Phage group enrichment method and kit and application thereof

Abstract

The invention provides a phage group enrichment method as well as a kit and application thereof, and belongs to the technical field of gene sequencing. According to the method, the phage group in the sample is enriched based on lysozyme and DNA binding dye, and then antibiotic is combined to inactivate bacteria and degrade DNA and RNA, so that the interference of the extracted bacteria DNA in the phage group is reduced, the total enrichment fraction of the established phage library is obviously improved, the ViromeQC concentration fraction of the phage library is greater than 10, and the application prospect is wide. The research requirement of a bacteriophage group is met, and the application value is wide.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene sequencing, and in particular relates to a phage group enrichment method, a kit and an application thereof. Background Art

[0002] There is a complex two-way interactive relationship between the intestinal microbiome and the human body, which is vital to life and health. It plays an important role in the digestion of food, absorption of nutrients, maintaining the balance of intestinal microecology, metabolism and immune response. The intestinal microbiota interacts with each other to maintain the dynamic balance of the intestinal environment. Ecological imbalance may be the main sign of chronic diseases. Recent studies have shown that the regulatory effect of viruses on intestinal microecology is no less than that of bacteria and fungi, and is one of the main factors affecting intestinal health. For a long time, people's understanding of viruses has been limited to their pathogenicity to humans. With the widespread application of microbiome, a large number of studies have shown that some viruses are not only harmless to the human body, but can have beneficial effects. At present, the important role of viruses in intestinal microecology has gradually been valued. The human intestinal virus group is mainly composed of prokaryotic viruses (i.e., bacteriophages), most of which are DNA viruses, showing rich diversity. The intestinal phages of healthy people are usually Caudovirales with double-stranded DNA, Microviridae and Inoviridae with single-stranded DNA. Toxic phages in the intestine are more common in patients with intestinal diseases.

[0003] A common method for measuring the enteric virus group (usually the phage group) that regulates bacteria in the intestine is metagenomic research based on high-throughput sequencing. Through metagenomic sequencing, the abundance of intestinal bacteria, fungi and viruses can be detected simultaneously. However, there are certain difficulties in detecting viruses through metagenomics. First, the amount of calculation is huge, which usually requires the support of a high-performance computing platform; second, the reliability is low, and the obtained viral sequences may be lost or present false positive sequences. For this reason, the academic community tends to use highly enriched viral isolates for metagenomic sequencing, which can minimize the interference of bacterial and fungal sequences and obtain more reliable phage groups. The current popular fecal supernatant phage enrichment schemes include one or more filtration sterilization schemes with different pore sizes based on volume differences, ultra-high-speed centrifugation schemes based on differences in centrifugal properties, and Dnase I and RNase A treatment schemes designed to degrade free (deoxy)ribonucleic acid. These schemes still result in a large amount of bacterial (fungal) DNA residues. This is reflected in the fact that in the high-throughput sequencing results after such processing, short sequences of bacteria (fungi) account for more than 95%, resulting in serious waste of sequencing throughput; and the enrichment score evaluated by ViromeQC is less than 3, and there is a large fluctuation between samples, which cannot be used as a reliable phage group result. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a kit for enriching a phage group, which can fully lyse bacteria and reduce the interference of bacterial DNA without affecting the activity of phages through the compounding of lysozyme and DNA binding dye, thereby achieving the purpose of phage enrichment.

[0005] The invention provides a kit for enriching a phage group, comprising lysozyme and a DNA binding dye.

[0006] Preferably, the DNA binding dye comprises propidium monoazide and / or ethidium bromide azide.

[0007] Preferably, the kit further comprises antibiotics and / or enzymes that degrade DNA and / or RNA.

[0008] Preferably, the antibiotics include penicillin and / or streptomycin;

[0009] Preferably, the enzyme that degrades DNA includes DNase I; and the enzyme that degrades RNA includes RNase A.

[0010] Preferably, it also includes virus concentration reagents and / or sample buffer;

[0011] Preferably, the virus concentration reagent includes a PEG virus concentrator;

[0012] Preferably, the sample buffer contains 100-200 mM NaCl, 5-10 mM MgSO 4 , 5~10mM CaCl 2 , an aqueous solution with a pH of 7 to 8 and a concentration of 50 to 100 mM Tris-HCl.

[0013] The present invention provides the use of the phage group enrichment kit in in vitro enrichment of phage groups.

[0014] The present invention provides a method for in vitro enrichment of a phage group based on the phage group enrichment kit, comprising the following steps:

[0015] Isolate microorganisms from samples to be tested;

[0016] Mixing the microorganism and lysozyme to lyse the microorganism to obtain a lysate;

[0017] The lysate is mixed and incubated with a DNA binding dye, photo-fixed, and the phage group is collected.

[0018] Preferably, the working concentration of the lysozyme is 100-200 μg / mL;

[0019] Preferably, before the mixed lysis, the microorganisms are inactivated by antibiotics; the antibiotics include penicillin and streptomycin; the working concentration of penicillin is 80-100 U / mL; the working concentration of streptomycin is 0.1-0.2 mg / mL;

[0020] Preferably, the working concentration of the DNA binding dye is 20-30 mM;

[0021] Preferably, the type of light in the photofixation includes blue light or white light; the power of the blue light is 60 to 100 W; the power of the white light is 450 to 600 W; the time of the photofixation is 10 to 15 min;

[0022] Preferably, after the photo-immobilization, the system further comprises separating the liquid phase; degrading the DNA and RNA in the liquid phase to collect the phage group;

[0023] More preferably, the method for degrading DNA and RNA is to use DNaseⅠ and RNaseA for degradation; the working concentration of DNaseⅠ is 100-200U / mL; the working concentration of RNase A is 15-20U / mL.

[0024] The present invention provides a kit for extracting DNA from enriched phage groups, comprising the components of the kit for enriching phage groups and a phage DNA extraction reagent;

[0025] Preferably, the phage DNA extraction reagent preferably includes commercial DNA extraction or DNA extraction reagent based on the "phenol-chloroform method".

[0026] The present invention provides application of the enriched phage group DNA extraction kit in the construction of a phage metagenomic library.

[0027] The present invention provides a kit for enriching a phage group, including lysosomes and DNA binding dyes. The principle of enriching phage groups in the kit is to utilize the characteristics of lysosomes that only lyse bacteria in the sample without affecting the activity of phages to lyse bacteria, so that the contents including DNA are released, and the DNA binding dye binds to bacterial DNA, so that even if the separated phage group has residual bacterial DNA, the DNA binding dye destroys the efficiency of bacterial DNA as an amplification template, thereby reducing the sequencing interference of bacterial DNA in the phage library, and achieving the purpose of phage enrichment. Experiments show that compared with conventional extraction methods, the present invention adopts the kit combined with lysozyme and DNA binding dye treatment to reduce the total DNA yield to less than 10%, and at the same time greatly reduces the proportion of bacterial DNA. At the same time, the overall enrichment score of the established phage library is significantly improved, and the overall enrichment score is increased from 1.79 to 10.8, which is increased by 6.14 times, meeting the requirements of phage group research and having a wide range of application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The electrophoresis results of bacterial 16s rDNA amplified using DNA extracted by different methods as templates;

[0029] Figure 2 Comparison results of phage groups from centenarians treated with different enrichment methods;

[0030] Figure 3 The electrophoresis results of bacterial 16s rDNA amplified using DNA extracted by two methods as templates; 1 is a negative control, 2 is a control group nucleic acid extracted by conventional phenol-chloroform extraction method, and 3 is a nucleic acid extracted using the kit of the present invention;

[0031] Figure 4 Comparison of phage enrichment fractions in DNA extracted using two methods. DETAILED DESCRIPTION

[0032] The invention provides a kit for enriching a phage group, comprising lysozyme and a DNA binding dye.

[0033] In the present invention, the DNA binding dye preferably includes propidium monoazide (PMA) and / or ethidium bromide azide (EMA). The DNA binding dye is a photoreactive DNA dye, has a high affinity with DNA, is inserted into free DNA or inserted into bacterial DNA through damaged bacterial cell walls, thereby affecting the amplification of DNA as a template. The lysozyme destroys the bacterial cell wall by hydrolyzing bacterial cell wall mucopolysaccharides, promotes the lysis of bacteria, and releases bacterial DNA and other contents. In an embodiment of the present invention, the lysozyme is purchased from Beijing Solebow Technology Co., Ltd., and the article number is L1080. The DNA binding dye (PMA) is purchased from Tianjin Baibei Biotechnology Co., Ltd., and the article number is P4036. In one embodiment of the present invention, the phage group is enriched using lysozyme and DNA binding dye, which can greatly reduce the interference of bacterial DNA.

[0034] In the present invention, the kit preferably further comprises antibiotics and / or enzymes that degrade DNA and / or RNA. The antibiotics preferably comprise penicillin and / or streptomycin, more preferably penicillin and streptomycin. The antibiotics function to inactivate bacteria and further promote bacterial lysis. The enzyme that degrades DNA preferably comprises DNase I; the enzyme that degrades RNA comprises RNase A. The enzyme that degrades DNA and / or RNA functions to further reduce the interference of bacterial DNA.

[0035] In the present invention, the kit preferably further comprises a virus concentration reagent and / or a sample buffer. The virus concentration reagent preferably comprises a PEG virus concentrator. The PEG virus concentrator is preferably a PEG-8000 virus concentrate, purchased from Beijing Solebow Technology Co., Ltd., item number P8260. The virus concentration reagent is used to concentrate bacteriophages in the system. The sample buffer preferably comprises 100-200 mM NaCl, 5-10 mM MgSO 4 , 5~10mM CaCl 2 , an aqueous solution of 50-100 mM Tris-HCl, pH 7-8; more preferably 100-180 mM NaCl, 5-8 mM MgSO 4 , 5~8mM CaCl 2 , an aqueous solution of 60 to 90 mM Tris-HCl, pH 7.2 to 7.8, more preferably 100 to 150 mM NaCl, 5.0 to 7 mM MgSO 4 , 5~7mM CaCl 2 , an aqueous solution of 70-80 mM Tris-HCl, pH 7.3-7.7; most preferably 100 mM NaCl, 5.0 mM MgSO 4 , 5.0 mM CaCl 2, a 100 mM Tris-HCl aqueous solution with a pH of 7.4. The sample buffer is used to dissolve the sample. The present invention provides the use of the phage group enrichment kit in in vitro phage group enrichment.

[0036] The present invention provides a method for in vitro enrichment of a phage group based on the phage group enrichment kit, comprising the following steps:

[0037] Isolate microorganisms from samples to be tested;

[0038] Mixing the microorganism and lysozyme to lyse the microorganism to obtain a lysate;

[0039] The lysate is mixed and incubated with a DNA binding dye, photo-fixed, and the phage group is collected.

[0040] The present invention separates microorganisms from a sample to be tested.

[0041] In the present invention, the sample to be tested includes feces or body fluids, etc. The method for separating microorganisms preferably places the sample to be tested in the sample buffer, crushes it, obtains a sample slurry, centrifuges and filters, and collects microorganisms. The mass volume ratio of the sample to be tested and the sample buffer is preferably 0.8-1.2g:1mL, more preferably 1g:1mL. The method of crushing preferably includes homogenization. The speed of the centrifugation is preferably 3500-5000rpm, more preferably 4000rpm. The time of the centrifugation is preferably 10-20min, more preferably 15-20min. The filtration is preferably membrane filtration. The pore size of the filter membrane used for membrane filtration preferably includes 0.45μm and 0.22μm.

[0042] After obtaining the microorganism, the present invention mixes the microorganism with lysozyme to lyse and obtain a lysate.

[0043] In the present invention, the working concentration of the lysozyme is preferably 100-200 μg / mL, more preferably 100-150 μg / mL, further preferably 100-120 μg / mL, and most preferably 100 μg / mL. The temperature of the mixed lysis is preferably 36-38° C., more preferably 37° C. The time of the mixed lysis is preferably 50-70 min, more preferably 60 min.

[0044] In the present invention, before the mixed lysis, it is also preferred to include antibiotics to inactivate microorganisms. The antibiotics preferably include penicillin and streptomycin; the working concentration of penicillin is preferably 80-100 U / mL, more preferably 90-100 U / mL; the working concentration of streptomycin is preferably 0.1-0.2 mg / mL, more preferably 0.15-0.2 mg / mL. The inactivation time is preferably 1-3 hours, more preferably 2 hours.

[0045] After obtaining the lysis product, the present invention mixes the lysis product with a DNA binding dye, incubates the mixture, and light-fixes the mixture to collect the phage group.

[0046] In the present invention, the working concentration of the DNA binding dye is preferably 20-30mM, more preferably 20-25mM, and most preferably 20mM. The mixed incubation is preferably incubated in the dark. The time of the incubation in the dark is preferably 10-15min, more preferably 12-15min. The type of light in the photoimmobilization preferably includes blue light or white light. The power of the blue light is preferably 60-100W, more preferably 80W. The power of the white light is preferably 450-600W, more preferably 500W. The time of the photoimmobilization is preferably 10-15min, more preferably 12-15min. The photoimmobilization is conducive to the stable binding of the DNA binding dye to DNA.

[0047] In the present invention, after light immobilization, it is preferred to further include a liquid phase in the separation system; the liquid phase is subjected to DNA and RNA degradation to collect the phage group; the method for DNA and RNA degradation is preferably to use DNaseⅠ and RNaseA for degradation; the working concentration of DNaseⅠ is preferably 100-200U / mL, more preferably 100-180U / mL, and further preferably 100-150U / mL; the working concentration of RNaseA is 15-20U / mL, more preferably 15-18U / mL, and further preferably 15-17U / mL. The method for collecting the phage group is preferably solid-liquid separation. The method for solid-liquid separation is preferably centrifugation. The speed of the centrifugation is preferably 3500-5000rpm, and more preferably 4000rpm. The time of the centrifugation is preferably 10-20min, and more preferably 20min. The conditions for DNA and RNA degradation are preferably incubation at 36-38°C for 20-40min, and more preferably incubation at 37°C for 30min.

[0048] In the present invention, the method enriches the phage group in the sample to be tested based on lysozyme and DNA binding dye. For the first time, a treatment method of combining lysozyme with DNA binding dye is added during the extraction process of phage. First, lysozyme is used to destroy the cell wall of the bacteria without affecting the activity of the virus. Then, the amplification of different microorganisms is modified by DNA binding dye, and the efficiency of bacterial DNA as an amplification template is destroyed, thereby achieving the purpose of phage enrichment.

[0049] The present invention provides a kit for extracting DNA from enriched phage groups, comprising the components of the kit for enriching phage groups and a phage DNA extraction reagent;

[0050] The phage DNA extraction reagent preferably includes a commercial DNA extraction or a DNA extraction reagent based on the "phenol-chloroform method". The commercial DNA extraction kit preferably includes a Zymo Feces / soil DNA extraction kit.

[0051] In the present invention, the DNA extraction reagent based on the "phenol-chloroform method" includes SDS, an extracting solution, a rinsing solution and an eluting solution. The SDS acts as an ionic detergent. The extracting solution is preferably a mixture of phenol, chloroform and isoamyl alcohol. The volume ratio of the phenol, chloroform and isoamyl alcohol is preferably 25:24:1. The extracting solution is used to extract phage DNA. The rinsing solution is preferably an ethanol aqueous solution with a volume concentration of 70% to 80%, more preferably an ethanol aqueous solution with a volume concentration of 75%. The eluting solution is preferably an aqueous solution containing diethyl pyrocarbonate with a volume concentration of 0.1%.

[0052] The present invention provides application of the enriched phage group DNA extraction kit in the construction of a phage metagenomic library.

[0053] In the present invention, the method for using the enriched phage group DNA extraction kit is preferably to extract phage DNA from the phage group collected by the above technical solution using the "phenol-chloroform method", and the specific steps are as follows:

[0054] A 20% SDS aqueous solution is mixed with the phage group in a water bath, an extracting solution is added to extract DNA, centrifuge, collect the first supernatant, remove foreign proteins, centrifuge, discard the supernatant, rinse the precipitate with a rinse solution, and dissolve the precipitate with an elution solution to obtain phage DNA.

[0055] In the embodiment of the present invention, the DNA extracted by the conventional extraction method is contaminated with a large amount of bacterial DNA, and the measured concentration is high; the present invention combines the use of lysozyme and PMA treatment to reduce the DNA yield to less than 10% of the conventional method; and further combining antibiotic inactivation and nuclease treatment (DNase I+RNaseA) can further reduce the amount of DNA extraction. The extracted phage DNA was subjected to 16S sequence determination for quality assessment. The results showed that the PCR yield of 16s rDNA by the conventional treatment method was 147.5ng / μL, while that by the lysozyme+PMA method was only 12.7ng / μL. A metagenomic library was constructed based on the extracted phage DNA, and the results showed that the lysozyme+PMA treatment method identified more uniform low-abundance OTUs. This may be because the enrichment score of the phage DNA extraction method provided by the present invention retains more effective reads than the traditional method, making it easier to detect low-abundance OTUs, which leads to differences in the abundance table.

[0056] The following is a detailed description of a phage group enrichment method, a kit and an application thereof provided by the present invention in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0057] Example 1

[0058] A kit for phage group enrichment, comprising the following components:

[0059] Sample buffer: contains 100mM NaCl, 5mM MgSO 4 , 5 mM CaCl 2 , 100 mM Tris-HCl in water, with a final pH of 7.4;

[0060] Lysozyme;

[0061] Penicillin and streptomycin mixture: 10000U / mL penicillin, 10mg / mL streptomycin;

[0062] Propidium monoazide (PMA);

[0063] DNaseⅠ and RNaseA.

[0064] Example 2

[0065] A kit for extracting DNA from enriched phage groups, comprising the components of the kit for enriching phage groups described in Example 1, and further comprising SDS, an extracting solution, a rinsing solution, and an eluting solution;

[0066] SDS: 20% SDS solution;

[0067] Extraction solution: DNA extraction solution mixed with saturated phenol, chloroform and isoamyl alcohol in a volume ratio of 25:24:1;

[0068] Rinsing solution: 75% ethanol aqueous solution;

[0069] Eluent: an aqueous solution of diethyl pyrocarbonate having a volume concentration of 0.1%.

[0070] Example 3

[0071] A method for enriching a bacteriophage group and extracting its DNA comprises the following steps:

[0072] Step 1, weigh 0.4g of freshly collected feces, add 400μL sample buffer for homogenization. After centrifugation at 4000rpm for 10min, take the supernatant and filter it with 0.45μm and 0.22μm water filter heads in turn; aspirate the supernatant and divide it into 5 equal parts and divide it into 5 2mL centrifuge tubes, take 1 tube of supernatant and mark it as A, store it at 4℃ temporarily as a blank control group. The other 3 supernatants are marked as B, C and D as experimental materials for the following experiments;

[0073] Add antibiotics to experimental materials C and D to inactivate bacteria for 1 hour. The antibiotics are a combination of penicillin and streptomycin, with a working concentration of penicillin of 100 U / mL and a working concentration of streptomycin of 0.2 mg / mL.

[0074] Step 2, incubate the three experimental materials obtained in step 1 with lysozyme at a working concentration of 100 μg / mL at 37° C. for 1 h;

[0075] Step 3, add PMA molecules with a working concentration of 20 mM to the three incubated systems, incubate at 37°C for 15 min, and then fix with a 500 W white light source for 15 min;

[0076] Add DNaseⅠ and RNaseA at working concentrations of 100 U / mL to the experimental material D, incubate at 37°C for 30 min, centrifuge, and collect the supernatant;

[0077] Step 4, use the "phenol-chloroform method" to extract the DNA of the above two tubes of samples;

[0078] (1) Add 100 μL of 20% SDS solution to 200 μL of supernatant and incubate at 55°C in a water bath for 1 h, inverting occasionally to mix;

[0079] (2) Add an equal volume of extract to the centrifuge tube, invert repeatedly to mix, and centrifuge at 12,000 rpm for 10 min;

[0080] (3) Take the supernatant and add an equal volume of chloroform, mix by inversion, and centrifuge at 12000 rpm for 10 min;

[0081] (4) Discard the supernatant, add 1 mL of rinse buffer to the centrifuge tube, centrifuge at 12,000 rpm for 5 min, wash twice, open the lid and air dry for 20 to 30 min. After drying, add 50 μL of elution buffer to dissolve the DNA.

[0082] The above four nucleic acid extracts were quantified using Qubit Nucleic Acid Protein Quantifier. The extraction using soil DNA extraction kit was taken as an example, and the results are shown in Table 1.

[0083] Table 1 DNA concentration results of different extraction methods

[0084] serial number Lysozyme antibiotic DNaseⅠ+RNaseA PMA DNA concentration A - - - - 47.5 ng / μL B + - - + 4.2 ng / μL C + + - + 3.8 ng / μL D + + + + 3.7 ng / μL

[0085] As shown in Table 1, the conventional extraction method (A) contaminated a large amount of bacterial DNA, and the measured concentration was high; the combined use of lysozyme and PMA treatment (B) can reduce the DNA yield to less than 10% of the conventional method; and further use of antibiotic inactivation and nuclease treatment (DNaseⅠ+RNaseA) (C and D) can further reduce the amount of DNA extraction, but the improvement is limited (reduced by 0.5ng / μL). It can be seen that the conventional method will produce a large number of bacterial contamination sequences after being used for metagenomic sequencing, which is a waste of sequencing throughput and downstream processing time. The following is a further analysis of the lysozyme and PMA treatment groups.

[0086] Example 4

[0087] Example 3 Method for evaluating the quality of extracted phage group DNA

[0088] According to Tables 2-4, PCR was performed to amplify bacterial 16s rDNA, with a template amount of 5 ng, and the amplified products were subjected to agarose gel electrophoresis.

[0089] Table 2 Primer sequences for bacterial 16s rDNA amplification

[0090] Primer name Sequence information (5'-3') 16s-27F AGAGTTTGATCCTGGCTCAG(SEQ ID NO:1) 16s-1492R TACGGYTACCTTGTTACGACTT(SEQ ID NO:2)

[0091] Table 3 Bacterial 16s rDNA PCR amplification reaction system

[0092]

[0093]

[0094] Table 4 Bacterial 16s rDNA PCR amplification reaction procedure

[0095]

[0096] The results are as follows Figure 1 , where 1 is a negative control, 2 is a group not treated with the method of the present invention, 3 is a group treated with antibiotics, lysozyme and PMA, 4 is a group treated with lysozyme and PMA, and 5 is a group treated with antibiotics, lysozyme, PMA, DNaseⅠ and RNaseA. The PMA treatment method significantly reduced the residual bacterial 16s rRNA gene content in the phage group, indicating that the treatment method can specifically remove bacterial DNA. The PCR yield of 16s rRNA in the conventional treatment method was 147.5 ng / μL as determined by the light intensity of the DNA band, while the lysozyme + PMA method only obtained 12.7 ng / μL.

[0097] Example 5

[0098] Construction of phage DNA library

[0099] Since the method developed by the present invention removes a large amount of contaminating DNA from the extracted phage group DNA, the final DNA concentration is only about 4ng / μL, which does not meet the conventional requirements for library construction. Considering that the phage concentration is relatively high, risk library construction is still selected.

[0100] The database construction process is as follows:

[0101] (1) The fragments were randomly sheared using a Covaris ultrasonic disruptor, and the entire library preparation was completed through end repair, A-tailing, sequencing adapter addition, fragment screening, PCR amplification, and purification steps;

[0102] (2) Sequencing was performed using Illumina NovaSeq with a 150 bp read length.

[0103] In order to objectively determine the enrichment degree of phages by the kit of the present invention, a library was constructed for the above two fecal phage groups, and metagenomic sequencing was performed. The sequencing data was filtered using the following method:

[0104] (1) Use Trim Galore and kneaddata to perform quality control and remove host contamination on the original sequencing reads, respectively, to generate high-quality reads. The steps are as follows: 1) Remove adpater; 2) Delete reads with quality less than 20 (--quality 20) and trim read length <20bp (--length 20). 3) Align the filtered reads to the human genome (hg37v0.1) to remove host contamination.

[0105] (2) High-quality reads were annotated with high-precision taxonomy using accurate k-mer matching (Kraken2, using reference databases including archaea, bacteria, viruses, plasmids, humans, UniVec_Core, protozoa, fungi, and plants), and the abundance of each taxonomic species was calculated using Bracken.

[0106] (3) In order to evaluate the enrichment degree of the phage group of the sample by the kit of the present invention, ViromeQC was used to perform enrichment scoring on the virome and metagenome.

[0107] Further comparisons between the traditional method and this method at the phylum, genus and species levels show the following results: Figure 2a is the phylum level, b is the genus level, and c is the species level; among the different sample markers, Con_phage: conventional enrichment method; Lyso.A.PMA_phage: enrichment method using antibiotics, lysozyme, and PMA treatment; Lyso.PMA_phage: enrichment method using lysozyme and PMA treatment.

[0108] from Figure 2 It can be seen that the main microorganism of this phage is the tail bacteriophage phylum (Uroviricota), accounting for more than 90%. There are certain differences in the phage groups produced by different phage enrichment methods at the phylum, genus and species levels. At the genus level, drivevirus is the main one, accounting for more than 80%; at the species level, Drivevirus gastrointestinalis is the main one. From the perspective of abundance reflected by different methods, the abundance of the lysozyme + PMA treatment method is closer to that of the traditional method. At the genus and species levels, the lysozyme + PMA treatment method identified more uniform low-abundance OTUs. We analyzed that this is because the enrichment score of the new method is higher than that of the traditional method, retaining more valid reads, making it easier to detect low-abundance OTUs, which leads to differences in the abundance table.

[0109] Example 6

[0110] Method for extracting bacteriophage DNA using bacteriophage enrichment and DNA extraction kit

[0111] 1. Kit: see Example 2;

[0112] 2. Detection method: see the extraction method of schemes A and D in Example 3;

[0113] 3. Experimental samples: fecal samples from healthy people;

[0114] 3. The above two nucleic acid extracts were quantified using Qubit Nucleic Acid Protein Quantifier and used as templates for PCR system to amplify the bacterial 16s content in nucleic acid, using the same method as in Example 2.

[0115] 4. Establish a phage group library for the two nucleic acid samples, using the same method as in Example 5.

[0116] Depend on Figure 3 It can be seen that the bacterial 16s content in the nucleic acid was evaluated by agarose gel electrophoresis. The results showed that the amplified amount of bacterial 16s in the nucleic acid extracted using the kit of the present invention was significantly reduced.

[0117] The results are shown in Table 5. The ViromeQC tool in Virome_pipe was used to compare the phage enrichment scores before and after the improvement. It was found that the proportion of the number of reads of the three types of bacterial markers in the metagenome decreased significantly (-83.5%, -83.9% and 81.1%).

[0118] Table 5 Evaluation of the abundance of bacterial markers in the phage group (%)

[0119] Bacterial markers Conventional phenol-chloroform method (A extraction protocol) Kit of the present invention (D extraction scheme) SSU rRNA 13.8259 2.2837 LSU rRNA 25.4223 4.0944 Bacterial_Marker 34.0878 6.4403

[0120] from Figure 4 The results show that the overall enrichment score increased from 1.79 to 10.8, an increase of 6.14 times. It can be seen that the DNA extracted by the extraction method (D extraction scheme) of the present invention better enriches phage DNA and effectively inhibits the amplification of bacterial DNA, and is a reliable and effective phage group enrichment extraction kit.

[0121] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A kit for enriching bacteriophage groups, characterized in that: Includes lysozyme and DNA binding dyes.

2. The kit for phage group enrichment according to claim 1, characterized in that: The DNA binding dyes include propidium monoazide and / or ethidium bromide azide.

3. The kit for phage group enrichment according to claim 1, characterized in that: The kit may also include antibiotics and / or enzymes that degrade DNA and / or RNA.

4. The kit for phage group enrichment according to claim 3, characterized in that: The antibiotics include penicillin and / or streptomycin; Preferably, the enzyme that degrades DNA includes DNase I; and the enzyme that degrades RNA includes RNase A.

5. The kit for enriching phage group according to any one of claims 1 to 4, characterized in that: Also included are reagents for virus concentration and / or sample buffers; Preferably, the virus concentration reagent includes a PEG virus concentrator; Preferably, the sample buffer is an aqueous solution containing 100-200 mM NaCl, 5-10 mM MgSO4, 5-10 mM CaCl2, pH 7-8 and concentration 50-100 mM Tris-HCl.

6. Use of the kit for enriching a phage group according to any one of claims 1 to 5 for enriching a phage group in vitro.

7. A method for in vitro enrichment of a phage group based on the phage group enrichment kit according to any one of claims 1 to 4, characterized in that: The following steps are involved: Isolate microorganisms from samples to be tested; Mixing the microorganism and lysozyme to lyse the microorganism to obtain a lysate; The lysate is mixed and incubated with a DNA binding dye, photo-fixed, and the phage group is collected.

8. The method for in vitro enrichment of bacteriophage groups according to claim 7, characterized in that: The working concentration of the lysozyme is 100-200 μg / mL; Preferably, before the mixed lysis, the microorganisms are inactivated by antibiotics; the antibiotics include penicillin and streptomycin; the working concentration of penicillin is 80-100 U / mL; the working concentration of streptomycin is 0.1-0.2 mg / mL; Preferably, the working concentration of the DNA binding dye is 20-30 mM; Preferably, the type of light in the photofixation includes blue light or white light; the power of the blue light is 60 to 100 W; the power of the white light is 450 to 600 W; the time of the photofixation is 10 to 15 minutes; Preferably, after the light immobilization, the system further comprises separating the liquid phase; degrading the DNA and RNA in the liquid phase to collect the phage group; More preferably, the method for degrading DNA and RNA is to use DNaseⅠ and RNaseA for degradation; the working concentration of DNaseⅠ is 100-200U / mL; the working concentration of RNaseA is 15-20U / mL.

9. A kit for extracting DNA from enriched phage groups, characterized in that: The invention comprises the components of the kit for enriching the phage group according to any one of claims 1 to 5 and a phage DNA extraction reagent.

10. Use of the enriched phage group DNA extraction kit according to claim 9 in the construction of a phage metagenomic library.

Images