SNP (Single Nucleotide Polymorphism) molecular marker for identifying or assisting in identifying buffalo black hair color phenotype and application of SNP molecular marker

Abstract

The invention relates to the technical field of animal genetic breeding, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker for identification or auxiliary identification of buffalo black hair color phenotype and application of the SNP molecular marker. The invention provides an SNP molecular marker for identification or auxiliary identification of buffalo black hair color phenotype, the SNP molecular marker is located at the 14298688th base of a buffalo genome 18 # chromosome, and when the base at the site is T, the buffalo hair color is pure black hair color; the version number of the buffalo genome is UOAWB1. The molecular marker provided by the invention is an SNP molecular marker related to buffalo black hair color phenotype and can be independently or combined for genetically identifying the body hair color of the buffalo, the buffalo with the homozygote black hair color gene can be selected according to different requirements of buffalo breeding target characters, molecular assisted breeding is carried out, and the breeding efficiency is improved. And a convenient and accurate method is provided for breeding buffalo with different hair colors.

Description

Technical Field

[0001] The invention relates to the technical field of animal genetic breeding, and in particular to a SNP molecular marker for identifying or assisting in identifying a buffalo's black coat color phenotype and an application thereof. Background Art

[0002] Asian domestic buffalo (Bubalus bubalis) is divided into two main types - river type and swamp type. River type buffalo (Bubalus bubalis bubalis) is mostly distributed in South Asia, West Asia and the Mediterranean region, while swamp type buffalo (Bubalus bubalis kerabau) is mostly distributed in southern China and Southeast Asian countries. The common coat colors of buffalo are black and non-black. Black buffaloes are dark all over, such as Murrah buffaloes and Mediterranean buffaloes. Non-black buffaloes generally have gray or black bodies, lighter hair on the lower limbs, grayish white, and light gray or white stripes on the lower neck and chest.

[0003] The study of the gene location and mechanism of the black coat color trait of buffalo not only helps to reveal the molecular mechanism of coat coloring and enrich people's understanding of the mechanism of coat color formation, but also can develop molecular markers of buffalo coat color characteristics for breed purity determination and marker-assisted selection, providing scientific means for buffalo breed protection and breeding. However, so far, the genetic mechanism of buffalo black coat color and the method of molecular marker-assisted selection of black coat color have not been reported at home and abroad. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a SNP molecular marker for identifying or assisting in identifying the black coat color phenotype of buffalo and its application. The SNP molecular marker provided by the present invention can be used for genetically identifying the black coat color phenotype of buffalo and can be used for assisting breeding of black coat buffalo, and has good application prospects.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a SNP molecular marker for identifying or assisting in identifying a buffalo's black coat color phenotype. The SNP molecular marker is located at the 14298688th base of chromosome 18 of the buffalo genome. When the base at this site is T, the buffalo's coat color is pure black. The version number of the buffalo genome is UOA_WB_1.

[0007] Preferably, the SNP molecular marker is located at the 158th base of the nucleotide sequence shown in SEQ ID NO.1.

[0008] The present invention provides the use of the SNP molecular marker described in the above technical solution or the reagent for detecting the SNP molecular marker described in the above technical solution in any one of 1) to 3),

[0009] 1) preparing a kit for identifying or assisting in identifying the black fur color of buffalo;

[0010] 2) Identify or assist in identifying the black coat color phenotype of buffalo;

[0011] 3) Buffalo breeding.

[0012] Preferably, the buffalo breeding includes breeding pure black buffalo or breeding non-pure black buffalo.

[0013] Preferably, when the genotype of the SNP molecular marker is TT or TG, the buffalo's coat color is pure black; when the genotype of the SNP molecular marker is GG, the buffalo's coat color is non-pure black.

[0014] Preferably, the reagents include a primer pair.

[0015] Preferably, the primer pair includes primers whose nucleotide sequences are shown as SEQ ID NO.2 and SEQ ID NO.3.

[0016] The present invention provides a method for identifying or assisting in identifying a buffalo black coat color phenotype, comprising the following steps:

[0017] Using the genomic DNA of the buffalo to be tested as a template, PCR amplification is performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain an amplified product;

[0018] detecting the genotype of position 158 of the amplified product, and determining the black coat color phenotype of the buffalo to be tested according to the genotype result;

[0019] When the genotype at position 158 of the amplified product is TT or TG, the buffalo's coat color is pure black;

[0020] When the genotype at position 158 of the amplified product is GG, the buffalo's coat color is not pure black.

[0021] Preferably, the detection method comprises sequencing.

[0022] The present invention provides application of the method described in the above technical solution in buffalo breeding.

[0023] Beneficial effects:

[0024] The present invention provides a SNP molecular marker for identifying or assisting in identifying the black coat color phenotype of a buffalo. The SNP molecular marker is located at the 14298688th base of chromosome 18 of the buffalo genome. When the base at this site is T, the coat color of the buffalo is pure black; the version number of the buffalo genome is UOA_WB_1. The molecular marker provided by the present invention is a SNP molecular marker related to the black coat color phenotype of the buffalo, which can be used alone or in combination for genetic identification of the coat color of the buffalo. According to the different needs of the target traits of the breeding buffalo, a buffalo with a homozygous black coat color gene can be selected for molecular assisted breeding, which provides a convenient and accurate method for breeding buffaloes with different coat colors. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0026] Figure 1 The results of dual luciferase activity detection in different groups of cells in Example 2;

[0027] Figure 2 The electrophoresis gel image of the PCR product in Example 3;

[0028] Figure 3 The sequencing result of the TT genotype of g.14298688 marker;

[0029] Figure 4 The sequencing result of the GG genotype of g.14298688 marker;

[0030] Figure 5 This is the sequencing result of the TG gene marked by g.14298688. DETAILED DESCRIPTION

[0031] The present invention provides a SNP molecular marker for identifying or assisting in identifying the black coat color phenotype of a buffalo, wherein the SNP molecular marker is located at the 14298688th base of chromosome 18 of the buffalo genome, and when the base at the site is T, the coat color of the buffalo is pure black; the version number of the buffalo genome is UOA_WB_1. As an embodiment, the SNP molecular marker is located at the 158th base of the nucleotide sequence shown in SEQ ID NO.1.

[0032] SEQ ID NO.1:

[0033] 5'-TAATCTGCTGCTTGGCTGTCTGACCTGCTGGTGAGCGTCAGCAA CGTGCTGGAGACGGCAGTCATGCTGCTGCTGGAGGCCAGTGTCCTGGCCACCCAGGCGGCCGTGGTGCAGCAGCTGGACAATGTCATCGACGTGCTCATCTGCAGCTCCATTGTGTCCAGCCTCTGCTTCCTGGGTGCCATTGCTGTGGACCGCTACATCTCCAT-3'.

[0034] The present invention collected 215 buffalo samples worldwide, obtained SNP genotype information covering the entire genome through whole genome resequencing, and then used selection signals and association analysis to find SNP molecular markers significantly correlated with the black coat color trait of buffalo, and verified their functions through cell experiments. The present invention finally obtains a SNP molecular marker g.14298688 related to the black coat color trait of buffalo, and the SNP molecular marker is located at the base position 14298688 of chromosome 18 of the buffalo genome (genome version number: UOA_WB_1), and is located in the exon region of the MC1R gene; the molecular marker is a T / G mutation in the 158th base of the nucleotide sequence shown in SEQ ID NO.1, and the genotype of the molecular marker in pure black coat color buffalo is TT or TG, and the genotype of the molecular marker in non-pure black coat color buffalo is GG. In addition, when the genotype is TG, about 9% of the individuals show non-pure black coat color, so when the genotype is TG, it can be preliminarily identified as pure black coat color, and the genotype can be used as an auxiliary identification result.

[0035] Based on the above advantages, the present invention provides the use of the SNP molecular marker described in the above technical solution or the reagent for detecting the SNP molecular marker described in the above technical solution in any one of 1) to 3),

[0036] 1) preparing a kit for identifying or assisting in identifying the black fur color of buffalo;

[0037] 2) Identify or assist in identifying the black coat color phenotype of buffalo;

[0038] 3) Buffalo breeding.

[0039] As an embodiment, the buffalo breeding can be breeding pure black buffalo or breeding non-pure black buffalo. The SNP molecular markers provided by the present invention can be used alone or in combination to genetically identify the body hair color of buffalo, and buffaloes with different hair colors (pure black buffalo or breeding non-pure black buffalo) can be selected according to the different needs of the target traits of breeding buffalo.

[0040] As an embodiment, when the genotype of the SNP molecular marker is TT or TG, the buffalo's coat color is pure black; when the genotype of the SNP molecular marker is GG, the buffalo's coat color is not pure black.

[0041] As an embodiment, the reagent includes a primer pair; the primer pair can be primers with nucleotide sequences such as SEQ ID NO.2 and SEQ ID NO.3, or other specific primers can be used as long as the detection of the molecular markers of the present invention can be achieved.

[0042] The present invention provides a method for identifying or assisting in identifying a buffalo black coat color phenotype, comprising the following steps:

[0043] Using the genomic DNA of the buffalo to be tested as a template, PCR amplification is performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain an amplified product;

[0044] detecting the genotype of position 158 of the amplified product, and determining the black coat color phenotype of the buffalo to be tested according to the genotype result;

[0045] When the genotype at position 158 of the amplified product is TT or TG, the buffalo's coat color is pure black;

[0046] When the genotype at position 158 of the amplified product is GG, the buffalo's coat color is not pure black.

[0047] As an embodiment, the detection method is sequencing, specifically Sanger sequencing.

[0048] The present invention provides application of the method described in the above technical solution in buffalo breeding.

[0049] As an embodiment, the buffalo breeding can be breeding pure black buffalo or breeding non-pure black buffalo. The method provided by the present invention can identify the body hair color of buffalo from a genetic perspective, and can select buffaloes with different hair colors (pure black buffalo or breeding non-pure black buffalo) according to different requirements of the target traits of breeding buffalo.

[0050] To further illustrate the present invention, a SNP molecular marker for identifying or assisting in identifying the black coat color phenotype of buffalo and its application provided by the present invention are described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0051] Example 1 Obtaining molecular markers associated with the black coat color phenotype of buffalo

[0052] 1. Sample collection

[0053] A total of 215 buffalo samples were collected worldwide. The samples were ear epithelial tissues, placed in sample tubes containing 75% alcohol and stored at -80°C.

[0054] 2. Extraction of buffalo genomic DNA

[0055] The genomic DNA was extracted using the phenol-chloroform method.

[0056] 3. Genome sequencing and mutation detection

[0057] Whole genome resequencing was performed using the Illumina HiSeq Xten sequencing platform, with a target sequencing depth of 10×. The sequencing reads were aligned to the buffalo reference gene (UOA_WB_1) using the MEM method using the BWA software (http: / / bio-bwa.sourceforge.net / ), with an average alignment rate of 99.31% and a coverage of 98.34%. GATK software (https: / / software.broadinstitute.org / gatk / ) was used for variant detection and quality control, and a total of 58,204,651 SNPs were obtained for subsequent analysis.

[0058] 4. Data collation and analysis

[0059] (1) Genotype data quality control

[0060] PLINK software (http: / / www.cog-genomics.org / plink2) was used to perform quality control on SNP sites with poor polymorphism and low detection rate. The specific quality control standards were as follows: SNP detection rate (SNP call rate)>90%; minimal allele frequency (MAF)>5%.

[0061] (2) Select signal analysis and correlation analysis

[0062] Using F st and θ π Methods Selection signals were analyzed in 40 pure black buffaloes (both trunk and limbs were black; including 20 Italian buffaloes, 7 Bengal buffaloes, and 13 Pakistani buffaloes) and 29 wild-type buffaloes (black trunk and grayish-white limbs; all Nepalese buffaloes) to locate the regions and genes significantly affected by selection. SNPEFF software (http: / / snpeff.sourceforge.net / ) was used to annotate SNPs in the significant regions, analyze the mutation types and possible functional effects, and screen potential candidate mutation sites.

[0063] In addition, in a sample group of 146 buffaloes with phenotypic records (including 49 Iraqi buffaloes, 45 Pakistani buffaloes, 21 Egyptian buffaloes, 20 Nepalese buffaloes, and 11 Bangladeshi buffaloes), PLINK software was used to conduct a case-control candidate site association analysis on buffaloes with two coat colors, and the chi-square test statistical method based on the dominant genetic model was used to determine the causal mutation site.

[0064] 5. Results Analysis

[0065] (1) Select signal analysis

[0066] Significant selected regions were identified in the 14160001-14470000 region of buffalo chromosome 18, among which the MC1R gene region had the highest selection signal. Annotation revealed that there were two missense mutation sites in the MC1R gene, c.14298614G>A (denoted as g.14298614) and c.14298688G>T (denoted as g.14298688), which resulted in amino acid substitutions of p.Gly104Ser and p.Met128Ile, respectively, and were potential candidate causative mutation sites.

[0067] (2) Association analysis of candidate sites

[0068] The genotyping results of the g.14298614 locus are shown in Table 1.

[0069] Table 1 Genotype frequency distribution of SNP site g.14298614

[0070]

[0071] Note: A-mutation, G-normal, E-09 is 10 -9 .

[0072] The genotyping results of the g.14298688 locus are shown in Table 2.

[0073] Table 2 Genotype frequency distribution of SNP site g.14298688

[0074]

[0075] Note: T-mutation, G-normal, E-25 is 10 -25 .

[0076] The results of association analysis showed that the g.14298688 marker had a more significant association with black coat color. According to the statistical results, when the g.14298688 marker genotype was TT, there was a 100% chance that the individual was black coat color, when the g.14298688 marker genotype was TG, there was a 90.9% chance (30 / 33×100%=90.9%) chance that the individual was black coat color, and when the g.14298688 marker genotype was GG, there was a 90.3% chance that the individual was non-black coat color.

[0077] Example 2 Functional verification of SNP marker g.14298688

[0078] 1. Test methods

[0079] Human renal epithelial cell line (293T cells) was used for functional verification of MC1R gene mutation sites. Recombinant plasmids were constructed based on the key mutation sites of MC1R gene (g.14298688 and g.14298614), as follows:

[0080] The chemically synthesized cDNA of the wild-type (WT, SEQ ID NO.4) buffalo MC1R gene and the cDNAs of two mutant buffalo MC1R genes obtained by point mutation on the basis of the wild type were respectively inserted between the HindIII and Xho I restriction sites of the pcDNA3.1(+) plasmid to obtain pcDNA3.1-WT plasmid, pcDNA3.1-bMC1R-1 plasmid and pcDNA3.1-bMC1R-2 plasmid; among them, the mutant buffalo MC1R with the mutation site g.14298688 was recorded as bMC1R-1; the mutant buffalo MC1R with the mutation site g.14298614 was recorded as bMC1R-2.

[0081] SEQ ID NO.4:

[0082] 5'-gccaccATGCCTGCACTCGGCTCCCAGAGACGGCTGCTGGGTTCCCTT AACTGCACGCCCCCAGCCACCCTCCCCCTCACTCCGGCCCCCAACCGGACGGGGCCCCAGTGCCTGGAGGTGTCCATCCCTGATGGGCTCTTTCTCAGCCTGGGGCTGGTGAGTCTCGTGGAGAACGTGCTGGTAGTGGCTGCCATCGCCAAGAACCGCAACCTGCACTCCCCCATGTACTACTTAATCTGCTGCTTGGCTGTGTCTGACCTGCTGGTGAGCGTCAGCAACGTGCTGGAGACGGCAGTCATGCTGCTGCTGGAGGCCGGTGTCCTGGCCACCCAGGCGGCCGTGGTGCAGCAGCTGGACAATGTCATCGACGTGCTCATCTGCAGCTCCATGGTGTCCAGCCTCTGCTTCCTGGGTGCCATTGCTGTGGACCGCTACATCTCCATCTTCTACGCCCTGCGGTACCACAGCGTTGTGACGCTGTCCCGAGCGTGGAGGATCATTGCGGCCATCTGGGTGGCCAGCATCCTCACCAGCCTGCTCTTCATCACCTACTACAACCACAAGGTCGTACTGCTGTGCCTCGTTGGCTTCTTCGTAGCTATGCTGGCCCTGATGGCCATCCTCTACGTCCACATGCTGGCCCGGGCCTGCCAGCATGCCCGGGGCATCGCCCGGCTCCAGAAGAGGCAGCGCCCCATTCATCAGGGCTTTGGCCTCAAGGGCGCTGCCACCCTCACCATCCTGCTGGGCGTCTTCTTCCTCTGCTGGGGCCCCTTCTTCTTGCACCTCTCGCTCATCGTCCTCTGCCCCCAGCACCCCACCTGTGGCTGCATCTTCAAGAACTTCAACCTCTTCCTGGCCCTCATCATTTGCAATGCCATTGTGGACCCCCTCATCTATGCCTTCCGCAGCCAGGAGCTCCGGAAGACACTCCAAGAGGTGCTGCAGTGCTCCTGGTGA-3';

[0083] The nucleotide sequence of bMC1R-1 is shown in SEQ ID NO.5, and is as follows:

[0084] 5'-gccaccATGCCTGCACTCGGCTCCCAGAGACGGCTGCTGGGTTCCCTTAACTGCACGCCCCCAGCCACCCTCCCCCTCACTCCGGCCCCCAACCGGACGGGGCCCCAGTGCCTGGAGGTGTCCATCCCTGATGGGCTCTTTCTCAGCCTGGGGCTGGTGAGTCTCGTGGAGAACGTGCTGGTAGTGGCTGCCATCGCCAAGAACCGCAACCTGCACTCCCCCATGTACTACTTAATCTGCTGCTTGGCTGTGTCTGACCTGCTGGTGAGCGTCAGCAACGTGCTGGAGACGGCAGTCATGCTGCTGCTGGAGGCCGGTGTCCTGGCCACCCAGGCGGCCGTGGTGCAGCAGCTGGACAATGTCATCGACGTGCTCATCTGCAGCTCCATTGTGTCCAGCCTCTGCTTCCTGGGTGCCATTGCTGTGGACCGCTACATCTCCATCTTCTACGCCCTGCGGTACCACAGCGTTGTGACGCTGTCCCGAGCGTGGAGGATCATTGCGGCCATCTGGGTGGCCAGCATCCTCACCAGCCTGCTCTTCATCACCTACTACAACCACAAGGTCGTACTGCTGTGCCTCGTTGGCTTCTTCGTAGCTATGCTGGCCCTGATGGCCATCCTCTACGTCCACATGCTGGCCCGGGCCTGCCAGCATGCCCGGGGCATCGCCCGGCTCCAGAAGAGGCAGCGCCCCATTCATCAGGGCTTTGGCCTCAAGGGCGCTGCCACCCTCACCATCCTGCTGGGCGTCTTCTTCCTCTGCTGGGGCCCCTTCTTCTTGCACCTCTCGCTCATCGTCCTCTGCCCCCAGCACCCCACCTGTGGCTGCATCTTCAAGAACTTCAACCTCTTCCTGGCCCTCATCATTTGCAATGCCATTGTGGACCCCCTCATCTATGCCTTCCGCAGCCAGGAGCTCCGGAAGACACTCCAAGAGGTGCTGCAGTGCTCCTGGTGA-3';

[0085] The nucleotide sequence of bMC1R-2 is shown in SEQ ID NO.6, and is as follows:

[0086] 5'-gccaccATGCCTGCACTCGGCTCCCAGAGACGGCTGCTGGGTTCCCTTAACTGCACGCCCCCAGCCACCCTCCCCCTCACTCCGGCCCCCAACCGGACGGGGCCCCAGTGCCTGGAGGTGTCCATCCCTGATGGGCTCTTTCTCAGCCTGGGGCTGGTGAGTCTCGTGGAGAACGTGCTGGTAGTGGCTGCCATCGCCAAGAACCGCAACCTGCACTCCCCCATGTACTACTTAATCTGCTGCTTGGCTGTGTCTGACCTGCTGGTGAGCGTCAGCAACGTGCTGGAGACGGCAGTCATGCTGCTGCTGGAGGCCAGTGTCCTGGCCACCCAGGCGGCCGTGGTGCAGCAGCTGGACAATGTCATCGACGTGCTCATCTGCAGCTCCATGGTGTCCAGCCTCTGCTTCCTGGGTGCCATTGCTGTGGACCGCTACATCTCCATCTTCTACGCCCTGCGGTACCACAGCGTTGTGACGCTGTCCCGAGCGTGGAGGATCATTGCGGCCATCTGGGTGGCCAGCATCCTCACCAGCCTGCTCTTCATCACCTACTACAACCACAAGGTCGTACTGCTGTGCCTCGTTGGCTTCTTCGTAGCTATGCTGGCCCTGATGGCCATCCTCTACGTCCACATGCTGGCCCGGGCCTGCCAGCATGCCCGGGGCATCGCCCGGCTCCAGAAGAGGCAGCGCCCCATTCATCAGGGCTTTGGCCTCAAGGGCGCTGCCACCCTCACCATCCTGCTGGGCGTCTTCTTCCTCTGCTGGGGCCCCTTCTTCTTGCACCTCTCGCTCATCGTCCTCTGCCCCCAGCACCCCACCTGTGGCTGCATCTTCAAGAACTTCAACCTCTTCCTGGCCCTCATCATTTGCAATGCCATTGTGGACCCCCTCATCTATGCCTTCCGCAGCCAGGAGCTCCGGAAGACACTCCAAGAGGTGCTGCAGTGCTCCTGGTGA-3';SEQ ID NO.4~SEQ ID NO.The lowercase gccacc shown in 6 is a Kozak sequence. .

[0087] 0.1 μg of mixed plasmids were co-transfected into HEK293T cells by Lipofectamine 2000 (Invitrogen), and after 4 hours, the transfection mixture was replaced with growth medium; the mixed plasmid consisted of MC1R plasmid, pGL4.29[luc2P-CRE-Hygro] plasmid and pRL-TK plasmid, and the mass ratio of the MC1R plasmid, pGL4.29[luc2P-CRE-Hygro] plasmid and pRL-TK plasmid was 2:10:1; the MC1R plasmid was pcDNA3.1-WT plasmid, pcDNA3.1-bMC1R-1 plasmid or pcDNA3.1-bMC1R-2 plasmid; and the growth medium was DMEM medium containing fetal bovine serum.

[0088] Without α-melanocyte stimulating hormone (α-MSH) stimulation, the dual luciferase activity in cells expressing wild-type MC1R and mutant MC1R was detected using a dual luciferase reporter gene assay kit (Promega); the concentration was 10 -7 After 6 hours of exposure to α-MSH from M, cells expressing wild-type MC1R and mutant MC1R were treated with a dual-luciferase reporter gene assay kit (Promega) to detect dual-luciferase activity in the cells, which indirectly reflects the amount of intracellular cAMP and thus studies the activity of the cAMP pathway. All experiments were repeated 3 times, and the data were expressed as mean ± standard error. The t-test was used to analyze the differences between the two groups, and P < 0.05 was the significance test threshold. Results are shown in Figure 1 , where basal level refers to the result without α-MSH stimulation, and α-MSH stimulation refers to the result with 10 -7 Results of α-MSH stimulation of M; **P<0.01, ***P<0.001.

[0089] 2. Results Analysis

[0090] In vitro experiments were performed on HEK293T cells expressing wild-type (WT) and mutants. Under basal levels and α-MSH stimulation, cells with the g.14298688 mutant had higher levels of cAMP accumulation compared with WT (P<0.05). It can be seen that the mutation at g.14298688 increased MC1R-mediated cAMP production, thereby increasing the synthesis of melanin, ultimately resulting in the buffalo's coat color being pure black.

[0091] Therefore, the present invention uses g.14298688 as a molecular marker related to the black coat color trait of buffalo for auxiliary selection.

[0092] Example 3g. Sanger sequencing detection of 14298688

[0093] (1) Primer design

[0094] Based on the upstream and downstream sequence information of the SNP marker, specific primers were designed as follows:

[0095] Upstream primer: 5'-TAATCTGCTGCTTGGCTGTG-3' (SEQ ID NO. 2);

[0096] Downstream primer: 5'-ATGGAGATGTAGCGGTCCAC-3' (SEQ ID NO. 3);

[0097] (2) PCR amplification

[0098] PCR reaction system: total volume 25 μL, including 10×Buffer 2.5 μL, dNTP mixture (2.5 mM each) 2 μL, Taq enzyme (5 U / μL) 0.5 μL, upstream and downstream primers (20 μM) 0.5 μL each, genomic DNA template 1 μg and the balance ddH2O.

[0099] PCR reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec, 35 cycles; final extension at 72°C for 7 min.

[0100] The instrument was Applied Biosystems 9700 PCR instrument.

[0101] (3) Gel electrophoresis detection and sequencing of PCR products

[0102] Prepare 2% agarose gel, take 3 μL of PCR product of each sample, and electrophoresed at 110V in TAE buffer for 40 minutes, and observe the electrophoresis results in a gel imaging system. PCR products were sequenced by Sanger sequencing.

[0103] (4) PCR product sequencing and genotype determination

[0104] PCR product gel image Figure 2 As shown, the product length is 211 bp.

[0105] The PCR products were subjected to Sanger sequencing, and the three genotypes of each SNP marker could be clearly determined based on the sequencing peak graph. The nucleotide sequence of the amplified product of the black homozygous genotype individual is as follows: Figure 3 As shown; the nucleotide sequence of the amplified product of non-black individuals is as follows Figure 4As shown; the nucleotide sequence of the amplified product of the black heterozygous genotype individual is as follows Figure 5 shown.

[0106] (5) Test result statistics

[0107] Based on the above detection method, the present invention detected a total of 44 Chinese buffalo samples, including 33 pure black buffaloes (22 Mora buffaloes, 10 Binglangjiang buffaloes, and 1 Dehong buffalo), and 11 non-pure black buffaloes (1 Dehong buffalo, 2 southeastern Yunnan buffaloes, 2 Guizhou buffaloes, 2 Shanghai buffaloes, and 4 Yanjin buffaloes). The genotyping results are shown in Table 3. All pure black buffaloes are TT or TG, and all wild-type buffaloes (black or gray body, gray limbs) are GG. The detection accuracy is 100%.

[0108] Table 3 PCR typing results of SNP site g.14298688

[0109]

[0110] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker for identifying or assisting in identifying the black coat color phenotype of buffalo, characterized in that: The SNP molecular marker is located at the 14298688th base of chromosome 18 of the buffalo genome. When the base at this site is T, the buffalo's coat color is pure black; the version number of the buffalo genome is UOA_WB_1.

2. The SNP molecular marker according to claim 1, characterized in that: The SNP molecular marker is located at the 158th base of the nucleotide sequence shown in SEQ ID NO.

1.

3. Use of the SNP molecular marker according to claim 1 or 2 or a reagent for detecting the SNP molecular marker according to claim 1 or 2 in any one of 1) to 3), 1) preparing a kit for identifying or assisting in identifying the black fur color of buffalo; 2) Identify or assist in identifying the black coat color phenotype of buffalo; 3) Buffalo breeding.

4. The use according to claim 3, characterized in that: The buffalo breeding includes breeding pure black-haired buffalo or breeding non-pure black-haired buffalo.

5. The use according to claim 3 or 4, characterized in that: When the genotype of the SNP molecular marker is TT or TG, the buffalo's coat color is pure black; when the genotype of the SNP molecular marker is GG, the buffalo's coat color is non-pure black.

6. The use according to claim 3, characterized in that: The reagents include a primer pair.

7. The use according to claim 6, characterized in that: The primer pair includes primers whose nucleotide sequences are shown as SEQ ID NO.2 and SEQ ID NO.

3.

8. A method for identifying or assisting in identifying the black coat color phenotype of buffalo, characterized in that: The following steps are involved: Using the genomic DNA of the buffalo to be tested as a template, PCR amplification is performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain an amplified product; detecting the genotype of position 158 of the amplified product, and determining the black coat color phenotype of the buffalo to be tested according to the genotype result; When the genotype at position 158 of the amplified product is TT or TG, the buffalo's coat color is pure black; When the genotype at position 158 of the amplified product is GG, the buffalo's coat color is not pure black.

9. The method according to claim 8, characterized in that The detection method includes sequencing.

10. Application of the method according to claim 8 in buffalo breeding.

Images