Novel chain specific transcriptome sequencing method based on improved reverse transcription random primer and Tn5 transposase

Abstract

The invention discloses a novel strand-specific transcriptome sequencing method based on an improved reverse transcription random primer and Tn5 transposase, the method adopts the improved reverse transcription random primer containing a sequencing joint Read 1 sequence and a Tn5 transposase complex only carrying an R2 sequencing joint, and the sequencing efficiency is improved by simplifying the experimental process and reducing the operation steps. The efficient and economical construction of the chain-specific transcriptome library is successfully realized, and a new powerful tool is provided for transcriptomics research.

Description

Technical Field

[0001] The invention belongs to the technical field of transcriptome sequencing, and in particular relates to a novel strand-specific transcriptome sequencing method based on improved reverse transcription random primers and Tn5 transposase. Background Art

[0002] As an important tool for modern biological science research, transcriptome sequencing technology has shown extremely high value and application potential in the fields of biological research, medical diagnosis and drug development. With its comprehensiveness, rapidity and accuracy, this technology can deeply analyze the transcript sequence information of a species under a specific physiological or pathological state, a specific tissue or organ, and draw a detailed blueprint of the overall transcriptional activity of cells or tissues for researchers. Through transcriptome sequencing, researchers can gain insight into the function and structure of genes from a global perspective, which is of immeasurable significance for revealing key biological processes in life activities.

[0003] Currently, transcriptome sequencing technology has been widely used in many fields, including but not limited to basic research, clinical diagnosis and treatment, and new drug development. In the field of plant biology, this technology helps scientists discover candidate genes, verify their functions, and perform genetic improvements; in the medical field, transcriptome sequencing has become an important means of identifying disease-related genes and transcripts, providing new perspectives and possibilities for early diagnosis and precise treatment of diseases.

[0004] In the process of transcriptome sequencing, the construction of high-quality sequencing libraries is a crucial step. This process not only involves the fine processing of RNA, but also includes complex steps such as reverse transcription of RNA into DNA / RNA hybrid chains and further synthesis of DNA duplexes. In recent years, with the rapid development of molecular biology technology, Tn5 transposase has attracted much attention for its ability to directly transpose DNA / RNA hybrid chains and efficiently add sequencing adapters. Innovative methods based on Tn5 transposase, such as SHERRY (DI L, FU Y, SUN Y, et al. RNA sequencing by direct tagmentation of RNA / DNA hybrids [J]. Proc Natl Acad Sci USA, 2020, 117 (6): 2886-93.) and TRACE-seq (LU B, DONG L, YID, et al. Transposase-assisted tagmentation of RNA / DNA hybrid duplexes [J]. Elife, 2020, 9.), have greatly simplified the operation process of traditional transcriptome sequencing technology, improved experimental efficiency, and reduced operational difficulty.

[0005] It is worth noting that RNA in organisms has a clear chain directionality, and bidirectional transcription is widely present in various organisms. This feature emphasizes the importance of retaining RNA chain direction information, which plays a key role in accurately identifying antisense transcripts with potential regulatory effects, determining the transcription chain direction of non-coding RNA, clarifying the transcription boundaries of adjacent genes on opposite chains, and accurately analyzing the expression levels of overlapping transcripts. Therefore, the development of chain-specific transcriptome sequencing technology came into being. This technology can most realistically reflect the transcription activity in biological samples and provide strong support for in-depth research on the mechanism of gene expression regulation.

[0006] The most commonly used strand-specific transcriptome sequencing technology is based on the dUTP method ( Figure 1 ): During the library construction process, dUTP is used instead of dTTP when synthesizing the second strand. After connecting the Y-type sequencing adapter, UNG enzyme is used to digest dUTP to degrade the second strand, leaving only the first strand of cDNA as a template for subsequent amplification and sequencing. The order of the adapters (#Ad1 and #Ad2) can reflect the relationship between RNA strands (ZHANG Y, TANG Y, SUN Z, et al. Tn5 tagments and transposes oligos to single-stranded DNA for strand-specific RNA sequencing[J]. Genome Res, 2023, 33(3): 412-26).

[0007] In addition, there are still studies reporting methods for strand-specific library construction using Tn5 transposase, including dU-Tn5 (TAO X, FENG S, LI S, et al. A novel strand-specific RNA-sequencing protocol using dU-adaptor-assembled Tn5 [J]. J Exp Bot, 2023, 74 (6): 1806-20.) and TABLE-seq (ZHANG Y, TANG Y, SUN Z, et al. Tn5 tagments and transposes oligos to single-stranded DNA for strand-specific RNA sequencing [J]. Genome Res, 2023, 33 (3): 412-26.).

[0008] In the dU-Tn5 method ( Figure 2), the second strand synthesis process was retained and dUTP was used instead of dTTP. When the 9bp single-strand gap was repaired by DNA polymerase, dUTP was introduced into a single-strand sequence to be tested and a sequencing adapter on one side. Subsequently, UDG enzyme was used to decompose dUTP, and finally only one strand was used as a template for amplification to form a DNA fragment that can be sequenced on the machine.

[0009] In the TABLE-seq method ( Figure 3 ), the Tn5 transposase complex can directly fragment and label DNA single strands. Based on this discovery, a new strand-specific transcriptome sequencing method was developed. After synthesizing cDNA through reverse transcription, the RNA single strand was digested with RNase to retain the DNA single strand. The Tn5 transposase complex was then used to fragment the DNA single strand and add a sequencing adapter on one side, and a closed sequencing adapter on the other side was designed. The adapter on the other side was connected to the 3' end of the DNA single strand to be tested using a ligase, thereby retaining strand-specific information.

[0010] The dUTP method is currently the most widely used strand-specific transcriptome sequencing technology, and the dU-Tn5 method has an advantage over dUTP in terms of experimental time. Although this method can slightly simplify the library construction process compared to dUTP, it still requires second-strand DNA synthesis and USER enzyme treatment steps, and requires the preparation of unconventional sequencing adapters containing UTP. Compared with the common transcriptome sequencing technologies SHERRY and TRACE-seq developed based on Tn5 transposase, there is still a gap in experimental time and cost.

[0011] However, TABLE-seq needs to digest the RNA chain in the reverse transcribed DNA / RNA hybrid chain during library construction, and the library yield is limited by the ligation efficiency of the ligase. At the same time, the cost of preparing sequencing adapters is high, and it is not possible to easily and efficiently prepare chain-specific transcriptome libraries. Compared with dUTP, it does not have obvious advantages.

[0012] In general, the technical disadvantages are as follows:

[0013] dUTP: The technical process is complicated, involving multiple tedious steps such as second-chain synthesis, dUTP replacement, and UNG enzyme treatment; the experimental cycle is long.

[0014] dU-Tn5: Second-strand synthesis and specific enzyme treatment are still required; the preparation of the linker is complex and costly.

[0015] TABLE-seq: Library yield is limited by ligase efficiency; adapter preparation is expensive; operation is complex. Summary of the invention

[0016] The common transcriptome sequencing technologies SHERRY and TRACE-seq developed based on Tn5 transposase have been rapidly transformed due to their reduced costs and simple operation. The relevant library construction kits can now be purchased directly. However, due to the randomness of Tn5 transposase during the transposition process, which will lead to the loss of chain directionality information, these two technologies cannot retain chain-specific information. Subsequent strand-specific transcriptome sequencing technologies developed based on Tn5 transposase, such as dU-Tn5 and TABLE-seq, have made breakthroughs in strand specificity, but are still inferior to the former in terms of simple and efficient library preparation. Therefore, how to simplify the library construction process using Tn5 transposase while retaining the RNA chain directionality information is an important challenge facing the development of strand-specific transcriptome sequencing technology.

[0017] To address the above problems, the present invention has developed a new set of chain-specific transcriptome library construction process. The general process is as follows: Figure 4 As shown. In the field of transcriptome sequencing, various sequencing technologies are inseparable from reverse transcription of RNA samples and sequencing adapter connection of the fragments to be tested by transposase or ligase. There are generally two strategies for pre-processing RNA samples. One is to enrich mature mRNA with polyA tails by mRNA magnetic beads, and the other is to enrich other RNAs except rRNA by removing rRNA. Figure 4 The process is demonstrated using mRNA as an example. This process is also applicable to RNA samples from which rRNA has been removed.

[0018] First, in the reverse transcription step, the present invention uses an improved reverse transcription random primer (named R1-8N) to anchor the sequencing adapter Read 1 sequence at its 5' end when synthesizing cDNA, which can be used for library amplification and recognized by a sequencer.

[0019] After obtaining the reverse transcription product, the present invention uses the transposase complex R2-Tn5 containing only the sequencing adapter R2 to fragment the cDNA product and form a library structure to be tested. Since the Tn5 transposase will generate a 9bp single-strand gap when transposing, a DNA polymerase with strand displacement activity is generally used in the art to extend to repair the single-strand gap. The present invention uses Bst 3.0 DNA polymerase to perform a strand displacement reaction. Finally, different Index primers are selected according to actual needs to amplify the library and perform sequencing.

[0020] The method provided by the present invention can be applied to sequencing on sequencers of different platforms, including but not limited to the Illumina NovaSeq series sequencing platform, the BGI T7 platform, etc., by changing the Read sequence when synthesizing primers.

[0021] The first object of the present invention is to provide a novel strand-specific transcriptome sequencing method, comprising the following steps:

[0022] S1. extracting total RNA from the sample to be tested, separating and purifying mRNA, and obtaining an mRNA purification product;

[0023] S2. Performing a reverse transcription reaction on the purified mRNA product using a random octamer primer carrying a Read 1 sequencing adapter at the 5' end to obtain a reverse transcription product; the Read 1 sequencing adapter can anchor the 5' end of the DNA single strand in the cDNA chain during the reverse transcription process;

[0024] S3. Prepare Tn5 transposase complex R2-Tn5 using Primer A and Primer B; Primer B is another sequencing adapter opposite to Read 1;

[0025] S4. Using the reverse transcription product obtained in step S2 as the starting material, a fragmentation reaction is performed using the Tn5 transposase complex R2-Tn5 to construct a strand-specific transcriptome library and sequence it.

[0026] Preferably, the reverse transcription reaction in step S2 is specifically performed as follows: the purified mRNA product is mixed with a random octamer primer carrying a Read1 sequencing adapter at the 5' end, reacted at 65°C for 5 minutes, and then quenched on ice for 2 minutes; reverse transcriptase is then added for subsequent reverse transcription reaction, and the reaction conditions are: 25°C for 3 minutes, 50°C for 15 minutes, and 85°C for 5 seconds.

[0027] Preferably, the nucleotide sequence of the random octamer primer carrying the Read 1 sequencing adapter at the 5' end in step S2 is TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNN.

[0028] Preferably, the nucleotide sequence of Primer A in step S3 is CTGTCTCTTATACACATCT, and the nucleotide sequence of Primer B is GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG; the 5' end of Primer A is phosphorylated, and the 3' end of Primer A is amino-modified.

[0029] Preferably, the reaction conditions of the fragmentation reaction in step S4 are: 55° C. for 10 min.

[0030] Preferably, after the fragmentation reaction in step S4 is completed, the product of the R2-Tn5 fragmentation reaction needs to be purified for RNA.

[0031] Preferably, the steps of constructing a strand-specific transcriptome library in step S4 are as follows:

[0032] a. using Bst 3.0 DNA polymerase to perform a strand displacement reaction on the purified R2-Tn5 fragmentation reaction product;

[0033] b. Add Index primers to the reaction system that has completed the primary amplification, perform secondary amplification, and obtain chain-specific transcriptome library amplification products.

[0034] Preferably, the reaction procedure of the primary amplification is: 72°C for 10 min, 95°C for 5 min.

[0035] Preferably, the reaction procedure of the secondary amplification is: 98°C for 30s; 98°C for 10s, 65°C for 75s, 21 cycles; 65°C for 10min.

[0036] Preferably, the strand-specific transcriptome library amplification product also needs to be subjected to DNA purification.

[0037] Beneficial effects of the present invention:

[0038] 1. The present invention uses a modified random octamer primer carrying a sequencing adapter Read 1 at the 5' end for reverse transcription, and anchors the sequencing adapter Read 1 sequence at its 5' end when synthesizing cDNA, thereby retaining the directional information of the chain, which can be used for library amplification and recognized by a sequencer.

[0039] 2. The present invention replaces the Read 1 sequencing adapter in the conventional transposase complex (Mix-Tn5) and uses the newly designed R2-Tn5 for library construction. R2-Tn5 can efficiently interrupt and label the DNA / RNA hybrid chain, and connect the sequencing adapter on the other side at the same time. In general, when using R2-Tn5 for subsequent library construction, it will not destroy the chain direction anchoring relationship of the Read 1 random primer for reverse transcription, and can efficiently interrupt and label the DNA / RNA hybrid chain, while retaining the chain-specific information generated by the reverse transcription process, forming a sequenceable library structure.

[0040] 3. From the perspective of experimental operation, the present invention greatly simplifies the experimental process. Compared with the dUTP method and the dU-Tn5 method, the present invention requires fewer experimental operation steps and the experimental time can be shortened to about 4 hours and 40 minutes.

[0041] 4. From the perspective of technical cost, the present invention does not require specific chemical modification of the Read sequencing adapter, and conventional synthetic primers can meet the experimental requirements. Compared with the dUTP method and dU-Tn5 method, fewer reagents and consumables are required. The cost of the present invention is close to that of the common transcriptome sequencing technologies SHERRY and TRACE-seq, and is much lower than the most commonly used dUTP method. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is a schematic diagram of the principle of dUTP chain-specific transcriptome sequencing technology.

[0043] Figure 2 This is a schematic diagram of the principle of dU-Tn5 chain-specific transcriptome sequencing technology.

[0044] Figure 3 This is a schematic diagram of the principle of TABLE-seq chain-specific transcriptome sequencing technology.

[0045] Figure 4 This is the core principle diagram of the strand-specific transcriptome sequencing technology; the ME sequence refers to a 19bp specific sequence that can be recognized by the Tn5 transposase and complete the transposition process.

[0046] Figure 5 This is a schematic diagram of the difference between Mix-Tn5 and R2-Tn5; ME DNA refers to a 19bp specific sequence that can be recognized by Tn5 transposase and complete the transposition process.

[0047] Figure 6 This is a workflow comparison diagram of different transcriptome sequencing methods.

[0048] Figure 7 The amplification curve and melting curve are obtained by qPCR of FBA1 and TDH3 using the reverse transcription products of each group as templates.

[0049] Figure 8 This is the structure diagram of the R2 sequence after the annealing reaction is completed.

[0050] Fig. 9 is the fragment length distribution diagram of the library constructed from different samples; ae represents the fragment length distribution diagram of the library constructed from RPM, R1M, R1R2-1, R1R2-2, and R1R2-3 samples, respectively.

[0051] Fig.10 This is the genome coverage map of Arabidopsis chromosome 1 in the libraries constructed from different samples.

[0052] Fig.11This is a diagram for evaluating the strand specificity of the library; AT4G16190 is a forward transcribed gene, and AT2G2470 is a reverse transcribed gene; the IGV software "Colors alignments by First-of-pair strand" mode is used for visualization, and the reads of the positive strand are colored according to the strand direction of the first read of each read pair, with the reads of the positive strand marked in pink and the reads of the negative strand marked in light blue. Gray represents incorrect matching or matching to different chromosomes; the color distribution of the non-strand-specific library is uniform, and the color distribution of the strand-specific library corresponds to the transcription direction of the gene. DETAILED DESCRIPTION

[0053] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0054] The following examples are based on the Illumina NovaSeq series sequencing platform as the adaptation platform for technical development. Different sequencing platforms can be adapted by changing the Read sequence of the sequencing adapter. At the same time, the amount of reverse transcriptase and transposase used can be different for samples with different starting amounts.

[0055] The technical process of the transcriptome sequencing method shown in Example 1 is compared with the existing methods (dUTP library, dU-Tn5 library). Figure 6 shown.

[0056] Example 1

[0057] 1. Effect of sequencing adapter-specific random primers on reverse transcription reaction

[0058] The sequencing adapter-specific random primer in the reverse transcription reaction is one of the key points, and the effect of the primer needs to be evaluated. Taking the Illumina NovaSeq X sequencing platform as an example, the length of its Read 1 sequencing sequence (SEQ ID NO.1: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG) is 33bp. Traditional random primers are random hexamers (N6 Primers), and their binding to the template depends on random matching of the sequence. Considering the limited binding capacity of random hexamer primers and the excessive specific information contained in the Read 1 sequence, this embodiment designs random primers of different lengths carrying the Read 1 sequence, including R1-6N, R1-8N, R1-10N and R1-12N (Table 1). The effects of these primers on the reverse transcription products are reflected in aspects such as product concentration, product fragment length, and preference. In order to evaluate the reverse transcription effect of these primers, the present embodiment extracts and purifies the mRNA of S288C saccharomyces cerevisiae in the logarithmic growth phase, respectively uses the primers described in Table 1 to perform reverse transcription reaction, and uses the product obtained by reverse transcription to perform qPCR experiment to carry out relative quantification of FBA1 and TDH3 internal reference genes of S288C saccharomyces cerevisiae, for comparing and evaluating the effect of each group of primers. FBA1 and TDH3 all show stable expression levels under various environmental conditions, and are ideal internal reference gene selections (Ayca CC, Elif D, Serpil E, et al. A Novel Strategy for Selection and Validation of Reference Genes in Dynamic Multidimensional Experimental Design in Yeast [J]. Plos One, 2012, 7 (6): e38351.). Since internal reference genes usually have stable expression levels, their results can reflect the reverse transcription situation within the whole genome to a certain extent.

[0059] Table 1 Sequencing adapter specific random primers

[0060] Primer name Primer sequences <![CDATA[Oligo(dT) 20 VN]]> 5'-TTTTTTTTTTTTTTTTTTTT-3' Random Primers 5'-NNNNNN-3' R1-6N 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNN-3' R1-8N 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNN-3' R1-10N 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNNN-3' R1-12N 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNNNNN-3'

[0061] Note: N represents any nucleotide among A, T, C and G.

[0062] Different from the traditional RT-qPCR method that evaluates gene expression levels by comparing the expression changes of internal reference genes with other genes, this example adopts a new strategy. The relative abundance of the target gene fragment is evaluated by comparing the Cq values ​​(Quantification Cycle) of the reverse transcription products of different groups of random primers in the qPCR experiment, thereby evaluating the effect of each group of random primers on the reverse transcription reaction. A total of 6 groups of treatments were set up in the experiment, using Oligo(dT) 20 VN, RandomPrimers, R1-6N, R1-8N, R1-10N, and R1-12N were used for reverse transcription reaction. After reverse transcription, qPCR quantification was performed on each group of samples using FBA1 and TDH3 specific primers. The primer information is shown in Table 2. The quantitative curve is shown in Figure 7 Each group of samples was repeated three times as indicated.

[0063] Table 2 Primer information used for qPCR quantification

[0064] qPCR primers sequence Sequence number FBA1-F2 TCGTTGGTGAAGATGTCCAC SEQ ID NO.2 FBA1-R2 AATGATTGGGGACTTGCTGT SEQ ID NO.3 TDH3-F2 TGCTTTGTCTAGACCAAACGT SEQ ID NO.4 TDH3-R2 AGCGTATCTACCGTGAGTGG SEQ ID NO.5

[0065] The Cq values ​​of each group of reactions are shown in Table 3, and the average value of three replicates was calculated.

[0066] Table 3 Cq values ​​of reverse transcription products in each group

[0067] Reverse transcription primers FBA1 TDH3 <![CDATA[Oligo(dT) 20 VN]]> 20.53 21.69 Random Primers 21.62 22.32 R1-6N 21.72 21.99 R1-8N 21.30 21.90 R1-10N 21.85 22.52 R1-12N 22.09 22.86

[0068] The results showed that the difference in Cq values ​​between the treatment groups was within 2 cycles, indicating that there was no significant difference in the content of the target gene between the groups. 20 When the VN primer was used for reverse transcription, the Cq value obtained was the smallest; compared with other groups, the content of the target gene in the product of this group was the highest, so it can be considered that its reverse transcription effect was the best. In the treatment of other random primers, the Cq value of R1-8N was similar to that of Oligo(dT) 20 The difference between VN and the control group was the smallest (within 1 cycle), which indicated that the effect of the random primers in the reverse transcription reaction was closest to that of the control group. Therefore, the subsequent experiments were mainly based on the R1-8N primers.

[0069] 2. Preparation of Tn5 transposase complex (R2-Tn5)

[0070] This example designs a method for preparing the R2-Tn5 transposase complex. Taking the Illumina sequencing platform as an example, the internal DNA sequence of the R2-Tn5 transposase complex is shown in Table 4. Using the DNA sequence in Table 4, the TruePrep TMTagment Enzyme (Cat. S111), prepare R2-Tn5 transposase complex according to the reaction system and reaction procedure in Tables 5 to 7.

[0071] Table 4 DNA sequences inside the R2-Tn5 transposase complex

[0072] Primer name Primer sequences Sequence number Primer A <![CDATA[5’-phos-CTGTCTCTTATACACATCT-NH2-3’]]> SEQ ID NO.6 Primer B 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3' SEQ ID NO.7

[0073] Note: Primer B is the Read 2 sequence adapted for the Illumina NovaSeq series sequencers.

[0074] The annealing reaction system is shown in Table 5.

[0075] Table 5 R2 annealing reaction system

[0076] Components volume Primer A (50 μM) 4μL Primer B (50μM) 4μL Annealing Buffer 32μL Total volume 40μL

[0077] The annealing reaction program is shown in Table 6.

[0078] Table 6 R2 Annealing Reaction Program

[0079] Components time 75℃ 15min 60℃ 10min 50℃ 10min 40℃ 10min 25℃ 30min

[0080] After annealing, the sequence structure of R2 is as follows Figure 8 shown.

[0081] The reaction components for preparing the R2-Tn5 transposition complex are shown in Table 7. After thorough mixing, the mixture was reacted at 30°C for 1 hour. The product was R2-Tn5, which was stored at -20°C.

[0082] Table 7 R2-Tn5 transposition complex preparation reaction system

[0083]

[0084]

[0085] 3. Arabidopsis strand-specific transcriptome sequencing

[0086] 3.1 In this example, one-month-old Arabidopsis Col-0 leaves were collected and total RNA was extracted using FastPure Plant TotalRNA Isolation Kit (Polysaccharides & Polyphenolics-rich) (Vazyme, Cat. RC401). The detailed steps were carried out according to the manufacturer's instructions. The purified product was eluted with 40 μL Nuclease-free ddH2O, stored briefly on ice, and then the subsequent mRNA purification experiment was carried out immediately.

[0087] In the mRNA purification step of this example, VAHTS mRNA Capture Beads 2.0 (Vazyme, Cat. N403) was used. The specific steps were carried out according to the manufacturer's instructions, and the purified product was eluted with 8 μL Nuclease-free ddH2O, and the subsequent experimental operations were immediately carried out.

[0088] The purified mRNA product was reverse transcribed using HiScript IV 1st Strand cDNA Synthesis Kit (Vazyme, Cat. R412), and the reaction system was configured on ice, as shown in Table 8. The specific steps are as follows: first, 8 μL of purified Arabidopsis mRNA product and 1 μL of 50 μM R1-8N were mixed evenly, reacted at 65°C for 5 min, and then quenched on ice for 2 min; then, 5 μL of 4×HiScript IV RT SuperMix was added, and the total system was filled to 20 μL with Nuclease-free ddH2O, and the mixture was gently pipetted and mixed, and then placed in a PCR instrument for subsequent reverse transcription reaction.

[0089] Table 8 Reverse transcription reaction system

[0090] Components volume Arabidopsis thaliana mRNA purification products 8μL R1-8N(50μM) 1μL 4×HiScript IV RT SuperMix 5μL <![CDATA[Nuclease-free ddH2O]]> 6μL Total volume 20μL

[0091] The subsequent reverse transcription reaction procedure is shown in Table 9.

[0092] Table 9 Subsequent reverse transcription reaction procedures

[0093]

[0094]

[0095] Table 9 After the reverse transcription reaction program was completed, the reverse transcription product was taken out and placed on ice for a short time, and the subsequent experiment was immediately carried out. The product was processed using Equalbit 1×dsDNA HS Assay Kit (Vazyme, Cat.EQ121) and quantified using Qubit 4 Fluorometer (Thermo Fisher, Cat.Q33238). The specific steps were carried out according to the manufacturer's instructions.

[0096] This embodiment performs three independent library construction and sequencing repetitions on the experimental group, and sets two groups of common transcriptome libraries as the control group. The experimental group (R1R2-1, R1R2-2, R1R2-3) uses the product of the reverse transcription reaction of R1-8N primer as the starting material, and uses the Tn5 transposase complex (R2-Tn5) carrying only the R2 sequencing connector for fragmentation and library construction and sequencing. Control group 1 (R1M) uses the product of the reverse transcription reaction of R1-8N primer as the starting material, and uses Mix-Tn5 (a conventional Tn5 transposase complex carrying double-end sequencing connectors Read 1 and R2) to build library sequencing. Control group 2 (RPM) uses Random Primers (random hexamer primers, sequence: 5'-NNNNNN-3') for reverse transcription reaction The product is used as the starting material, and Mix-Tn5 is used for library construction and sequencing. The difference between R2-Tn5 and the transposase complex Mix-Tn5 used for conventional Tn5 transposase library construction is as follows Figure 5 Both R2-Tn5 and Mix-Tn5 use TruePrep Tagment Enzyme (from TruePrep TM Tagment Enzyme, Cat. S111) was used as the source of Tn5 transposase, and the same dosage and reaction conditions were used. The Primer sequence was the only variable (the preparation of R2-Tn5 transposase complex only required Primer B, while the preparation of Mix-Tn5 transposase complex required Primer A and Primer B). The specific treatments of each group are shown in Table 10.

[0097] Table 10 Library construction information of each group of samples

[0098] Sample name Reverse transcription primers Sample size Transposase complex Expected library type RPM Random Primers 20ng Mix-Tn5 General transcriptome library R1M R1-8N 20ng Mix-Tn5 General transcriptome library R1R2-1 R1-8N 20ng R2-Tn5 Strand-specific transcriptome library R1R2-2 R1-8N 20ng R2-Tn5 Strand-specific transcriptome library R1R2-3 R1-8N 20ng R2-Tn5 Strand-specific transcriptome library

[0099] In each treatment group, 20 ng of reverse transcription product was used as the starting material, and the reaction system was shown in Table 11.

[0100] Table 11 R2-Tn5 fragmentation reaction system

[0101]

[0102]

[0103] Note: 5×Tagment Buffer L comes from the TruePrep kit of Novozymes TM Tagment Enzyme (Cat. S111); PEG 8000 (Cat. R0056) was purchased from Bio-Tech; PEG 200 (Cat. 60360ES76) was purchased from Yisheng Biotechnology.

[0104] The mixture was mixed thoroughly by pipetting and reacted at 55° C. for 10 min. The reaction product was purified using VAHTS RNA CleanBeads (Vazyme, Cat. N412) and eluted using 20 μL Nuclease-free ddH 2 O.

[0105] The reaction system and reaction procedure for library amplification are shown in Tables 12 to 15 respectively.

[0106] Table 12 Primary amplification reaction system

[0107] Components volume Purification of products 20μL NEBNext Ultra IIQ5 Master Mix 25μL Bst 3.0 DNA Polymerase 1.8μL

[0108] Table 13 Primary amplification reaction program

[0109] temperature time 72℃ 10min 95℃ 5min

[0110] Table 14 Secondary amplification reaction system

[0111] Components volume Primary amplification reaction system 46.8μL N5 Index 2.5μL N7 Index 2.5μL

[0112] Table 15 Secondary amplification reaction program

[0113]

[0114]

[0115] The product was purified using VAHTS DNA Clean Beads (Vazyme, Cat. N411). The purified product was eluted using 35 μL Nuclease-free H2O and then frozen at -20°C.

[0116] The library quality inspection and high-throughput sequencing related work of this embodiment were entrusted to the Beijing Medical Laboratory of Annoroad Gene Technology Co., Ltd. In the library quality inspection stage, the qPCR absolute quantification technology will be used to accurately measure the library concentration, and the LabChip Touch will be used to detect the fragment size distribution of the library to ensure that the library quality meets the sequencing requirements. The library quality inspection results will be summarized and reported and returned for further analysis. In the high-throughput sequencing stage, Illumina NovaSeq X was selected as the sequencing platform, and the sequencing type was PE150. The sequencing depth was set to 6G Raw data for each sample.

[0117] The high-throughput sequencing data processing and analysis work of the present embodiment is performed on the supercomputing cluster of Shenzhen Genomics Institute of Chinese Academy of Agricultural Sciences. First, FastQC (version v0.12.1) software is used to perform quality assessment on the original sequencing data to ensure the accuracy and reliability of the data. Subsequently, cutadapt (version 4.6) tool is used to remove the joint process, and the sequencing data is subjected to strict quality filtering to remove low-quality sequences and potential pollution. In the alignment process, TAIR10 is selected as the reference genome, and corresponding TAIR 10.58 is used as the genome annotation file, which is downloaded from plants.ensembl.org website. Then, STAR software (version 2.7.22) is used to compare the filtered sequencing data with the reference genome, and chain-specific information is retained for subsequent analysis. Finally, in order to more intuitively show the full genome coverage and chain-specific information of sequencing data, IGV (version 2.17.0) is used for visual analysis.

[0118] 3.2 Results

[0119] The fragment length distribution of each group of processing libraries is as follows Fig. 9 As shown in ae.

[0120] In each group of processing, RPM has no small peak in the interval of 150-200bp size, and small peaks appear in all other groups. Subsequent analysis shows that the appearance of the small peak is due to the residual unconsumed reverse transcription random primers in the system when other groups are processed during transposition, and the Tn5 transposase complex can directly fragment and mark the single-stranded DNA of this length. And the labeled single-stranded DNA can be combined and amplified by sequencing primers, so a small peak is produced in the library. For the present invention, the appearance of the small peak can have a limited impact on the sequencing results. By data filtering, using an appropriate amount of RNA samples, using an appropriate amount of reverse transcription primers and an appropriate amount of transposase complex, the influence of the small peak can be effectively reduced.

[0121] The results of absolute quantitative detection of the library by qPCR are shown in Table 16. The results of absolute quantitative detection show that the sample size of each sample meets the requirements for sequencing.

[0122] Table 16 Library qPCR absolute quantitative concentration

[0123] Sample name Concentration (nmol / L) Dilution multiple RPM 108.21 10 R1M 87.62 10 R1R2-1 85.72 10 R1R2-2 78.15 10 R1R2-3 79.60 10

[0124] According to the library quality assessment results and the quality control analysis of the original sequencing data using FastQC software, the present embodiment found that there were a large number of small fragment sequences in the sequencing data. In view of the fact that these small fragment sequences cannot be accurately aligned to the reference genome, the present embodiment has taken corresponding measures in the data processing flow. When using the cutadapt tool to remove the joint sequence, the sequence with an insert length of less than 80bp is also filtered out. In addition, when performing the STAR comparison, the present embodiment uses more stringent parameter settings to ensure that the chain-specific information of the library is accurately retained.

[0125] Fig.10 Taking chromosome 1 of Arabidopsis thaliana as an example, the genome coverage and gene expression abundance of each group of samples were displayed, showing that the results of the control group (RPM, R1M) and the experimental group (R1R2-1, R1R2-2, R1R2-3) were similar, indicating that the experimental group method has the ability to detect the entire genome.

[0126] Fig.11 Taking the Arabidopsis AT4G16190 and AT2G2470 genes as examples, the strand-specific information of each group of samples is displayed. AT4G16190 is a forward transcribed gene, and AT2G2470 is a reverse transcribed gene. In the IGV software Colors alignmentsby First-of-pair strand mode, it was observed that the sequencing data of the experimental groups (R1R2-1, R1R2-2, R1R2-3) showed obvious strand specificity on the genome, that is, most reads originated from specific DNA strands, which is a typical sign of strand-specific transcriptome sequencing. In contrast, the distribution of reads in the control group (RPM, R1M) on the genome did not show obvious strand specificity, which is consistent with the characteristics of non-strand-specific transcriptome sequencing.

[0127] In summary, although the presence of small fragment contaminants in the library slightly reduced the amount of available data produced by sequencing, after strict data filtering, the experimental group method of this example can still cover the entire genome and maintain good chain specificity.

Claims

1. A novel strand-specific transcriptome sequencing method, characterized in that: The following steps are involved: S1. extracting total RNA from the sample to be tested, separating and purifying mRNA, and obtaining an mRNA purification product; S2. Performing a reverse transcription reaction on the purified mRNA product using a random octamer primer carrying a Read 1 sequencing adapter at the 5' end to obtain a reverse transcription product; the Read 1 sequencing adapter can anchor the 5' end of the DNA single strand in the cDNA chain during the reverse transcription process; S3. Prepare Tn5 transposase complex R2-Tn5 using Primer A and Primer B; Primer B is another sequencing adapter opposite to Read 1; S4. Using the reverse transcription product obtained in step S2 as the starting material, a fragmentation reaction is performed using the Tn5 transposase complex R2-Tn5 to construct a strand-specific transcriptome library and sequence it.

2. The method according to claim 1, characterized in that The specific steps of the reverse transcription reaction in step S2 are as follows: the purified mRNA product is mixed with a random octamer primer carrying a Read 1 sequencing adapter at the 5' end, reacted at 65°C for 5 minutes, and then quenched on ice for 2 minutes; reverse transcriptase is then added for subsequent reverse transcription reaction, and the reaction conditions are: 25°C for 3 minutes, 50°C for 15 minutes, and 85°C for 5 seconds.

3. The method according to claim 1, characterized in that The nucleotide sequence of the random octamer primer carrying the Read 1 sequencing adapter at the 5' end in step S2 is TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNN NNNNNN.

4. The method according to claim 1, characterized in that: The nucleotide sequence of Primer A in step S3 is CTGTCTCTTATACACATCT, and the nucleotide sequence of Primer B is GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG; the 5' end of Primer A is phosphorylated, and the 3' end of Primer A is amino-modified.

5. The method according to claim 1, characterized in that The reaction conditions of the fragmentation reaction in step S4 are: 55° C. for 10 min.

6. The method according to claim 1, characterized in that After the fragmentation reaction in step S4 is completed, the product of the R2-Tn5 fragmentation reaction needs to be purified for RNA.

7. The method according to claim 1, characterized in that The steps of constructing a strand-specific transcriptome library in step S4 are as follows: a. using Bst 3.0 DNA polymerase to perform a strand displacement reaction on the purified R2-Tn5 fragmentation reaction product; b. Add Index primers to the reaction system that has completed the primary amplification, perform secondary amplification, and obtain chain-specific transcriptome library amplification products.

8. The method according to claim 7, characterized in that The reaction procedure of the primary amplification is: 72°C for 10 min, 95°C for 5 min.

9. The method according to claim 7, characterized in that: The reaction procedure of the secondary amplification is: 98°C for 30s; 98°C for 10s, 65°C for 75s, 21 cycles; 65°C for 10min.

10. The method according to claim 7, characterized in that The strand-specific transcriptome library amplification product also needs to be purified by DNA.

Images