ECL biosensor based on DNA logic gate and application of ECL biosensor in preparation of detection system for detecting cardiovascular disease related miRNA

Abstract

The invention belongs to the technical field of biological analysis and detection, and particularly relates to an ECL biosensor based on a DNA logic gate and application of the ECL biosensor in preparation of a detection system for detecting cardiovascular disease related miRNA. According to the invention, cascade strand displacement amplification and downstream DNAzyme cleavage reaction are coupled through the catalytic hairpin assembly, and the synthesized ABEI-Au-MSNs are connected to the surface of the electrode, so that the intensity of an output signal is enhanced. According to the invention, a basic YES gate, dual-input response OR, AND and INHIBIT gates and a three-input AND-INH cascade logic gate are constructed for miRNA identification, so that two diseases, namely acute myocardial infarction and acute pulmonary embolism, with similar symptoms can be detected more conveniently. Different logic gates constructed by the invention display corresponding input and output mapping, and through the intelligent design, a new thought is provided for simultaneous diagnosis of multiple miRNAs and early diagnosis of diseases. In future research, more miRNA biomarkers can be combined and introduced into a designed logic system, and an intelligent tool is provided for biomedical research and clinical diagnosis.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological analysis and detection, and specifically relates to an ECL biosensor based on a DNA logic gate and an application thereof in preparing a detection system for detecting cardiovascular disease-related miRNA. Background Art

[0002] Acute myocardial infarction (AMI) is myocardial necrosis caused by acute occlusion of coronary arteries. As the most serious complication of ischemic heart disease, the leading cause of death worldwide, it is a major cause of death and disability worldwide. Acute myocardial infarction is pathologically defined as the death of myocardial cells due to long-term ischemia. After myocardial ischemia occurs, the lag of histological cell death is as short as 20 minutes. Accurate and early diagnosis is crucial to control the disease, limit myocardial damage, and protect cardiac function. However, the symptoms and signs of AMI are similar to those of other acute cardiovascular events, such as aortic dissection and acute pulmonary embolism. This similarity increases the complexity of the clinical differential diagnosis of acute myocardial infarction.

[0003] A series of cardiac marker tests with high sensitivity and specificity will play a key role in the diagnosis of acute myocardial infarction. Studies have shown that when myocardial infarction occurs, myocardial cells will respond to external stimuli of local ischemia, the expression of circulating miRNAs will be dysregulated, and some miRNAs will appear in plasma earlier than other conventional biomarkers of AMI. Myocardial infarction-related miRNAs are not only considered biomarkers for the diagnosis of AMI, but also biomarkers for post-infarction prognosis. In addition, the expression pattern of miRNAs varies between different diseases. There are obvious differences in the expression levels of miRNAs between different acute cardiovascular diseases with similar symptoms. At the same time, the identification of marker miRNAs for diseases with similar symptoms (acute myocardial infarction AMI, acute pulmonary embolism APE) to assist in disease diagnosis will reduce the risk of misdiagnosis. Traditional methods often require cumbersome experimental steps and cannot identify multiple miRNAs at the same time. Therefore, finding an efficient solution to simplify the miRNA identification process is crucial for accurate disease diagnosis.

[0004] Boolean DNA logic gate molecular systems have been used to identify a variety of biomarkers in recent years due to their high programmability. DNA-based analog Boolean logic gate operations provide a promising solution for realizing multifunctional information processing of miRNA. DNA logic gates use the interactions between DNA sequences to realize computational and logical operations. Using the programmability and parallel processing capabilities of DNA logic gates to perform complex operations can greatly improve the efficiency and throughput of miRNA identification and realize intelligent analysis of multiple miRNAs. In particular, combined with functional DNA modules such as aptamers, DNAzymes, DNA i-motifs, and DNA triplex, DNA logic gates can be designed into different biosensors to meet the needs of various application scenarios. Among them, DNAzyme is a metal ion-dependent DNA fragment that can catalyze RNA cleavage. It shows broad prospects in biomarker detection with its excellent catalytic activity and flexible programmability.

[0005] However, due to the inherent short length, low abundance and high similarity between miRNA family members, it is very difficult to identify miRNA. In order to solve the above problems, people have proposed various new signal amplification strategies, such as hybridization chain reaction (HCR), clustered regularly interspaced short palindromic repeats and associated proteins (CRISPR-Cas) system, double-stranded specific nuclease-mediated signal amplification, etc. Strand displacement amplification is a nucleic acid amplification method performed in an isothermal manner. Through continuous strand displacement and amplification, strand displacement amplification can efficiently amplify nucleic acid sequences under isothermal conditions, thereby increasing the detection sensitivity of the target sequence.

[0006] Researchers have combined a variety of nucleic acid amplification technologies and optical technologies (fluorescence, electrochemistry, Raman, electrochemiluminescence, etc.) to develop a variety of sensing platforms and have made great progress in the analysis of miRNA. Among them, electrochemiluminescence (ECL) technology has been proven to be a good signal output platform for molecular diagnosis due to its high sensitivity, good controllability and simple operation. Summary of the invention

[0007] The purpose of the present invention is to provide an ECL biosensor based on DNA logic gates and its application in the preparation of a detection system for detecting cardiovascular disease-related miRNA. The present invention provides a multi-miRNA intelligent analysis method mediated by a dual signal amplification strategy of strand displacement amplification and DNAzyme. The different logic gates constructed show corresponding input-output mappings. Through these intelligent designs, these DNA logic gates driven by different miRNAs for strand displacement and DNAzyme dual amplification will provide new ideas for simultaneous diagnosis of multiple miRNAs and early diagnosis of diseases. Specifically, the present invention is implemented by the following technical solutions:

[0008] The ECL biosensor based on DNA logic gate of the present invention is prepared by the following method: (1) pre-treating the electrode; (2) modifying the DNA tetrahedron scaffold (DTN) on the electrode surface; (3) adding MCH to prevent non-specific binding; (4) adding the target miRNA to the logic gate template chain, dNTPs, Klenow enzyme fragment, Nb.BbvCI enzyme, 0.01% BSA and magnesium ions to trigger the amplification reaction to obtain an enzyme chain; (5) adding the enzyme chain obtained by the amplification reaction to the electrode surface to produce an enzyme cleavage product; (6) adding the hairpin HP1-modified ABEI-Au@MSNs to the electrode surface. The chain displacement amplification of the present invention can be said to be a process of obtaining an enzyme chain by amplifying the miRNA with each logic gate template chain.

[0009] As a preferred embodiment, in the above-mentioned ECL biosensor, the pretreatment in step (1) includes polishing, cleaning and drying.

[0010] As a preferred embodiment, in the above-mentioned ECL biosensor, step (2) electrochemically deposits HAuCl 4 Modified on the electrode surface.

[0011] As a preferred embodiment, in the above-mentioned ECL biosensor, step (2) of modifying the electrode surface refers to incubating the DNA tetrahedron scaffold on the electrode.

[0012] The DNA tetrahedron scaffold is formed by annealing and cooling T1, T2, T3, T4 with thiol groups, and hairpin probe HP (rA), which are recorded as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5 in the sequence table, respectively. T1, T2, T3, and T4 are single-stranded DNA. The preparation of the DNA tetrahedron scaffold adopts a common self-assembly method, such as keeping the buffer of T1, T2, T3, T4, and HP (rA) at 90°C for 10 minutes, and then quickly reducing it to 4°C and keeping it for 30 seconds.

[0013] T1:

[0014] 5'-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTC TTCTTTTTTCCGAATGCCGTAAGCCCGTGCTCAACTCGTGC-3';

[0015] T2:

[0016] 5'-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCG CAT-3';

[0017] T3:

[0018] 5'-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCA ATAC-3';

[0019] T4:

[0020] 5'-ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATA GTA-3';

[0021] HP (rA):

[0022] 5'-CAGCGCTAGTCGATCACAGGACATCGAATAGTCTTTTTTGAGCGACTCACTATrAGGAAGAGATACTGTCGTGACTATTCGA-3'.

[0023] As a preferred embodiment, the MCH in step (3) is thiol polyethylene glycol SH-PEG.

[0024] As a preferred embodiment, in the above-mentioned ECL biosensor, in step (4), the target miRNA is added to a solution consisting of a logic gate template chain, dNTPs, Klenow enzyme fragment, Nb.BbvCI enzyme, 0.01% BSA and magnesium ions, incubated at 37°C for 2 hours, and then incubated at 80°C for 20 minutes. The logic gate template chain includes at least one of a YES gate template chain, an OR gate template chain, an AND gate template chain, an INH gate template chain, and an INH-AND cascade gate template chain; the present invention selects the types of logic gates suitable for biosensing, and designs different single-stranded substrate chains including P1 according to the response modes of these logic gates (template chains). YES , P1 OR , P1 AND , P2 AND , P1 INH , P2 INH , CP1 INH 、CP2 INH 、CP1 AND 、CP2 AND , all of which were designed by ourselves and are recorded as SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.15 in the sequence table.

[0025] P1 YES :

[0026] 5’-ACTCACTATTTTCGACCGGCTCGGAGAAGAGATCCTCAGCTTATTTGGTTCC ATTTTA-3’;

[0027] P1OR:

[0028] 5’-ACTCACTATTTTCGACCGGCTCGGAGAAGAGATCCTCAGCTTTGCCGTGCCCTGGCCTTTAAACATCACTGCAAGT-3’;

[0029] P1 AND :

[0030] 5’-TAAAATGGAACCAAATTTCTGATAACCTACAGGACA-3’;

[0031] P2 AND :

[0032] 5’-ACTCACTATTTTCGACCGGCTCGGAGAAGAGATCCTCAGCTTATTTGGTTCC ATTTTA-3’;

[0033] P1 INH :

[0034] 5’-CTGATAACCTACAGGACACCTCAGCTTAAACATCACTGCAAGT-3’;

[0035] P2 INH :

[0036] 5’-TGTCCTGTAGGTTATCAGCCTCAGCTTTGCCGTGCCCTGGCCT-3’;

[0037] CP1 INH :

[0038] 5’-CTGATAACCTACAGGACACCTCAGCTTAAACATCACTGCAAGT-3’;

[0039] CP2 INH :

[0040] 5’-TGTCCTGTAGGTTATCAGCCTCAGCTTTGCCGTGCCCTGGCCT-3’;

[0041] CP1 AND :

[0042] 5'-TAAAATGGAACCAAATTTCTGATAACCTACAGGACA-3';

[0043] CP2 AND :

[0044] 5'-ACTCACTATTTTCGACCGGCTCGGAGAAGAGATCCTCAGCTTATTTGGTTCC ATTTTA-3';

[0045] Among them, the YES door template chain is P1 YES , OR gate template chain is P1 OR , AND gate template chain consists of P1 AND and P2 AND The INH door template chain consists of P1 INH and P2 INH The INH-AND cascade gate template chain consists of CP1 INH and CP2 INH The INHIBIT gate template strand and CP1 AND and CP2 AND The AND gate partial template chain is formed. For the template chain structure, a stable composite template chain structure can be formed by mixing the required substrate chains with partial complementary paired structures, heating at 90°C for 10 min, and then slowly cooling to ambient temperature for 1 h. For example, the AND gate template chain includes two partially complementary paired P1 AND and P2 AND ; INHIBIT template strand includes two partially complementary paired P1 INH and P2 INH ;CP1 INH and CP2 INH Hybridization forms the INHIBIT gate part of the template chain in the cascade logic gate, CP1 AND and CP2 ANDHybridization forms the AND gate part of the template chain in the cascade logic gate. For the simplest single-input YES gate, the absence (0) of the input will produce an output (0), while the presence (1) of the input will produce an output (1), following the mapping pattern of "0 to 0" and "1 to 1". For the AND gate, the output (1) can only be generated when all inputs are simultaneously present (1, 1), otherwise the output is (0). For the OR gate, the presence of any input can generate an output (1), and only the absence (0, 0) of all inputs will produce an output (0). For the INHIBIT gate, one of the inputs acts as an inhibitory element, and the output (1) can only be generated when this element is absent and all other inputs coexist.

[0046] As a preferred embodiment, in the above-mentioned ECL biosensor, the synthesis method of the hairpin HP1 modified ABEI-Au@MSNs in step (6) is to treat the annealed hairpin HP1 with tri-(2-carboxyethyl)phosphine hydrochloride, and then mix it with ABEI-Au@MSNs. Further, it can be that the annealed hairpin HP1 is treated with TCEP (tri(2-carboxyethyl)phosphine) for 30 minutes, then mixed with ABEI-Au@MSNs and gently shaken at room temperature for 12 hours; the hairpin HP1 is a self-designed DNA chain, which is SEQ ID NO.16 in the sequence list.

[0047] Hairpin HP1:

[0048] 5'-TTTTCATCGAATAGTCGCTCATAAACGACTATTCGATGTCCTACTTTTTTTTTTT-3'

[0049] As a preferred embodiment, in the above-mentioned ECL biosensor, in step (6), the hairpin HP1-modified ABEI-Au@MSNs are dropped onto the modified electrode surface and incubated in the dark.

[0050] As a preferred embodiment, the above-mentioned ECL biosensor can be prepared by the following specific steps:

[0051] (1) Polish the electrode with alumina slurry, rinse thoroughly with ultrapure water, ultrasonically treat in ethanol and water, and dry at room temperature;

[0052] (2) Place the electrode in the electrolyte (25 mM HAuCl 4 ) was electrochemically deposited for 30 seconds, and then 10 μL of 1 μM T2, T3, T4 with thiol groups, 1 μM T1 and 3 μM HP (rA) were added to form a DNA tetrahedral scaffold after annealing and cooling, and incubated on the electrode for 4 h-6 h;

[0053] (3) Add 1 mM MCH and incubate for 30 min;

[0054] (4) Mix 0.1 μM logic gate template chain with dNTPs, Klenow enzyme fragment, Nb.BbvCI enzyme, 0.01% BSA, and the corresponding target miRNA chain with different concentrations of magnesium ions and incubate for 2 h, then anneal at 80°C for 20 min to obtain the corresponding logic gate reaction solution;

[0055] (5) Drop 10 μL of logic gate reaction solution on the electrode surface and incubate for 3 h;

[0056] (6) 10 μL of hairpin HP1-modified ABEI-Au@MSNs was dropped onto the electrode surface and incubated in the dark for 2 h. Finally, ECL measurement was performed. The ECL photomultiplier tube was set at 700 V, with a scan rate of 0.1 V / s from 0 to 0.6 V.

[0057] Furthermore, in the above step (6), the silica nanospheres are first prepared, and then the amino groups are modified by post-grafting method to obtain amino-modified silica nanospheres, and then HAuCl 4 ABEI-Au@MSNs were obtained by combining with N-(4-aminobutyl)-N-ethylisoluminol in the solution; the annealed hairpin HP1 was treated with tri-(2-carboxyethyl)phosphine hydrochloride for 30 min and then mixed with ABEI-Au@MSNs and gently shaken at room temperature for 12 h to obtain hairpin HP1-modified ABEI-Au@MSNs; then 10 μL of hairpin HP1-modified ABEI-Au@MSNs was dropped onto the modified electrode surface and incubated in the dark at 37°C for 2 h.

[0058] Furthermore, in step (6), the synthesis method of ABEI-Au@MSNs can be as follows:

[0059] Hexadecyltrimethylammonium bromide, sodium salicylate and triethylamine were mixed, and then triethoxysilane was added to react at 70-90°C; then, the template was removed by extraction with hydrochloric acid and methanol solution at 70-90°C, and the silica nanospheres were dried at 50-70°C overnight; the silica nanospheres were dispersed in ethanol and ultrasonically treated, 25wt%-28wt% ammonia water and aminopropyltriethoxysilane were added, the reaction was vigorously stirred for 10-15, ethanol was washed, and the aminated MSNs were vacuum dried overnight; the aminated MSNs were dispersed in distilled water and ultrasonically treated, and then 20-30 mM HAuCl was added 4 solution and stirred; then N-(4-aminobutyl)-N-ethylisoluminol was added and stirred at room temperature until the solution turned purple-red, and then centrifuged and washed to obtain ABEI-Au@MSNs.

[0060] Furthermore, in step (6), the synthesis method of ABEI-Au@MSNs is as follows:

[0061] 0.380 g of hexadecyltrimethylammonium bromide (CTAB), 0.067 g of sodium salicylate and 0.068 g of triethylamine (TEA) were added to 25 mL of water and gently stirred for 1 h. Then, 2 mL of triethoxysilane (TEOS) was added to the above solution and continued to stir at 80 °C for 2 h. Then, the product was extracted with hydrochloric acid and methanol solution at 80 °C for 6 h to remove the template and dried at 60 °C overnight.

[0062] The amino groups were modified by post-grafting method. 200 mg of silica nanospheres were dispersed in 40 mL of ethanol and ultrasonically treated for 15 min, then stirred for 15 min. Then, 4 mL of ammonia (25%-28%) and 500 μL of aminopropyltriethoxysilane (APTES) were added to the solution and stirred vigorously for 12 h. The final product was washed with ethanol several times and then vacuum dried at 35 °C overnight to obtain amino MSNs.

[0063] 20 mg of aminated MSNs were dispersed in 10 mL of distilled water by ultrasonic treatment for 15 min and then stirred with magnetic stirring for 15 min. 4 The solution (2 mL; 25 mM) was added to the above aqueous solution and stirred for 1 h. 5 mL 4 mM N-(4-aminobutyl)-N-ethylisoluminol (ABEI) was added to the above solution and stirred at room temperature until the solution turned purple-red. After centrifugation and washing, ABEI-Au@MSNs were obtained.

[0064] The present invention relates to the field of bioanalysis and detection, and specifically to an ECL biosensor and its application in preparing a detection system for detecting and analyzing a marker miRNA for cardiovascular and cerebrovascular diseases, especially acute myocardial infarction (AMI) or acute pulmonary embolism (APE). The present invention can realize rapid detection and identification of multiple target miRNAs, and can be applied to multiple real samples such as serum, blood, etc.

[0065] The present invention designs different structures and programmable DNA intermediates between input and output. The cascade strand displacement amplification and the cleavage reaction of the downstream DNAzyme are coupled through a catalytic hairpin assembly, and the synthesized ABEI-Au@MSNs are connected to the electrode surface to enhance the output signal intensity. A basic YES gate was constructed, and by editing the architecture of the template chain, OR, AND, and INHIBIT gates for dual-input responses were established. Further, by combining the AND gate and the INHIBIT gate, a three-input AND-INH cascade logic gate was constructed for the identification of miRNAs, so as to facilitate the detection of two diseases with similar symptoms, acute myocardial infarction and acute pulmonary embolism. And the stability and accuracy of the method were demonstrated by challenging biological samples. As an important biomarker for disease diagnosis, miRNAs play a key role in the occurrence and development of diseases, so miRNA detection can provide more accurate information for the implementation of targeted treatment of diseases and the prediction of prognosis. In future studies, more miRNA biomarkers can be combined and introduced into the designed logic system to bring intelligent tools to biomedical research and clinical diagnosis.

[0066] The principle analysis of the present invention is as follows:

[0067] 1. Design basis for DNA molecular logic gates for multi-miRNA analysis and sensing

[0068] DNA molecular logic gate is a method that uses the characteristics of DNA molecules to achieve information processing and signal transmission. It can perform calculations and judgments through the interaction between DNA sequences, thereby realizing complex logical operations. By selecting the appropriate logic gate type (such as AND gate, OR gate, prohibition gate, etc.), and designing the input and output parts according to actual needs. Ensure that the logic gate can accurately identify and signal multiple miRNAs. Design a suitable miRNA recognition sequence in the DNA logic gate to achieve high-specificity recognition of the target miRNA. This enables it to effectively distinguish different miRNA subtypes and avoid cross-reactions and misjudgments. At the same time, by introducing a suitable signal amplification strategy in the DNA molecular logic gate, it can be used to improve the sensitivity of miRNA analysis and expand the dynamic range, so that it can detect low-concentration miRNA molecules. DNA molecular logic gates are programmable and can be designed and adjusted according to actual needs. By adjusting the structure and sequence of the logic gate, different functional and performance requirements can be achieved to adapt to different miRNA analysis and sensing.

[0069] 2. Basis for the design of dual signal amplification based on strand displacement amplification and DNAzyme

[0070] In the extremely complex blood environment, the abundance of circulating miRNA is low, and it can stably exist in the blood environment with high specificity. Design a dual signal amplification DNA logic gate of strand displacement amplification and DNAzyme to achieve signal amplification. Among them, strand displacement amplification is a nucleic acid amplification method performed in an isothermal manner. Through continuous strand displacement and primer amplification, strand displacement amplification can efficiently amplify nucleic acid sequences under isothermal conditions, thereby increasing the detection sensitivity of the target sequence. Design a substrate chain that can recognize the target miRNA, accurately capture the target miRNA and rapidly amplify to produce a large number of DNAzyme sequences. DNAzyme is a DNA molecule with catalytic activity, usually a nuclease composed of DNA sequences. Unlike traditional protein enzymes, DNAzyme has the characteristics of DNA molecules and can recognize and catalyze specific reactions through specific sequences and structures. DNAzyme can catalyze reactions such as shearing of DNA chains and breaking of phosphate bonds under appropriate conditions, thereby realizing the recognition and processing of specific targets. The DNAzyme designed in the present invention can efficiently complete the cutting of the hairpin with the rA site on the tetrahedral support, and the generated sticky ends are used for fixing the ECL emission material ABEI-Au@MSNs on the electrode surface.

[0071] 3. Design basis of high-performance ECL-emitting ABEI-Au@MSNs

[0072] N-(4-aminobutyl)-N-(ethylisominol) (ABEI) has been confirmed to be a new derivative of luminol, which is more active than the prototype and more easily reacts with co-reactants, resulting in stronger ECL. In order to further amplify the signal, nano-gold aggregated ABEI-Au@MSNs was designed as an introduced co-reactant accelerator in the system, which can catalyze the co-reactants to increase the formation of free radical intermediates, thereby obtaining a higher excited state of the luminophore. Nano-Au has excellent catalytic function, but it has been documented that small Au nanoparticles are prone to aggregation and then lose activity. To alleviate this problem, Au nanoparticles are usually modified with capping agents. However, the use of capping agents may limit the availability of Au active centers and reduce their activity. Anchoring Au nanoparticles on support materials such as carbon, graphene, silica periodic mesoporous organosilicon is another way to improve the dispersibility of bare nano-Au without sacrificing its efficiency. Compared with other supports, silica nanoparticles have attracted great attention due to their tunable mesostructure, adjustable morphology, and easy surface functionalization.

[0073] In order to synthesize efficient ECL emitting materials, a coreaction accelerator was introduced into the ECL luminescence of ABEI, which has stronger activity than the prototype luminol. The ABEI-Au@MSNs aggregated with gold nanoparticles catalyzed the co-reactant H 2 O2 Produce more active intermediates to achieve the enhanced effect of ECL. Fix gold nanoparticles to prevent aggregation by in-situ reduction to achieve high catalytic performance. By adjusting the reaction time, ion concentration, reducing agent dosage, etc., materials with high catalytic performance and high ECL luminescence performance can be obtained.

[0074] In this paper, a multi-miRNA intelligent analysis method mediated by a dual signal amplification strategy combining strand displacement amplification and DNAzyme was constructed. The DNA tetrahedral scaffold was designed in a highly ordered manner and anchored on the surface of a glassy carbon electrode deposited with elemental gold. Then, OR, AND, and INHIBIT logic circuits for analyzing multi-miRNAs were constructed. We successfully designed "AND", "OR", "INHIBIT" logic gates and a more advanced cascade logic circuit "INHIBIT-AND". Among them, miRNA-499, miRNA-133 related to acute myocardial infarction AMI, and specific serum miRNA-1233 that can be used for the diagnosis of acute pulmonary embolism APE were used as inputs, and DNAzymes were generated through the dual signal amplification logic gates for the cutting of hairpin DNA on the tetrahedral skeleton on the electrode surface. The cleavage product introduced a hairpin with a high-efficiency ECL emission material on the electrode surface, generating an enhanced ECL emission signal in the presence of the co-reactant hydrogen peroxide. The sensing performance of the proposed DNA logic gates was evaluated using actual biological samples, and the different logic gates constructed showed corresponding input-output mappings. Through these intelligent designs, these DNA logic gates driven by different miRNA-driven chain displacements and DNAzyme dual amplification will provide new ideas for the simultaneous diagnosis of multiple miRNAs and the early diagnosis of diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 Schematic diagram of the principle of smart DNA logic gate and dual amplification strategy in multi-miRNA analysis of acute cardiovascular disease; Figure 1 A is the schematic diagram of the synthesis of ABEI-Au@MSNs. Figure 1 B is a schematic diagram of the multi-miRNA analysis principle using the INH-AND cascade DNA molecular logic gate as an example.

[0076] Figure 2 TEM images of MSNs and ABEI-Au@MSNs; the left image is MSNs, the middle and right images are ABEI-Au@MSNs;

[0077] Figure 3 The detection principle of the YES logic gate and the YES logic gate strand displacement amplification verified by gel electrophoresis experiments;

[0078] Figure 4The graph and linear relationship between the concentration of target miRNA and ECL intensity;

[0079] Figure 5 The ECL intensity-potential curves of the OR gate under four input modes in 10% serum and the comparison of the detection results of buffer and 10% serum;

[0080] Figure 6 The ECL intensity-potential curves of AND gate under four input modes in 10% serum and the comparison of the detection results of buffer and 10% serum;

[0081] Figure 7 The ECL intensity-potential curves of INHIBIT in four input modes in 10% serum and the comparison of the detection results of buffer and 10% serum;

[0082] Figure 8 The ECL intensity-potential curves of INHIBIT-AND under eight input modes in 10% serum and the comparison of the detection results of buffer and 10% serum. DETAILED DESCRIPTION

[0083] Using the mirbase database, relevant miRNAs (miRNA-499, miRNA-1233, miRNA-133) were screened as analysis objects and provided by Suzhou Gene Gene Co., Ltd. The sequences are SEQ NO. 17, SEQ NO. 18, and SEQ NO. 19 in the sequence table, as follows:

[0084] miRNA-499: 5'-UUAAGACUUGCAGUGAUGUUU-3';

[0085] miRNA-1233: 5'-AGUGGGAGGCCAGGGCACGGCA-3';

[0086] miRNA-133: 5'-AGCUGGUAAAAUGGAACCAAAU-3';

[0087] Example 1

[0088] The DNA tetrahedron scaffold was prepared by a self-assembly method, specifically, the buffer solution of T1, T2, T3, T4 with thiol groups and hairpin HP (rA) was kept at 90°C for 10 min, and then rapidly reduced to 4°C and kept for 30 s.

[0089] Example 2

[0090] Design and verification of DNA molecular logic gates:

[0091] We first constructed the YES logic gate with the simplest input-output mapping among logic gates. As the easiest logic gate to implement, the YES gate follows the 0 to 0 and 1 to 1 mapping patterns and is the most basic logic gate. We designed a YES gate that responds to miRNA-499 and explored the performance of the ECL sensor. The principle of upstream chain displacement amplification initiated by miRNA-499 in the YES gate is shown in Figure 2. Figure 3 As shown. First, miRNA-499 hybridizes with the designed template chain P1YES, and then extends along the template chain in the presence of Klenow fragment and dNTP to generate a complete double-stranded chain. Thereafter, Nb. BbvCI specifically recognizes the double-stranded nick site and cuts the extended DNA chain. Further, the polymerase continues to extend from the nick site, releasing the DNAzyme chain for the cleavage reaction on the electrode surface, bringing a large amount of luminescent material close to the electrode. Combining the upstream chain displacement amplification and the downstream DNAzyme cleavage reaction, a significantly enhanced signal response can be recorded, characterizing the trace level of the target miRNA-499. To verify the feasibility of the design, we conducted polyacrylamide gel electrophoresis (PAGE) experiments to prove the correct design of the upstream chain displacement amplification ( Figure 3 ), the molecular weight of the DNA probe before and after the target induction reaction appeared at the expected position on the gel. The slower moving band observed in lane 3 (miR-499+P1YES) compared to lane 1 (miR-499) and lane 2 (P1YES) indicated the formation of duplexes of miRNA and template strands. Compared to lanes 4 and 5, it can be observed that in the absence of the target, no strand displacement amplification was observed. When incubated with the target miRNA, a new band appeared in lane 5, and the band position coincided with the DNAzyme strand in lane 6, indicating the successful triggering of strand displacement amplification.

[0092] Example 3

[0093] Design and synthesis of hairpin HP1-modified ABEI-Au-MSNs:

[0094] First, 0.380 g of hexadecyltrimethylammonium bromide (CTAB), 0.067 g of sodium salicylate and 0.068 g of triethylamine (TEA) were added to 25 mL of water and gently stirred for 1 h; then 2 mL of triethoxysilane (TEOS) was added to the above solution and continued to stir at 80 °C for 2 h. Then, the product was extracted with hydrochloric acid and methanol solution at 80 °C for 6 h to remove the template, and the product was dried at 60 °C overnight. The amino group was modified by post-grafting method. 200 mg of silica nanospheres were dispersed in 40 mL of ethanol and ultrasonically treated for 15 min, and then stirred for 15 min. Then, 4 mL of ammonia water (25%-28%) and 500 μL of aminopropyltriethoxysilane (APTES) were added to the above solution and stirred vigorously for 12 h. The final product was washed with ethanol several times and then dried in vacuum at 35 °C overnight to obtain amino silica nanospheres (amino MSNs).

[0095] 20 mg of aminated MSNs were dispersed in 10 mL of distilled water by ultrasonic treatment for 15 min and then stirred with magnetic stirring for 15 min. 4 Solution (2 mL; 25 mM) was added to the above aqueous solution and continued to stir for 1 h. 5 mL of 4 mM N-(4-aminobutyl)-N-ethylisoluminol (ABEI) was added to the above solution with continuous stirring at room temperature until the solution turned purple-red. After centrifugation and washing, ABEI-Au@MSNs were obtained. The annealed hairpin HP1 was treated with TCEP for 30 min and then mixed with ABEI-Au@MSNs and gently shaken at room temperature for 12 h. The hairpin HP1 modified ABEI-Au@MSNs used in step (6) were obtained. Figure 2 The morphology of MSNs and Au-ABEI@MSNs was characterized by transmission electron microscopy (TEM). MSNs exhibited a mesoporous spherical structure with good monodispersity and uniformity, with an average particle size of about 78 nm. After in situ deposition of gold nanoparticles using ABEI, the morphology of the prepared Au-ABEI@MSNs nanoparticles maintained good consistency, and the field of view of a single nanoparticle showed that the Au nanoparticles were uniformly deposited on the mesoporous silica nanospheres, which contributed to the excellent ECL emission performance and subsequent immobilization.

[0096] Example 4

[0097] Detection procedure of ECL biosensor:

[0098] Electrochemiluminescence measurements were performed using a three-electrode system with a platinum wire electrode as the working electrode, a silver / silver chloride electrode as the reference electrode, and a glassy carbon electrode as the reference electrode. The glassy carbon electrode was pretreated to obtain a mirror-like surface. In order to deposit a layer of gold nanoparticles (depAu), the electrode was immersed in 1% HAuCl 4 In the solution, electrochemical deposition was performed at 0.2 V for 30 seconds to form a layer of gold nanoparticles (depAu). After drying, 10 μL of the prepared tetrahedral scaffold solution was added to the surface of the gold electrode and incubated at 4 °C overnight to form Au-S bonds. Then, the modified electrode was blocked with 1 mM thiol (MCH) for 1 h. In a reaction solution supplemented with 10 mM magnesium acetate, 100 mM sodium chloride and 10 mM Tris-HCl buffer (pH 7.4), the template chain of each logic gate was prepared, and the substrate chain of each logic gate was added at the same concentration; it was heated at 90°C for 10 min, and then slowly cooled to ambient temperature for 1 h to form a stable logic gate template chain structure; then, different amounts of target, i.e., circulating miRNA, and, dNTPs (200 μM), Klenow fragment (0.04 U / μL) and corresponding buffer (1x), Nb.BbvCI (0.1 U / μL) and corresponding buffer (1x), 0.01% BSA, magnesium ions, the final concentration of the template chain was 0.1 μM, and the final volume was 10 μL; finally, the reaction system was incubated at 37°C for 2 h to obtain a reaction solution, and then incubated at 80°C for 20 min for standby use; after the logic gate operation, 10 μL of the reaction solution was dropped onto the electrode surface and incubated at 37 °C for 3 h to complete the enzymatic cleavage reaction. In this process, the DNAzyme cuts the HP (rA) hairpin with rA site on the tetrahedral skeleton of the electrode surface. Finally, 10 μL of HP1 / ABEI-Au@MSNs solution was added to the electrode surface and incubated in the dark for 2 h. After each step of incubation on the electrode, the platform was gently rinsed with ultrapure water to remove unbound reactants. In a solution containing 3 mM H 2 O 2 The synthesized biosensor was characterized by ECL in PBS buffer. Then, the synthesized biosensor was detected in 5 mL PBS solution (0.1 M, pH 7.4) using an MPI-E multifunctional electrochemical analyzer. The scanning voltage was 0-0.6 V, the scanning rate was 100 mV, and the photomultiplier voltage was 700 V.

[0099] Figure 4 Middle: Quantitative measurement of different concentrations of miRNA-499 by ECL biosensor platform. Figure 4As shown in Figure 2, from 0 to 1 nm, as the concentration of miRNA-499 increased, the ECL intensity continued to increase, showing a good linear relationship between the ECL signal intensity and the logarithm of the concentration. The linear regression equation was I = 1699.5lg C + 27715.4 (R 2 =0.9979), with a detection limit of 0.60 fM.

[0100] like Figure 5 A shows the design principle of the OR gate, P1 OR The end of the OR gate contains a complementary sequence to the DNAzyme, and there are two additional domains that are complementary to miRNA-499 and miRNA-1233, respectively. Either of these two sequences can trigger strand displacement amplification, releasing the DNAzyme chain for subsequent reactions. Here, the presence of miRNA-499 or miRNA-1233 is considered as input "1", while their absence is defined as "0". For the output, luminescence values ​​less than the threshold value of 3000 are defined as output 0, and values ​​greater than 3000 are assigned as output 1. The performance of the OR gate was verified by PAGE experiments, as shown in Figure 5 As shown in B, three chains are involved here, including miRNA-499 (lane 1), miRNA-1233 (lane 2) and template chain P1 OR (Lane 3). miRNA-499 hybridizes with P1OR to form a double strand (Lane 4). miRNA-1233 hybridizes with P1OR to form a double strand (Lane 6). OR Hybridization (lane 8), these simple chain hybridizations, their success can be judged by observing the increase in DNA molecular weight in the lane. Then, the three chain displacement amplification processes were verified in the presence of two proteases (Klenow fragment, Nb.BbvCI) (lanes 5, 7, 9). It can be observed that in the presence of any target miRNA or both, new bands consistent with the position of the DNAzyme chain in lane 10 appeared, indicating the correct OR gate logic response. Subsequently, electrochemiluminescence measurements were performed, using 100pM of the two targets as inputs to the logic gate, and the input patterns were (0, 0), (0, 1), (1, 0), (1, 1). ECL measurements were performed in buffer and 10% serum, respectively. Figure 5 D shows the ECL potentials of different input modes in 10% serum. Figure 5 E compares the response signals in buffer and 10% serum under different input modes. The analysis results of serum were not significantly different from those of buffer, indicating that the sensing platform has good detection performance in serum samples and these results are consistent with Figure 5The expected truth table listed in C is exactly the same, proving the correct response of the OR gate.

[0101] like Figure 6 A shows the design principle of AND gate. AND template chain includes two partially complementary paired P1 AND and P2 AND , P1 AND The complementary sequence of miRNA-1233 and the similar sequence of miRNA-499 are contained in P2 AND The miRNA-499 and DNAZYME chains contain complementary sequences and endonuclease cleavage sites, which hybridize to form a composite chain. miRNA-1233 is used as the first primer and can be used along P1 AND Template extension. After that, P2 AND The miRNA-499 antisense sequence at the 3' end of the AND gate is released from the double strand, which can capture miRNA-499 for SDA reaction and release the DNAZYME chain. The AND gate requires two targets to trigger together to release the DNAZYME chain. Figure 6 The PAGE experiment in B verified the feasibility of the AND gate, including miRNA-499 (lane 1), miRNA-1233 (lane 2) and template strand P1 AND (lane 3) and P2 AND (Lane 4). P1 AND and P2 AND Hybridization forms AND gate template strand (lane 5). By adding target strand miRNA-1233 (lane 6), miRNA-1233 and miRNA-499 (lane 7) to the AND gate, it can be observed that after the addition of miRNA-1233, due to its interaction with P1 AND The single-stranded part of the AND gate is partially complementary to the hybridization, so a band with a larger molecular weight is formed. After the addition of miRNA-499, since the complementary sequence of miRNA-499 in the AND gate template chain is not exposed, no new band is formed compared to lane 6. Then these three situations were verified in the presence of two proteases (lanes 9, 10, and 11). Lanes 9 and 10 prove that incubating miRNA-499 or miRNA-1233 alone will not produce any new bands. Only when miRNA-499 and miRNA-1233 are mixed with the AND gate template chain, a new band with the same molecular weight as the DNAZYME chain in lane 11 will appear, indicating that the DNAZYME chain can only be generated when two targets are present at the same time, which is consistent with the logical response of the AND gate. In the electrochemiluminescence measurement, 100pM of the two targets are used as the input of the logic gate, and the input mode is (0, 0), (0, 1), (1, 0), (1, 1), and the signal response is recorded in buffer and 10% serum, respectively. Figure 6 D recorded the ECL intensity-potential curves of different input modes in 10% serum. Figure 6 E compares the response signals in buffer and 10% serum under different input modes. The response signal of 10% serum is highly correlated with the signal in buffer, which proves the good response performance of AND gate sensing platform in serum samples and meets the requirements of Figure 6 The expected truth table for C verifies the correct response of the AND gate.

[0102] like Figure 7 A shows the design principle of the INHIBIT gate. The INHIBIT template chain also includes two partially complementary paired P1 INH and P2 INH .P1 INH The complementary sequence of miRNA-1233, DNAzyme chain similar sequence and endonuclease nicking site are included in P2 INH Contains the antisense sequence of miRNA-499 and DNAZYME strands and the endonuclease cleavage site, P1 INH and P2 INH Hybridization forms a composite strand as the template strand of the INHIBIT gate. miRNA-1233 can be combined with P1 INH Template complementary hybridization undergoes SDA reaction in the presence of polymerase and endonuclease to release the complementary strand of the DNAZYME strand. INH Template extension releases the DNAzyme chain. In the presence of two miRNAs, the co-released DNAzyme chain and the complementary chain of DNAzyme form a stable double-stranded structure, which inactivates the DNAzyme chain. Among them, miRNA-1233 acts as an inhibitory element. The output signal only shows a high level when miRNA-1233 is input at a low level and miRNA-499 is input at a high level. The feasibility of the INH gate was verified by PAGE ( Figure 7 B), miRNA-499 (lane 1), miRNA-1233 (lane 2) and template strand P1 INH (Lane 3) and P2I NH (Lane 4). P1 INH and P2 INH Hybridization forms the INH gate template strand (lane 5). By adding the target strand miRNA-1233 (lane 6), miRNA-499 (lane 7), and both (lane 8) to the INH gate template strand, it can be observed that after the addition of miRNA-1233, due to its interaction with P1 INH The single-stranded part of P2 is complementary to each other, so a band with a larger molecular weight is formed. After the addition of miRNA-499, due to its INHThe single-stranded parts of the miRNAs were partially hybridized complementary to each other, and a band with a larger molecular weight was also formed. When the two miRNAs co-existed, the migration speed was further slowed down. Subsequently, the hybridization of the three chains was verified in the presence of two proteases (lanes 9, 10, and 11). It can be observed that in the presence of miRNA-1233, a new band with the same molecular weight as the DNAZYMEB chain (lane 12) was produced, and in the presence of miRNA-499, a new band with the same molecular weight as the DNAZYME chain (lane 11) was produced. The new band formed in the presence of the two miRNAs was consistent with the migration speed of the hybrid chains of DNAZYME and DNAZYMEB, indicating a correct INH gate logic response. Electrochemiluminescence measurements were also performed. Figure 7 D records the response values ​​of ECL signals with different input modes in 10% serum as the voltage changes. Figure 7 E compares the response signals in buffer and 10% serum under different input modes. It is observed that the analysis results of 10% serum under different input modes are consistent with the analysis results of buffer and conform to Figure 7 The truth table of the INH gate in C demonstrates the correct response of the INH gate to the target miRNA and its excellent detection performance for biological samples.

[0103] Through the construction of the basic logic gates mentioned above, we further attempted to expand the cascade logic gates that respond to multiple inputs for intelligent identification of multiple miRNAs. The cascade logic gates that form multiple inputs through the combination of basic logic gates can be used to judge the detailed information of the inputs, thereby completing the identification of AMI and APE. miRNA-499, miRNA-1233 and miRNA-133 are used as three inputs. Through this three-input logic gate, another marker of acute myocardial infarction, miRNA-133, is used to assist miRNA-499 in identification. The working mechanism of the cascade logic gate is as follows Figure 8 As shown in A, a new cascade logic gate is constructed by combining the INH gate and the AND gate. Here, the INH gate uses miRNA-499 and miRNA-1233 as input signals, miRNA-1233 as an inhibitory element, and the SE chain output by the prohibition gate is used as an input signal of the AND gate. The other input signal of the AND gate is miRNA-133, a marker of acute myocardial infarction, and the AND gate output has a DNAzyme chain. The performance of the INHIBIT-AND gate was verified using PAGE ( Figure 8 C), including CP1 INH (Lane 1), CP2 INH (Lane 2) and template strand CP1 AND (Lane 3) and CP2 AND (Lane 4). CP1 INH and CP2INH Hybridization of the INHIBIT partial template strand (lane 5) and CP1 in forming a cascade logic gate AND and CP2 AND Hybridization forms the AND gate part of the template chain in the cascade logic gate. Lanes 7 to 13 correspond to the truth table ( Figure 8 B) The amplified bands generated by the 7 target addition modes. From the results, it can be observed that only a new band with the same molecular weight as the DNAZYME chain in lane 14 is generated in lane 12, which corresponds to (input = 1, 0, 1) in the truth table, indicating a correct logical response.

[0104] The ECL signal responses were measured and recorded in buffer and 10% serum respectively under the 8 conditions in the truth table. Figure 8 D compares the response signals in buffer and 10% serum under different input modes. The signal response values ​​in serum are similar to those in buffer, indicating that the three-input INH-AND sensing platform has good detection performance in serum samples and these results are consistent with Figure 8 The expected truth table in B is consistent, proving the successful fabrication of the INH-AND gate. The INH-AND gate responds to eight input patterns of three miRNAs and only generates a high output signal when the input pattern is (0, 1, 1). This input pattern can complete the response to two specific miRNAs of AMI while excluding the APE marker miRNA-1233, and can simultaneously exclude the possibility of APE in the process of completing the diagnosis of AMI, thereby achieving the purpose of distinguishing these two diseases with similar symptoms.

Claims

1. An ECL biosensor based on DNA logic gates is prepared by the following method: (1) Pretreatment of electrodes; (2) Modifying the DNA tetrahedral scaffold on the electrode surface; (3) Add MCH to prevent nonspecific binding; (4) adding the circulating miRNA to a logic gate template chain, dNTPs, Klenow enzyme fragment, Nb.BbvCI enzyme, 0.01% BSA and magnesium ions to trigger an amplification reaction to obtain a DNAzyme chain; the logic gate template chain includes a YES gate template chain, an OR gate template chain, an AND gate template chain, an INH gate template chain, and an INH-AND cascade gate template chain; (5) Add the DNAzyme chain obtained from the amplification reaction to the electrode surface to produce enzyme cleavage products; (6) Hairpin HP1-modified ABEI-Au@MSNs were added to the electrode surface and incubated in the dark.

2. The ECL biosensor according to claim 1, characterized in that: Step (1) pretreatment includes polishing, cleaning and drying.

3. The ECL biosensor according to claim 1, characterized in that: Step (2) first electrochemically deposits gold on the electrode surface, and then modifies the electrode surface with a DNA tetrahedron scaffold; the DNA tetrahedron scaffold is mainly formed by annealing T1, T2, T3, T4 with thiol groups, and a hairpin probe HP (rA); the sequences of T1, T2, T3, T4, and HP (rA) are SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5 in the sequence list, respectively.

4. The ECL biosensor according to claim 1, characterized in that: Step (2) modification on the electrode surface refers to incubating the DNA tetrahedron scaffold on the electrode.

5. The ECL biosensor according to claim 1, characterized in that: Step (4) adding the circulating miRNA to a solution formed by a logic gate template chain, dNTPs, Klenow enzyme fragment, Nb.BbvCI enzyme, 0.01% BSA and magnesium ions, incubating at 37°C for 2 h and then incubating at 80°C for 20 min to obtain a DNAzyme chain; in the logic gate template chain, the YES gate template chain is P1 YES , OR gate template chain is P1 OR , AND gate template chain consists of P1 AND and P2 AND The INH door template chain consists of P1 INH and P2 INH The INH-AND cascade gate template chain consists of CP1 INH and CP2 INH The INHIBIT gate template strand and CP1 AND and CP2 AND The AND gate part template chain is formed; the P1 YES 、P1 OR 、P1 AND 、P2 AND 、P1 INH 、P2 INH 、CP1 INH 、CP2 INH 、CP1 AND 、CP2 AND , and their sequences are SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.15 in the sequence listing, respectively.

6. The ECL biosensor according to claim 1, characterized in that: Step (6) The synthesis method of ABEI-Au@MSNs modified with hairpin HP1 is to treat the annealed hairpin HP1 with tri-(2-carboxyethyl)phosphine hydrochloride, and then mix it with ABEI-Au@MSNs; the hairpin HP1 is SEQ NO. 16 in the sequence table.

7. The ECL biosensor according to claim 1, characterized in that: Prepared by the following method: (1) Polish the electrode with alumina slurry, rinse thoroughly with ultrapure water, ultrasonically treat in ethanol and water, and dry at room temperature; (2) Place the electrode in 25 mM HAuCl4 electrolyte, electrochemically deposit gold, and then add 10 μL of DNA tetrahedron scaffold on the electrode and incubate for 4 h-6 h; (3) Add 1 mM MCH and incubate for 30 min; (4) Add circulating miRNA and logic gate template chain, 200 μM dNTPs, 0.04 U / μL Klenow fragment, 0.1 U / μL Nb.BbvCI, 0.01% BSA, and magnesium ions; incubate the reaction system at 37°C for 2 h to obtain a reaction solution, and then incubate at 80°C for 20 min for standby use; (5) Place 10 μL of the reaction solution from step (4) on the electrode surface and incubate for 3 h; (6) Prepare silica nanospheres MSNs, and then use the post-grafting method to modify the amino groups to obtain amino-modified silica nanospheres, which are then combined with N-(4-aminobutyl)-N-ethylisoluminol in HAuCl4 solution to obtain ABEI-Au@MSNs; treat the annealed hairpin HP1 with tri-(2-carboxyethyl)phosphine hydrochloride for 30 min, then mix it with ABEI-Au@MSNs and gently shake it at room temperature for 12 h to obtain hairpin HP1-modified ABEI-Au@MSNs; then drop 10 μL of hairpin HP1-modified ABEI-Au@MSNs onto the modified electrode surface and incubate at 37 °C in the dark for 2 h.

8. The ECL biosensor according to claim 7, characterized in that: The synthesis method of ABEI-Au@MSNs in step (6) is as follows: mix hexadecyltrimethylammonium bromide, sodium salicylate and triethylamine, then add triethoxysilane and react at 70-90°C; then extract with hydrochloric acid and methanol solution at 70-90°C to remove the template, and dry at 50-70°C overnight to obtain silica nanospheres; disperse the silica nanospheres in ethanol and ultrasonically treat, add 25wt%-28wt% ammonia water and aminopropyltriethoxysilane, vigorously stir to react for 10-15, wash with ethanol, and vacuum dry overnight to obtain amino MSNs; disperse the amino MSNs in distilled water and ultrasonically treat, then add 20-30 mM HAuCl4 solution and stir; then add N-(4-aminobutyl)-N-ethylisoluminol and stir at room temperature until the solution turns purple-red, and centrifuge and wash to obtain ABEI-Au@MSNs.

9. Use of the DNA logic gate-based ECL biosensor according to any one of claims 1 to 7 in the preparation of circulating miRNAs for detecting cardiovascular diseases or acute pulmonary embolism.

10. The use according to claim 8, characterized in that The circulating miRNA is one or more of miR-499, miR-1233, and miR-133.

Images