Kit for detecting SNP (Single Nucleotide Polymorphism) markers of Duolang sheep double lambs of local mutton sheep in southern Xinjiang and application of kit

Abstract

The invention discloses a kit for detecting SNP markers of Duolang sheep double lambs of local mutton sheep in southern Xinjiang and application of the kit, and relates to the field of molecular breeding, the SNP markers are located at the downstream of COL21A1 genes and located at the 4505310th site of the 20th chromosome of the sheep, the original basic group is T, and the variant basic group is C; the nucleotide sequence of the SNP marker is NSE, and the lambing number of TC genotype individuals at the SNP site is significantly higher than that of TT genotype individuals. The nucleotide sequences of the primer disclosed by the invention are NSEF1 and NSER2. The kit is applied to detection of the lambing number of the Duolang sheep, and how the lambing traits of the Duolang sheep are determined by detecting the genotype of the SNP marker. The kit provided by the invention can be used for breeding of duolang sheep breeding traits.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular breeding, and in particular to a kit for detecting SNP markers of twin lambs of Duolang sheep, a local mutton sheep in southern Xinjiang, and application thereof. Background Art

[0002] Duolang sheep is an excellent sheep breed in Xinjiang that can be used for both meat and fat. It belongs to the genus Ovis of the family Ovis of the order Artiodactyla. Because its central production area is in Maigaiti County, it is also called Maigaiti sheep. Duolang sheep are large in size, produce a lot of meat, and the meat is tender. Their coat contains a lot of down and the hair quality is good. They have a high reproduction rate and are precocious, making them an ideal breed for organizing lamb meat production.

[0003] Duolang sheep have high reproductive capacity and early sexual maturity. Generally, male lambs mature at 6-7 months of age; female lambs are first mated at 6-8 months of age, and most one-year-old ewes have already given birth. The estrus cycle of ewes is generally 15-18 days, and the average duration of estrus is 24-48 hours. The gestation period is 150 days. Generally, three litters are born in two years, and those with good fatness can give birth to two litters a year. The twin lamb rate is relatively high, reaching 33%, and there are cases of three or four lambs in one litter. A ewe can give birth to 15 lambs in her lifetime.

[0004] However, there are significant differences in the number of lambs born by different multi-lang ewes. Therefore, how to predict the number of lambs born by multi-lang ewes in advance and effectively select multi-lang ewes for breeding remains a technical problem that herders need to solve urgently.

[0005] In the Chinese patent CN108048578B, it was found that the number of lambs born in Duolang sheep is closely related to the SNP sites at 32015148G>A and 32033237A>G in the NCOA1 gene. However, the inventors of the present invention found in further research that the SNP sites related to the number of lambs born in Duolang sheep are not limited to the SNP sites disclosed in the above patent, and thus completed the present invention. Summary of the invention

[0006] In view of this, the embodiment of the present invention provides a kit for detecting SNP markers of twin lambs of Duolang sheep, a local meat sheep in southern Xinjiang, and its application. To achieve the above purpose, the present invention mainly provides the following technical solutions:

[0007] On the one hand, the present invention relates to a kit for detecting SNP markers of twin lambs of Duolang sheep, a local meat sheep in southern Xinjiang. The SNP marker is located at position 4505310 on chromosome 20 of the sheep, the original base is T, and the variant base is C; the nucleotide sequence where the SNP marker is located is NSE.

[0008] In a preferred embodiment of the present invention, the SNP marker further comprises NCOA1 gene SNP sites 32015148G>A and / or 32033237A>G. The use of the SNP sites known in the prior art and the newly discovered SNP sites of the present invention together helps to further improve the detection accuracy.

[0009] Preferably, the number of lambs born by individuals with TC genotype at the SNP site is significantly higher than that of individuals with TT genotype.

[0010] On the other hand, the kit of the present invention comprises primers for detecting the above-mentioned SNP markers, and the nucleotide sequence of the primers is NSE.

[0011] On the other hand, an embodiment of the present invention provides the use of the above-mentioned detection kit in the breeding of Duolang sheep.

[0012] On the other hand, an embodiment of the present invention provides a method for screening SNP markers that affect the number of lambs born in Duolang sheep, the method comprising: determining the lamb number trait of the sheep by detecting the above-mentioned SNP markers in the genes of the sheep to be tested.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The present invention uses the whole genome association analysis method based on whole genome resequencing to screen out the above-mentioned specific SNP site, and verifies the credibility of this site through first-generation sequencing, and further determines the genotype of individuals with high lambing number through association analysis with lambing number, and determines whether the SNP site significantly affects the lambing number of Duolang sheep through significance test analysis, and finally determines and screens out the SNP markers that affect the lambing number of Duolang sheep. The genotypes determined in the method of the present invention are TT and TC, and individuals with TC genotypes are selected to select and improve the lambing number of Duolang sheep. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The Manhattan plots calculated by two softwares in the method of the embodiment of the present invention are: the autosomes (A) and the X chromosome (B) calculated by the PLINK software; the Manhattan plots calculated by the GCTA software, the autosomes (C) and the X chromosome (D); the Manhattan plots calculated by the SAIGE software, the autosomes (E) and the X chromosome (F); G, the information of 18 significant or suggestive loci, different colors represent the proportion of different genotypes in the group, the top of each locus map is the annotated gene, and the right side from top to bottom is the physical position, the P value of GWAS, the P value of the additive effect of a single locus, and the P value of the heterozygous effect of a single locus.

[0016] Figure 2: This is the Manhattan diagram of the overdominant effect in the method of the embodiment of the present invention: A, Manhattan diagram calculated by plink software; B, Manhattan diagram calculated by GCTA software; C, Manhattan diagram calculated by SAIGE software; D, information of 27 significant or suggestive loci, different colors represent the proportion of different genotypes in the group, the top of each locus diagram is the annotated gene, and the right side from top to bottom are the physical position, the P value of GWAS, and the P value of the heterozygous effect of a single locus.

[0017] Figure 3 This is a diagram of genomic DNA extraction in the method of the embodiment of the present invention;

[0018] Figure 4 It is a PCR amplification diagram in the method of the embodiment of the present invention;

[0019] Figure 5 This is the genotype diagram of this site determined by first-generation sequencing of 120 sheep in the method of the embodiment of the present invention. DETAILED DESCRIPTION

[0020] In order to further explain the technical means and effects adopted by the present invention to achieve the predetermined invention purpose, the specific implementation methods, technical solutions, features and effects of the present invention application are described in detail below with preferred embodiments. The specific features, structures, or characteristics of the multiple embodiments in the following description can be combined in any suitable form.

[0021] Example 1

[0022] (1) Genome-wide association analysis of reproductive traits in Duolang sheep

[0023] Based on the whole genome sequence (10X) variation data of 151 twin-born sheep and 151 single-born sheep, the first five principal components were used as fixed effects. Case-control additive effect GWAS analysis was performed using three softwares: plink, SAIGE, and GCTA. It was found that 18 gene loci had significant or suggestive signals (P<1×10-6) ( Figure 1 AF). Further single-locus chi-square test found that these 18 gene loci were significantly different in the single- and twin-lamb groups (P<0.05). We further used chi-square test to detect the difference between heterozygotes and homozygotes in the single- and twin-lamb groups, and found that 16 loci were significantly different (P<0.05) ( Figure 1 G).

[0024] Based on the additive effect GWAS finding that there are significant differences in heterozygotes between groups in significant or suggestive loci, we further conducted a GWAS analysis of heterozygote effects (i.e., overdominant effects) and found that 27 gene loci had significant or suggestive signals (P < 1×10 -6 )( Figure 2 AC). Further chi-square test found that the effects of these 27 gene loci were significant (P<0.001) ( Figure 2 D) Association analysis revealed that the SNP at position 4505310 on chromosome 20 of sheep was strongly associated with the number of lambs. In order to further verify whether this site has false positives and whether the mutation affects the number of lambs, this study selected another 120 sheep for verification experiments.

[0025] (2) Extraction and detection of genomic DNA

[0026] DNA was extracted from the blood samples of 120 sheep using the phenol-chloroform extraction method. The quality of the DNA was tested by 1% agarose gel electrophoresis. After meeting the requirements, it was placed in a -200C refrigerator for future use. The genomic DNA was tested by 1% agarose gel electrophoresis. The results showed that the genomic DNA bands were clear and bright ( Figure 3 ). This indicates that the extracted genomic DNA has a relatively high purity and good quality and can be used for subsequent experiments.

[0027] (3) Primer design and synthesis

[0028] Primers were designed using prime 5 software and synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The primer sequences are as follows: The nucleotide sequence of the SNP marker is NSE:

[0029] CAAGGATCAAAGCATCTGGCTTTATGAGAGCCAGGTTCTGGCAGGGGTGGCTGGCGGTCTTCTCAAGAAAGCTGACATCTGCTGAGGAT[T / C]AGAAGTCTGAAAGGGAAGTACTAT AGGTGAATATGGTGTGGTACATAGAGGTGAATGGGGTCGGGTGCCATCAGGGTTTCTG GGATGTGTTCTGAGACATCTC

[0030] The above ([T / C]) in the NSE sequence is a mutant base.

[0031] NSEF1, upstream primer: 5'-CAAGGATCAAAGCATCTGGCTTTATG-3'

[0032] NSER2, downstream primer: 5'-GAGATGTCTCAGAACACATCCCAGAAA-3'

[0033] The annealing temperature is 58°C.

[0034] (4) PCR amplification reaction

[0035] The PCR amplification reaction system and reaction procedures are shown in Tables 1 and 2.

[0036] Table 1 PCR reaction system (total volume: 20ul)

[0037]

[0038] Table 2 PCR amplification reaction program

[0039]

[0040] (5) PCR amplification product detection

[0041] Agarose gel electrophoresis can be used to detect whether the marker has a specific band. The PCR amplification product was detected using 1.5% agarose gel. The results showed that the band was clear and bright, with good quality and met the requirements ( Figure 4 ).

[0042] (6) PCR product sequencing

[0043] The PCR amplification product was sent to Shanghai Biotech for first-generation sequencing. The sequencing results showed that the T site mutated into a C site (results as Figure 5 ).

[0044] (7) Correlation analysis and application

[0045] SPSS23.0 software was used to perform a significance test on the genotypes produced by the detected SNP loci: TT, TC and the number of lambs born in Duolang sheep. The results are shown in Table 3.

[0046] Table 3 Comparison of the number of lambs born by individuals with different genotypes

[0047] variety genotype Number of lambs Mean ± SD Duolangyang TT(66) <![CDATA[1.39±0.49 B ]]> TC(54) <![CDATA[1.64±0.48 A ]]>

[0048] Note: Mean±SD means mean±standard deviation. When the shoulder marks are different capital letters in the same column, the difference is extremely significant (P<0.01).

[0049] As can be seen from Table 3, this SNP locus is closely related to the number of lambs born in Duolang sheep, and the average number of lambs born in TC-type individuals is significantly higher than that in TT-type individuals. In actual production applications, the number of lambs born in Duolang sheep can be increased by selecting individuals with TC genotype, and the breeding of more lambs in Xinjiang local breed sheep can be accelerated.

[0050] The present invention determined the above-mentioned SNP molecular marker through the method of Example 1, and the specific position is Chr20:g.4505310 site T>C (base T mutates to base C), wherein the number of lambs born by individuals with genotype TC is extremely significantly higher than the number of lambs born by individuals with genotype TT; the present invention discovered that the above-mentioned SNP molecular marker can be used to screen the Duolang sheep breed with a large number of lambs.

[0051] The present invention uses the above SNP markers to identify the lambing number trait, and also develops primers that can be used to detect the above SNP markers, a forward primer (NSEF1) and a reverse primer (NSER2):

[0052] Upstream primer: 5′-CAAGGATCAAAGCATCTGGCTTTATG-3′;

[0053] Downstream primer: 5'-GAGATGTCTCAGAACACATCCCAGAAA-3'.

[0054] The SNP markers, primers and kits of the present invention can all be used to detect the trait of lamb number.

[0055] The present invention can use the above-mentioned SNP markers and primers to detect the lambing traits of Duolang sheep, screen out genotype TC individuals as multi-product varieties, and then apply them to Duolang sheep breeding.

[0056] For matters not covered in the embodiments of the present invention, those skilled in the art can select from the prior art.

[0057] The above disclosure is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the above claims.

Claims

1. A kit for detecting SNP markers in twin lambs of local mutton sheep in southern Xinjiang, characterized in that: The SNP marker originates from the intergenic region and is located downstream of the COL21A1 gene. The SNP marker is located at position 4505310 on sheep chromosome 20, the original base is T, and the variant base is C; the nucleotide sequence where the SNP marker is located is NSE.

2. The kit according to claim 1, characterized in that The number of lambs born by individuals with TC genotype at the SNP site is significantly higher than that of individuals with TT genotype; the SNP marker also includes NCOA1 gene SNP sites 32015148G>A and / or 32033237A>G.

3. A primer for detecting the SNP marker according to claim 1 or 2, characterized in that: The nucleotide sequences of the primers are NSEF1 and NSER2.

4. A kit for detecting the SNP marker according to claim 1 or 2, characterized in that: The kit comprises the primers according to claim 3.

5. Use of the SNP marker according to claim 1 or 2, the primer according to claim 3 or the kit according to claim 4 in breeding of Duolang sheep.

6. A method for detecting the lambing number trait of Duolang sheep, characterized in that: The method comprises: determining the genotype of the sheep by detecting a SNP marker in a sheep gene to be detected; wherein the SNP marker is the SNP marker according to claim 1 or 2.

7. A method for detecting the lambing number trait of Duolang sheep as claimed in claim 6, characterized in that: The method comprises the following steps: Extract genomic DNA from sheep blood samples; analyze specific SNP sites using the whole genome association analysis method after resequencing; use the DNA as an amplification template and the primers described in claim 3 as amplification primers to perform PCR amplification, send the amplified products to the company for first-generation sequencing, and obtain the typing results of this site as TT type and TC type. According to the resequencing results, the typing of this site in all individuals is determined, and the number of lambs born by sheep corresponding to different genotypes is counted, and the difference in the average number of lambs born by different genotypes is compared using the independent sample T test method to determine the extent to which this site affects the number of lambs.

8. A method for detecting the lambing number trait of Duolang sheep as claimed in claim 7, characterized in that: Among the genotypes of the SNP, the number of lambs born by individuals with the TC genotype was significantly higher than that of individuals with the TT genotype.

9. A method for detecting the lambing number trait of Duolang sheep as claimed in claim 6, characterized in that: The reaction conditions of the PCR were as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, 30 cycles, annealing temperature for 30 s, 30 cycles, extension at 72°C for 1 min, 30 cycles, extension at 72°C for 10 min, 1 cycle, and storage at 4°C. The PCR reaction system: PCR Green Mixture 2.5μl, Upstream primer 1 0.5 μl, Downstream primer 0.5 μl, DNA template 1 μl, Ultrapure water 8 μl, The nucleotide sequence of the upstream primer is NSEF1; The nucleotide sequence of the downstream primer is NSER2.

10. The method for screening SNP markers affecting the number of lambs born in Duolang sheep according to claim 1, characterized in that: Individuals with genotype TC in the SNP marker are selected to breed a Duolang sheep breed with a large number of lambs.

Images