reducing seed size; characterized by: The plant is corn; the ZmTRX1 protein is a protein with the amino acid sequence shown in SEQ ID NO:

3.

2. The application as described in claim 1, characterized in that: The nucleic acid molecule encoding the ZmTRX1 protein is a DNA molecule as shown in b1), b2), or b3) below: b1) the coding region is the DNA molecule shown in SEQ ID NO: 2; b2) the nucleotide sequence is the DNA molecule shown in SEQ ID NO: 2; b3) the nucleotide sequence is the DNA molecule shown in SEQ ID NO:

1.

3. A method for cultivating transgenic plants, comprising the following steps: reducing the expression level of the ZmTRX1 protein as described in claim 1 in a starting plant to obtain a transgenic plant; the transgenic plant has smaller grain size compared to the starting plant; the plant is corn.

4. A plant breeding method, comprising the following steps: reducing the expression level of the ZmTRX1 protein as described in claim 1 in the starting plant, thereby reducing the grain size; wherein the plant is maize.

Images