Mining method of lagerstroemia indica leaf color related SNP molecular marker

Abstract

The invention relates to the field of agricultural molecules, in particular to a mining method of a lagerstroemia indica leaf color related SNP (Single Nucleotide Polymorphism) molecular marker. The invention clearly reveals that the P-type (purple red) and G (green leaf) SNP loci have additive effect on leaf color control, meanwhile, the five SNP markers obtained by the research can be used for breeding assisted selection, and four new crape myrtle color leaf varieties are screened according to typing results and phenotypic observation results of the five markers.

Description

Technical Field

[0001] The invention relates to the field of agricultural molecules, and in particular to a method for mining SNP molecular markers related to crape myrtle leaf color. Background Art

[0002] Crape myrtle is an excellent native ornamental tree species in my country. It has a long flowering period and bright colors, and is deeply loved by people. However, the breeding of crape myrtle in my country started relatively late, and the native crape myrtle is mainly for viewing flowers. In recent years, with the introduction of some colorful (red-leaf) crape myrtle varieties from Europe and the United States and the breeding of new varieties, crape myrtle with both leaf and flower viewing has become popular in the market.

[0003] Studies have shown that in the leaves of crape myrtle, which is mainly red leaves, anthocyanin pigments are the main pigments for coloring. The accumulated pigments are mainly anthocyanin pigments accumulated on the epidermis of the leaves. In order to reveal the coloring mechanism of crape myrtle leaf color and flower color, researchers have conducted research from multiple aspects such as metabolomics and transcriptomics. Studies on purple-leaf crape myrtle have shown that Elongated hypocotyl 5 (HY5) that regulates leaf color has three allelic variations. LfiHY5p and LfiHY5a in purple leaves work together to upregulate the synthesis of anthocyanins, but in green leaf varieties, LfiHY5g resists the effect of LfiHY5a, and the accumulation of anthocyanins is relatively low. In addition to the allelic variation of HY5 affecting its function, the expression of LiHY5 is also induced by the combination of red and blue light.

[0004] Despite transcriptome reports, the mechanisms of these leaf color changes and the genes involved remain relatively unclear, and there is a lack of relevant SNP (single nucleotide) molecular marker methods to assist in crape myrtle breeding. Summary of the invention

[0005] The purpose of the present invention is to overcome the existing defects and provide a method for mining SNP molecular markers related to crape myrtle leaf color, which can discover SNP sites that control leaf color and help assist crape myrtle breeding.

[0006] The technical solution to achieve the above object is: a method for mining SNP molecular markers related to crape myrtle leaf color, comprising the following steps:

[0007] S1 Plant material collection: collected crape myrtle varieties and hybrid plants with different flower colors;

[0008] S2 Visual observation of crape myrtle leaf color: observe and record the different characteristics of crape myrtle varieties;

[0009] S3 CIEL*a*b* colorimetric data collection: Use a colorimeter to collect CIEL*a*b* data of each crape myrtle leaf at the peak leaf stage. Randomly select 5 leaves from the same plant for CIEL*a*b* data measurement; calculate the chromaticity C value and h value. The calculation formula of C value is C=[b 2 +a 2 ] 1 / 2 , the calculation formula of h value is h = arctan [b / a];

[0010] S4 SNP mining based on differentially expressed genes: annotate the genome of the genome and transcriptome data, obtain differentially expressed genes, and remove genes with FPKM<5. Use GATK software to identify single base and insertion and deletion variations between the sequenced samples and the reference genome, obtain the intersection of variations and differential genes, obtain candidate genes, and use the software to annotate and analyze the variation sites to obtain the regions where the variation sites occur in the genome, remove rare sites, and obtain candidate SNP sites.

[0011] The steps of S5 targeted sequencing are:

[0012] S5.1 Selection of plant materials: The plant materials used were 18 crape myrtle varieties and 60 open-pollinated progeny, totaling 78 materials;

[0013] S5.2 Primer design: Use Primer3 software to design amplification primers for each SNP site;

[0014] S5.3 Preliminary screening: The designed primers were screened using e-PCR software;

[0015] S5.4 Library construction: After genomic DNA was extracted from 78 samples, primers of the sites obtained by screening were used for amplification, and sequencing adapters were added. Finally, after purification, the quality of the library was evaluated;

[0016] S5.5 qualified samples were used for paired-end 150 bp sequencing using the Illumina HiSeq platform;

[0017] S6 Candidate SNP site mining: After removing the sequencing adapters and low-quality sequences from the original data, the clean reads were aligned to the reference sequence using the software algorithm, the genotype of the sequenced material was analyzed, and the SNP-index in the offspring purple-red square leaf pool and green leaf pool was calculated. The SNP-index value of the same genotype in the purple-red leaf pool was subtracted from the SNP-index value in the green leaf pool to obtain the △SNP-index, and the SNP sites with a △SNP-index value greater than 0.2 were screened;

[0018] Verification of S7 candidate SNP sites: Genomic DNA was extracted, and the sites with △SNP-index greater than 0.2 were compared with the sequencing results, primers were redesigned, and PCR amplification was performed. After the PCR products were recovered by 1.2% agarose electrophoresis, Sanger sequencing was performed to verify the consistency of the candidate sites with the targeted sequencing results.

[0019] S8 High-resolution melting curve detection: The PCR system of HRM was configured with Tiangen HRM Analysis Kit in 20 μL system: the concentration of upstream and downstream primers was 0.1 μmol·L-1, gDNA was 40-100 ng, and the other components were carried out according to the product instructions; the PCR program was performed using Roche LC480 fluorescence quantitative PCR instrument: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 10 s, 55℃ annealing for 20 s, and 72℃ extension for 15 s; the number of cycles was 40. After the reaction, the melting curve analysis was performed using the HRM detection mode, and the fluorescence was collected once at 0.05℃, and the Threshold value was 0-5%. At least three PCR replicates were performed for each sample.

[0020] S9 data analysis: The data measured by the system were subjected to K-means cluster analysis using software to obtain plant phenotypic classification, and related icons were produced. The genotype and phenotype correlation analysis was performed, and the plant phenotype obtained by the CIEL*a*b* system analysis of each individual plant was assigned a value, with green leaves as "0", mosaic leaves as "1", and purple leaves as "2". The three genotypes measured by HRM were also assigned values, with the two homozygous genotypes as "0" and "1", and the heterozygous as "2". The software was also used to perform correlation analysis on the genotype and phenotype assignment data of 90 F1 plants.

[0021] Preferably, in step S5, the length of the amplification primer is between 17-32 bp; the Tm value is between 60-64°C; the sequencing product size does not exceed 500 bp and must cover the target site.

[0022] Preferably, rare sites are eliminated in step S4 to obtain 53 candidate SNP sites.

[0023] Preferably, in step S7, 53 candidate SNP sites are screened to obtain 5 SNP molecular marker primers.

[0024] Preferably, the five SNP molecular marker primers all include Forward Sequences hereinafter referred to as FS and Reverse Sequences hereinafter referred to as RS. The following is the composition of the primers for each site:

[0025] The FS numbered V16 is ATCTTGAAGCCCCAGTGAC,

[0026] RS numbered V16 is TGGCTTGGTGATGATGGGTG;

[0027] The FS numbered V18 is TTTTTGGTGTAAGCTCCCACT,

[0028] RS numbered V18 is CTCATGTTCGTACAGTTCAAC;

[0029] The FS numbered V34 is GCTGGCCAAGAATTGTTC,

[0030] RS numbered V34 is CGGAGGAGTAAAGTAACCAG;

[0031] The FS numbered V35 is CCCATCTTGTCACATGTGAG,

[0032] The RS numbered V35 is CCGTAAGCCGATGAAAGA;

[0033] The FS numbered V38 is ATTGACTGGCGGACAACTGAG,

[0034] The RS numbered V38 is CCATTGACAAGTAGATCCTTT.

[0035] The beneficial effects of the present invention are as follows: the amplification of each individual is analyzed, and the correlation statistics are performed using the S9 step method, and it is found that all four markers reach a significant level. According to the HRM detection results of the above 90 F1 plants, the relationship between the genotype and the phenotype of the SNP site is statistically analyzed. When the sequence type P of the 5 SNP markers is in the majority, the leaf color is purple (red), and the more P-type SNP sites, the purpler the leaf color. When the SNP sequence type is mostly G-type, the leaves show green leaves. When the number of P-type and G-type SNPs is similar, red and green mosaic leaves are shown, indicating that these sites have an additive effect on the control of leaf color. At the same time, the HRM technology is used to further analyze 45 F1 plants, and the genotype obtained by each marker detection is correlated with its leaf color. The results show that the 5 SNP markers obtained in this study can be used for breeding-assisted selection, and 4 new varieties of crape myrtle colored leaves are screened according to the typing results of the 5 markers and the phenotypic observation results. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 is a flow chart of the present invention;

[0037] Figure 2 This is a representative picture of colorful crape myrtles with different seasonal phases;

[0038] Figure 3 It is the leaf phenotype diagram of 60 progeny;

[0039] Figure 4 It is the candidate SNP screening result graph;

[0040] Figure 5 This is a diagram of the leaf phenotype and HRM molecular marker amplification results of the F1 offspring of the hybrid of Red Fireball and 10#-7. DETAILED DESCRIPTION

[0041] The technical solution of the present invention will be described clearly and completely below in conjunction with the accompanying drawings. In the description of the present invention, it should be noted that the terms "center", "up", "down", "left", "right", "vertical", "horizontal", "inside", "outside" and the like indicate directions or positional relationships based on the directions or positional relationships shown in the accompanying drawings, which are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific direction, be constructed and operated in a specific direction, and therefore cannot be understood as a limitation on the present invention. In addition, the terms "first", "second", and "third" are used for descriptive purposes only and cannot be understood as indicating or implying relative importance.

[0042] The present invention will be further described below in conjunction with the accompanying drawings.

[0043] Example 1

[0044] like Figure 1 As shown, S1 plant material collection

[0045] The crape myrtle varieties with different flower colors collected from Nantong City are numbered: 10#3, 10#5, 10#6, 10#7, 10#16,

[0046] 12#2 (mature leaves are green); six varieties of the Black Diamond series introduced by the research team: 'Best red', 'Red hot', 'Blush', 'Crimson red', 'Blush V2' and 'Pure white'; varieties such as 'National Flag Red', 'Red Fireball', 'Red Rocket', 'Velvet', and 'Red Leaf Tree' introduced from domestic scientific research institutions; the material with black and purple leaves collected from Lipu, Zhejiang, temporarily named 'Lipu No. 2'; the crape myrtle material 'NTU-1' with a breast diameter of 30 cm grown on the campus of Nantong University; F1 plants of 'Red Fireball', 'Crimson red', 'Best red', 'Blush' and local varieties (as shown in Table 1 below).

[0047] Table 1 F1 population plant information

[0048]

[0049] S2 Visual Observation of Lagerstroemia Leaf Color

[0050] According to the characteristics listed in the table of distinctiveness, uniformity and stability of the crape myrtle varieties, the four stages of leaf development were observed: young leaf stage, full leaf stage, full flowering stage and leaf fall stage.

[0051] Combination Figure 2 Specific analysis (A is red hot; B is NTU-1; C is Blush; D is Pure white, (1)-(4) represent: young leaf stage, full leaf stage, full flowering stage and leaf fall stage respectively), the leaf color observation results of 19 varieties in four stages (as shown in Table 2 below) show that the leaves of local varieties are green at all stages of development, belonging to the year-round green leaf type; 'Red hot' and 'Lipu No. 2' (black purple leaves all year round), the remaining varieties belong to the spring, spring-summer (early summer) or autumn colorful leaf type, the hybrid mother has purple-red leaves throughout the growing season, such as 'red hot', or red for a certain period of time, such as 'purewhite'. From this result, it can be seen that the leaves of the native crape myrtles in my country are mostly green throughout the season, while the introduced crape myrtles are mostly colorful for a certain period of time.

[0052] Table 2 Leaf colors of 19 varieties at four developmental stages

[0053]

[0054]

[0055] S3 CIEL*a*b* Colorimetry Data Collection

[0056] This experiment uses a CS-421 colorimeter (the colorimeter is an existing device, produced by Zhejiang Caipu Company) to collect CIEL*a*b* data of crape myrtle leaves in the full leaf stage, and randomly selects 5 leaves from the same plant for data measurement; calculates the chroma C (C = [b2 + a2]1 / 2) and the hue angle h (h = arctan[b / a]);

[0057] Combination Figure 3 Specifically, (A) shows the phenotype of some representative leaves; (BF) shows the box plot of leaf color L*, a*, b*, C, and h values. L*: indicates leaf brightness; a*: indicates the degree of green to red; b*: indicates the degree of blue to yellow; C indicates leaf chroma; h: chromaticity angle; n≥5, *p≤0.05, **p≤0.01, ***p≤0.001.

[0058] In order to further confirm whether the visual phenotypes are statistically different, we used a colorimeter to detect the CIEL*a*b* values ​​of the 60 plants numbered Z in Table 1 when they entered the peak leaf stage. The results of K-means clustering were consistent with the visual results and were divided into three categories (results not shown). According to the clustering results, the L*a*b* values ​​of different types were statistically analyzed. The results showed that no significant differences were detected in the red a* values ​​between the flower-colored leaves and the purple-red leaves (such as Figure 3 However, the leaf brightness (L*), yellowness (b*), chroma (C value) and chromaticity angle h value all showed significant differences (as shown in Figure 2C). Figure 3 As shown in Figure 2, B and DF, since L*a*b* values ​​can distinguish the color of leaves in multiple dimensions, in actual work, a colorimeter can be used to replace the traditional color card colorimetry (or visual inspection) to observe the color of leaves.

[0059] S4 SNP mining based on differentially expressed genes

[0060] The leaf transcriptome data used in this study are the transcriptome data of young leaves (purple), median (discolored, referred to as mosaic in this article) and base (green) leaves on the same branch of 'Zijing No. 1'. Referring to the genome of 'NTU-1', firstly, the differentially expressed genes of 'Zijing No. 1' were obtained and genes with FPKM<5 were eliminated; secondly, the GATK software was used to identify single base and insertion and deletion variations between the sequenced samples and the reference genome, and the intersection of variations and differential genes was obtained to form candidate sites; finally, the SnpEff (3.6c) software was used to annotate and analyze the variant sites (SNP or InDel), and rare (<10%) sites were eliminated to finally obtain candidate SNP sites;

[0061] Combination Figure 4 Specifically, 4792 and 1178 differentially expressed genes were screened in purple leaves and green leaves, and in mosaic leaves and green leaves, respectively. There were 890 differentially expressed genes shared by the two, of which 495 genes had an expression FPKM ≥ 5. They were homologously aligned with the whole genome, and 430 candidate genes were successfully matched. SNP site analysis was performed on the candidate genes, and a total of 546 SNP sites were detected, of which about 46% of the SNPs were located in the intron region of the gene, and the rest were located in the upstream, downstream, intergenic, exon, 5′ and 3′-UTR regions of the gene; based on multiple transcriptome data, rare (<10%) sites and sites in the intergenic region were removed again, and 53 candidate SNP sites were finally obtained for subsequent SNP marker development.

[0062] S5 Targeted Sequencing

[0063] The steps for targeted sequencing are:

[0064] S5.1 Selection of plant materials: The plant materials used were 18 crape myrtle varieties and 60 open-pollinated progenies (Table 1) (except NTU-1 which has been sequenced), totaling 78 materials;

[0065] S5.2 Primer design: Use Primer3 software (v2.5.0) to design amplification primers for each SNP site: the length is between 17-32 bp; the Tm value is between 60-64°C; the sequencing product size does not exceed 500 bp and must cover the target site;

[0066] S5.3 Preliminary screening: The designed primers were screened using e-PCR software (v2.3.12);

[0067] S5.4 Library construction: After genomic DNA was extracted from 78 samples, primers of the sites obtained by screening were used for amplification, and sequencing adapters were added. Finally, after purification, the quality of the library was evaluated;

[0068] S5.5 Qualified samples were used for paired-end 150 bp (PE150) sequencing using the Illumina HiSeq platform (Illumina HiSeq platform is available on the website);

[0069] The results of targeted sequencing showed that the Q20 of the 78 samples exceeded 96%, and the Q30 exceeded 90%, indicating that the data volume and data quality of the 78 samples in this experiment were in line with expectations (results not shown).

[0070] S6 Candidate SNP Site Mining

[0071] The obtained raw data were removed from the sequencing adapters and low-quality sequences, and the clean reads were aligned to the reference sequence using the MEM algorithm of the BWA software; the genotypes of the sequenced materials were analyzed, and the SNP-index in the purple (red) square leaf pool and the green leaf pool of the offspring were calculated with reference to the phenotypes of each material. The SNP-index value of the same genotype in the purple (red) leaf pool was subtracted from the SNP-index value in the green leaf pool to obtain the △SNP-index, and SNP sites with a △SNP-index value greater than 0.2 were screened. Since the differential genes are mosaic and purple-red, which are common differential genes, we divided the typing results of the step materials into two pools: the green leaf pool and the colorful leaf pool. After calculating the △SNP-index of 53 SNP sites in the purple (red) leaf and green leaf pools, SNPs with a △SNP-index threshold value exceeding 0.2 were screened, and a total of 7 sites were obtained (as shown in Table 3 below).

[0072] Table 3 Sites with △SNP-index exceeding 0.2

[0073]

[0074]

[0075] S7 Candidate SNP Site Verification

[0076] The genomic DNA of Lagerstroemia indica was extracted. The plant materials used were 10 purple (red) and 10 green plants from the 78 materials for targeted sequencing. The candidate SNP sites in S6 were compared with the sequencing results, and the primers were redesigned and PCR amplified. The PCR amplification system was as follows: 40–100 ng gDNA was added to a total volume of 50 μL, the concentration of the upstream and downstream primers was 0.05 μmol·L-1, and the remaining components were carried out according to the 2X EsTaq instructions. The PCR program was as follows: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 55-58°C annealing for 30 s, 72°C extension for 30 s, 35 cycles, and then 72°C extension for 5 min. The PCR products were recovered by 1.2% agarose electrophoresis and then subjected to Sanger sequencing (Sanger sequencing was provided by Suzhou Jinweizhi Biotechnology Co., Ltd.). The obtained sequences were analyzed for SNP sites using MegaX software.

[0077] In order to verify the accuracy of the 7 candidate SNP markers, the reference genome sequence and targeted sequencing sequence of Lagerstroemia indica were compared, and 7 pairs of primers were designed to perform PCR amplification on 10 materials in the colorful leaf pool and the green leaf pool, respectively. It was found that 4 sites could be successfully amplified in the materials in the green leaf pool and the red leaf pool (as shown in Table 4 below). After sequencing, it was shown that there were nucleic acid differences in the red leaf pool and the green leaf pool; while the V18 marker was missing in the red leaf material, but could be amplified normally in the green leaf pool. Therefore, we used these 5 molecular markers as candidate molecular markers associated with leaf color.

[0078] Table 45 SNP molecular marker primers

[0079]

[0080] S8 High resolution melting (HRM) detection

[0081] The PCR system of HRM was prepared with Tiangen Biochemical HRM Analysis Kit (EvaGreen) (FP210-01) in a 20 μL system: the concentration of upstream and downstream primers was 0.1 μmol·L-1, gDNA was 40-100 ng, and the other components were prepared according to the product instructions. The PCR program was performed using Roche fluorescent quantitative LC480 PCR. After the reaction, the melting curve analysis was performed using the high-resolution melting curve (HRM) detection mode, and the fluorescence was collected once at 0.05°C, and the Threshold value was 0-5%. At least three PCR replicates were performed for each sample.

[0082] S9 Data Analysis

[0083] The data measured by the CIELab system were subjected to K-means cluster analysis using Origin2018 software to obtain plant phenotypic classification data, and prism software was used for mapping and difference analysis. Genotype and phenotype correlation analysis, the plant phenotype obtained by the CIEL*a*b* system analysis of each individual plant was assigned a value, green leaves were "0", mosaic leaves were "1", and purple leaves were "2"; secondly, the three genotypes measured by HRM were also assigned values, the two homozygous genotypes were "0" and "1", and the heterozygous was "2", and the genotype and phenotype assignment data of 90 individual plants were subjected to Spearman correlation analysis using SPASS Statistics 25.0 software, *p<0.05, **p<0.01;

[0084] Combination Figure 5 Specific analysis, including (A) leaf phenotype. G, M and P in the figure represent green, mosaic and purple (red) respectively; (B) three-dimensional diagram of leaf color L*a*b* of 90 offspring; the green, mosaic and purple-red individuals in the figure are represented by green balls, pink balls and purple-red balls respectively. L*, a*, b* are the same Figure 2 ; (CF) are the amplification HRM melting curves of V16, V34, V35 and V38, and the genotypes represented by each color are shown in the figure; In order to verify the five candidate SNP molecular markers obtained, we used them in the F1 plants obtained by hybridizing Red Fireball and 10#-7; Red Fireball ('Dynamite') has purple-red leaves in the young and full leaf stages, and 10#-7 has green leaves throughout the growing season (Table 2); the leaf color phenotype and leaf color distribution of its progeny (such as Figure 5 Among the 90 plants tested, 24 plants showed purple leaves in the peak leaf stage, 34 plants showed flower color, and 32 plants showed green leaves. The five candidate markers were tested by HRM, and the purple-red leaves and green leaves that had been sequenced were used as controls. The results of the melting curves showed that the four markers V16, V34, V35 and V38 had clearly identifiable melting curve differences (as shown in Figure 1). Figure 5As shown in CF, overall, all four loci have homozygous and heterozygous individuals (Table 5); the amplification of each individual was analyzed, and the correlation statistics were performed using the S10 method, and it was found that all four markers reached a significant level (Table 5); the results also showed that when the sequence type of the five SNP markers was P-type, the leaf color was purple (red), and the more P-type SNP loci, the purpler the leaf color; when the SNP sequence type was mostly G-type, the leaves showed green leaves; when the number of P-type and G-type SNPs was similar, red and green mosaic leaves were shown, indicating that these loci have an additive effect on the control of leaf color.

[0085] Table 5 Correlation analysis between genotype and phenotype of 90 F1 plants

[0086]

[0087] Example 2

[0088] The SNP markers obtained in this study are derived from differentially expressed genes in the transcriptome. Since the transcriptome can only cover a small amount of information in the genome, the non-transcribed regions of the genome, especially the differences in gene expression caused by changes in the regulatory regions, cannot be detected because there are no polymorphic sites in the coding regions, so there are certain limitations.

[0089] From the annotation of gene functions at the five loci, it was not found that these genes were involved in the synthesis of chlorophyll, carotenoids or anthocyanins (results not shown), but it was found that in the region closely linked to these loci, according to the currently known annotation results of the crape myrtle genome, there were transcription factors with zinc finger C3H domains, genes related to light signals, E3 ubiquitin ligase genes and caffeine synthase, etc. The purple (red) color of crape myrtle mined in the transcriptome of this study gradually faded during development, which may be related to light signals.

[0090] In fact, the expression of HY5 mentioned above is regulated by light. The C3H zinc finger protein in plants has been reported to be involved in lignin synthesis. Substances such as lignin and caffeic acid belong to the same metabolic pathway of phenylpropanoids as anthocyanins. Therefore, the genes at the SNP molecular marker sites obtained in this study may indirectly regulate the accumulation of anthocyanins in mesophyll cells by regulating metabolic flow. From the results of this study, it can be seen in Table 5 that the correlation between the four molecular markers and the phenotype is between 0.184≤r≤0.684, which also shows that there is still separation between the markers and the genes. Therefore, subsequent studies need to detect variations in different materials near these markers, develop molecular markers that are closely linked to traits, and improve their detection efficiency in the process of molecular marker-assisted breeding.

[0091] In addition to cultivating purple (red) leaves, the breeding of crape myrtle leaf color can also focus on chlorophyll synthesis. In addition to hybridization, subsequent breeding can also start from chemical and radiation mutagenesis to cultivate more crape myrtles with different leaf colors.

[0092] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that the technical solutions described in the above embodiments may still be modified, or some or all of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for mining SNP molecular markers related to crape myrtle leaf color, comprising the following steps: S1 Plant material collection: collected crape myrtle varieties and hybrid plants with different flower colors; S2 Visual observation of crape myrtle leaf color: observe and record the different characteristics of crape myrtle varieties; S3 CIEL*a*b* colorimetric data collection: Use a colorimeter to collect CIEL*a*b* data of each crape myrtle leaf at the peak leaf stage. Randomly select 5 leaves from the same plant for CIEL*a*b* data measurement; calculate the chromaticity C value and h value. The calculation formula of C value is C=[b 2 +a 2 ] 1 / 2 , the calculation formula of h value is h = arctan [b / a]; S4 SNP mining based on differentially expressed genes: annotate the genome of the genome and transcriptome data, obtain differentially expressed genes, and remove genes with FPKM<5. Use GATK software to identify single base and insertion and deletion variations between the sequenced samples and the reference genome, obtain the intersection of variations and differential genes, obtain candidate genes, and use the software to annotate and analyze the variation sites to obtain the regions where the variation sites occur in the genome, remove rare sites, and obtain candidate SNP sites. The steps of S5 targeted sequencing are: S5.1 Selection of plant materials: The plant materials used were 18 crape myrtle varieties and 60 open-pollinated progeny, totaling 78 materials; S5.2 Primer design: Use Primer3 software to design amplification primers for each SNP site; S5.3 Preliminary screening: The designed primers were screened using e-PCR software; S5.4 Library construction: After genomic DNA was extracted from 78 samples, primers of the sites obtained by screening were used for amplification, and sequencing adapters were added. Finally, after purification, the quality of the library was evaluated; Samples that passed S5.5 were used for paired-end 150 bp sequencing using the Illumina HiSeq platform; S6 Candidate SNP site mining: After removing the sequencing adapters and low-quality sequences from the original data, the clean reads were aligned to the reference sequence using the software algorithm, the genotype of the sequenced material was analyzed, and the SNP-index in the offspring purple-red square leaf pool and green leaf pool was calculated. The SNP-index value of the same genotype in the purple-red leaf pool was subtracted from the SNP-index value in the green leaf pool to obtain the △SNP-index, and the SNP sites with a △SNP-index value greater than 0.2 were screened; Verification of S7 candidate SNP sites: Genomic DNA was extracted, and the sites with △SNP-index greater than 0.2 were compared with the sequencing results, primers were redesigned, and PCR amplification was performed. The PCR products were recovered by 1.2% agarose electrophoresis and then Sanger sequencing was performed to verify the consistency of the candidate sites with the targeted sequencing results. S8 High-resolution melting curve detection: The PCR system of HRM was configured with Tiangen HRM Analysis Kit in 20 μL system: the concentration of upstream and downstream primers was 0.1 μmol·L-1, gDNA was 40-100 ng, and the other components were carried out according to the product instructions; the PCR program was performed using Roche LC480 fluorescence quantitative PCR instrument: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 10 s, 55℃ annealing for 20 s, and 72℃ extension for 15 s; the number of cycles was 40. After the reaction, the melting curve analysis was performed using the HRM detection mode, and the fluorescence was collected once at 0.05℃, and the Threshold value was 0-5%. At least three PCR replicates were performed for each sample. S9 data analysis: The data measured by the system were subjected to K-means cluster analysis using software to obtain plant phenotypic classification, and related icons were produced. The genotype and phenotype correlation analysis was performed, and the plant phenotype obtained by the CIEL*a*b* system analysis of each individual plant was assigned a value, with green leaves as "0", mosaic leaves as "1", and purple leaves as "2". The three genotypes measured by HRM were also assigned values, with the two homozygous genotypes as "0" and "1", and the heterozygous as "2". The software was also used to perform correlation analysis on the genotype and phenotype assignment data of 90 F1 plants.

2. The method for mining SNP molecular markers related to Lagerstroemia indica leaf color according to claim 1, characterized in that: In step S5, the length of the amplification primers is between 17-32 bp; the Tm value is between 60-64°C; the size of the sequencing product does not exceed 500 bp and must cover the target site.

3. The method for mining SNP molecular markers related to Lagerstroemia indica leaf color according to claim 1, characterized in that: In step S4, rare sites are eliminated to obtain 53 candidate SNP sites.

4. The method for mining SNP molecular markers related to Lagerstroemia indica leaf color according to claim 3, characterized in that: In step S7, 53 candidate SNP sites are screened to obtain 5 SNP molecular marker primers.

5. The tile cutting device according to claim 4, characterized in that: The five SNP molecular marker primers all include Forward Sequences (hereinafter referred to as FS) and Reverse Sequences (hereinafter referred to as RS). The following is the composition of the primers for each site: The FS numbered V16 is ATCTTGAAGCCCCAGTGAC, RS numbered V16 is TGGCTTGGTGATGATGGGTG; The FS numbered V18 is TTTTTGGTGTAAGCTCCCACT, RS numbered V18 is CTCATGTTCGTACAGTTCAAC; The FS numbered V34 is GCTGGCCAAGAATTGTTC, RS numbered V34 is CGGAGGAGTAAAGTAACCAG; The FS numbered V35 is CCCATCTTGTCACATGTGAG, The RS numbered V35 is CCGTAAGCCGATGAAAGA; The FS numbered V38 is ATTGACTGGCGGACAACTGAG, The RS numbered V38 is CCATTGACAAGTAGATCCTTT.

Images