A KASP molecular marker related to the grain length of japonica rice and its application

By developing KASP molecular markers in rice and using specific primer sets to perform competitive allelic-specific PCR, the problem of difficulty in identifying the grain length of japonica rice in the prior art is solved, rapid and accurate genotype identification is achieved, and breeding efficiency is improved.

CN119162372BActive Publication Date: 2025-07-01GUIZHOU RICE RES INST +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411567532.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-05
Publication Date
2025-07-01
Estimated Expiration
2044-11-05

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently identify and utilize multigene-regulated rice grain long genes, resulting in inefficient breeding of new varieties of long-grain japonica rice.

Method used

A KASP molecular marker was developed at 22840530 bp in chromosome 6. Competitive allelic-specific PCR was performed through a specific primer set to detect the long-grain genotype A/A of japonica rice grains to identify long-grain dominance.

Benefits of technology

The rapid and accurate identification of the genotype of japonica rice grains has been achieved, and the breeding efficiency of new varieties of long-grain japonica rice has been improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119162372B_ABST
    Figure CN119162372B_ABST
Patent Text Reader

Abstract

The present invention discloses a KASP molecular marker related to the grain length of japonica rice and its application, belonging to the technical field of rice genetic engineering. There is a total of 1 KASP molecular marker, namely KASP_22840530, and its polymorphism is G or A. The developed molecular marker can quickly and accurately detect the long-grain genotype of japonica rice GL6.1. The grain length of the genotype A / A is significantly greater than that of the genotype G / G. Therefore, this KASP molecular marker is suitable for the molecular breeding of new long-grain japonica rice varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of rice genetic engineering, and particularly relates to a KASP molecular marker related to the grain length of japonica rice and its application. Background Art

[0002] Indica rice and japonica rice are two subspecies of Asian cultivated rice, and there are significant differences in their appearance quality and eating quality. Generally, in terms of appearance, the grain length and length-width ratio of indica rice are larger than those of japonica rice, while in terms of quality, the cooking and eating quality of japonica rice is better than that of indica rice. With the improvement of people's living standards, the market demand for high-quality rice is increasing continuously. Coupled with the influence of international brand rice, long-grain high-quality rice such as Thai fragrant rice, Basmati, KDML105, etc. is more popular among people. Therefore, cultivating long-grain japonica rice has become a trend in the breeding of new japonica rice varieties.

[0003] Great progress has been made in the genetics and regulation mechanism of rice grain shape. Research shows that grain length, grain width, and grain length-width ratio are co-regulated by multiple genes, and the inheritance has an additive effect. At present, the cloned rice grain length genes or QTLs include OsLG3, GS3, PGL1, PGL2, AGP, qSW5, GL6, GL7, GLW7, GS2, TGW6, etc. GS3 is a major QTL regulating grain length. Among them, the OSR domain can negatively regulate grain length, and TNFR / NGFR can positively regulate grain length. The loss of GS3 function leads to a long-grain phenotype, while overexpression leads to a short-grain phenotype. PGL1, PGL2, OsLG3, GL6, and GL7 are positive regulators of grain length, which increase the grain length of rice by increasing the number of cells in the glume, promoting the proliferation of seed cells, and increasing the division of longitudinal cells in the grain. Currently, the cloned genes that significantly affect grain width include GW2, TGW2, GW5 / GSE5, GS5, GW8, GS6, etc. GW2 encodes an E3 ubiquitin ligase in the cytoplasm and can negatively regulate grain width. TGW2 encodes a cell number regulator OsCNR1 and can negatively regulate the grain width of rice. GW5 regulates grain width by mediating the brassinolide (BR) signal transduction. GSE5 encodes a calmodulin-binding protein, and the deletion of the promoter region is the genetic basis for the variation of grain width in rice varieties. GS5 encodes a serine carboxypeptidase and can positively regulate the grain width of rice. GW8 increases the grain width by inhibiting the expression of GW7.

[0004] Molecular marker-assisted selection is an important means to improve breeding efficiency. Therefore, the development and application of molecular markers for long-grain functional genes play an important role in the breeding of new long-grain japonica rice varieties. Summary of the Invention

[0005] The present invention provides a KASP molecular marker related to the grain length of japonica rice. The physical position of the KASP molecular marker is determined based on the MSU7.0 version of the whole genome sequence of Nipponbare. The KASP molecular marker is located at 22,840,530 bp on chromosome 6, and the polymorphism is A and G.

[0006] The present invention also provides the application of a reagent for detecting the above KASP molecular marker in identifying the grain length of japonica rice.

[0007] The present invention also provides the application of a primer set for detecting the above KASP molecular marker in identifying the grain length of japonica rice. The primer set includes 2 specific primers and 1 common primer. The nucleotide sequences of the 2 specific primers are shown in SEQ ID NO.1-2 respectively, and the nucleotide sequence of 1 common primer is shown in SEQ ID NO.3. Specifically as follows: Primer_AlleleFAM: GAAGGTGACCAAGTTCATGCTGTTCACAACTAGGTACGGGAG (SEQ ID NO.1);

[0008] Primer_AlleleHEX: GAAGGTCGGAGTCAACGGATTGTTCACAACTAGGTACGGGAA (SEQ ID NO.2);

[0009] Primer_Common: CGTCGAAGAAACAAGTACGAGAAGGC (SEQ ID NO.3).

[0010] Furthermore, the 2 specific primers are respectively labeled with different fluorescent labels.

[0011] The present invention also provides a method for identifying the grain length of japonica rice. The method includes the following steps:

[0012] Using the genomic DNA of the rice sample to be tested as a template, performing competitive allele-specific PCR with the primer set SEQ ID NO.1-3, and then determining the genotype corresponding to the above KASP molecular marker. The grain length of japonica rice with the genotype A / A is greater than that of G / G.

[0013] Furthermore, it also includes the step of extracting the genomic DNA of the rice sample to be tested.

[0014] The present invention also provides the application of the above method in the breeding of japonica rice grain length.

[0015] The present invention also provides the application of a product in identifying the grain length of japonica rice. The product includes a primer set with nucleotide sequences shown in SEQ ID NO.1-3.

[0016] Furthermore, the product is a kit.

[0017] The present invention also provides an application of a gene chip in identifying the grain length of japonica rice, and the gene chip comprises a primer group with nucleotide sequences shown in SEQ ID NO.1-3.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention provides the long grain genotype of the KASP_22840530 KASP molecular marker. The KASP_22840530 genotype A / A is the long grain dominant genotype and can be used in the molecular breeding of new long grain japonica rice varieties. Description of the Drawings

[0020] Figure 1 It is the genotyping map of the KASP_22840530 molecular marker in Example 1.

[0021] Figure 2 It is the statistical analysis result of the grain lengths of 132 japonica rice with different genotypes in two years in Example 1.

[0022] Figure 3 It is the verification result of the KASP_22840530 dominant genotype in the Rice SNP-Seek Database (snp-seek.irri.org / index.zul) in Example 1.

[0023] Figure 4 It is the verification result of the KASP_22840530 dominant genotype in the RiceVarMap v2.0 database (RiceVarMap2(ncpgr.cn)) in Example 1. Detailed Embodiments

[0024] Example 1

[0025] 1. Extract DNA

[0026] Take 132 rice leaves as test samples and store them in a -80°C ultra-low temperature freezer. (2) Transfer the frozen samples to 2-ml centrifuge tubes, add small steel beads, freeze them in liquid nitrogen, and then grind the leaves into powder using a tissue grinder. (3) Add CTAB extraction buffer, incubate in a water bath at 65°C for 2 hours, and then centrifuge at 12,000×g at 4°C for 10 minutes; (4) Take the supernatant and add an equal volume of chloroform, mix well, and centrifuge at 12,000×g at 4°C for 10 minutes; (5) Take the supernatant and transfer it to a new centrifuge tube, add 2 volumes of absolute ethanol, mix well, place at -20°C for 30 min, centrifuge at 12,000×g at 4°C for 10 minutes, and discard the supernatant; (6) Add 1 ml of pre-cooled 70% ethanol, centrifuge at 12,000×g at 4°C for 10 minutes, and discard the supernatant (this step is repeated 2 times); (6) Air-dry at room temperature until the precipitate is colorless and transparent, add sterile ddH2O to dissolve the DNA precipitate, and store at -20°C for later use.

[0027] 2. DNA Dilution

[0028] Use a BioDrop uLite nucleic acid microassay instrument to measure the DNA concentration and quality of the samples to be tested, and uniformly dilute all samples to be tested to an appropriate concentration for machine loading (about 5-10 ng / μl) according to the test results.

[0029] 3. Primer Design

[0030] GL6.1 (LOC_Os06g38550) is located in the interval of 22836854–22839540 on chromosome 6. Then, mine the KASP loci in the intervals 150 kb upstream and downstream of this interval, and use the online primer design website BatchPrimer3.

[0031] 4. KASP (Kompetitive Allele-Specific PCR) Genotyping Detection

[0032] Configure the reaction system as follows:

[0033] Table 1

[0034] Volume (μl) DNA template 0.8 2x KASP Mastermix + Assay 0.8 Total volume 1.6

[0035] Use the SNP gene detection platform of IntelliQube to compile a program, and sequentially place the 384Array tape, DNA sample plate, and KASP genotyping mixture into the machine. Operate the machine to execute the program, and automatically perform the processes of dispensing the DNA sample diluent and the KASP genotyping mixture into the 384-well array tape and sealing the film respectively. The PCR reaction is carried out by water bath PCR, and the specific program is as follows:

[0036] Table 2

[0037]

[0038]

[0039] Finally, pre-denaturation was performed at 94°C for 15 min; for the first-step amplification reaction, denaturation was carried out at 94°C for 20 s, annealing and extension were performed at 61°C - 55°C for 60 s, for 10 cycles, and the temperature of annealing and extension decreased by 0.6°C for each cycle; for the second-step amplification reaction, denaturation was carried out at 94°C for 20 s, annealing and extension were performed at 57°C for 60 s, for 3 cycles.

[0040] 5. Verification of KASP molecular markers

[0041] The grain lengths of 132 japonica rice varieties were measured with 2-year replicates. The results showed that the grain length of the KASP_22840530 genotype A / A was extremely significantly higher than that of the genotype G / G. In addition, after screening, statistical analysis was performed on the grain lengths of the KASP_22840530 markers of 104 japonica rice varieties (Table 4) in the Rice SNP-Seek Database and 138 japonica rice varieties (Table 5) in the RiceVarMap v2.0 database, and the results verified that the grain length of the genotype A / A was extremely significantly higher than that of the genotype G / G.

[0042] Table 3

[0043]

[0044]

[0045]

[0046]

[0047] Table 4

[0048]

[0049]

[0050]

[0051] Table 5

[0052]

[0053]

[0054]

[0055]

[0056] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of a reagent for detecting KASP molecular markers in identifying grain length of japonica rice, characterized in that: The grain length of japonica rice with the KASP molecular marker genotype of A / A is greater than that of G / G; the physical position of the KASP molecular marker is determined based on the MSU7.0 version of the whole genome sequence of Nipponbare, and the KASP molecular marker is located at 22840530bp on chromosome 6, and the polymorphism is A and G.

2. Application of a primer set for detecting KASP molecular markers in identifying grain length of japonica rice, characterized in that: The primer set comprises two specific primers and one universal primer, wherein the nucleotide sequences of the two specific primers are respectively shown as SEQ ID NO.1-2, and the nucleotide sequence of the universal primer is shown as SEQ ID NO.3; the grain length of japonica rice with the KASP molecular marker genotype of A / A is greater than that of G / G; the physical position of the KASP molecular marker is determined based on the MSU7.0 version of the whole genome sequence of Nipponbare, and the KASP molecular marker is located at 22840530bp on chromosome 6, and the polymorphism is A and G.

3. The use according to claim 2, characterized in that: The two specific primers are respectively labeled with different fluorescent markers.

4. A method for identifying the length of japonica rice grains, characterized in that: The method comprises the following steps: The genomic DNA of the japonica rice sample to be tested was used as a template, and competitive allele-specific PCR was performed using the primer set SEQ ID NO.1-3 to determine the genotype corresponding to the KASP molecular marker, and the grain length of the japonica rice with the genotype of A / A was greater than that of G / G; the physical position of the KASP molecular marker was determined based on the MSU7.0 version of the whole genome sequence of Nipponbare, and the KASP molecular marker was located at 22840530 bp on chromosome 6, and the polymorphism was A and G.

5. The method according to claim 4, characterized in that The method also includes a step of extracting genomic DNA of the rice sample to be tested.

6. Use of the method according to claim 4 or 5 in the breeding of japonica rice grain length.

7. Application of a product in identifying the length of japonica rice grains, characterized in that: The product includes a primer set with nucleotide sequences as shown in SEQ ID NO.1-3, and competitive allele-specific PCR is performed using the primer set SEQ ID NO.1-3 to determine the genotype corresponding to the KASP molecular marker, wherein the grain length of japonica rice with the genotype of A / A is greater than that of G / G; the physical position of the KASP molecular marker is determined based on the MSU7.0 version of the whole genome sequence of Nipponbare, and the KASP molecular marker is located at 22840530 bp on chromosome 6, and the polymorphism is A and G.

8. The use according to claim 7, characterized in that: The product is a test kit.

9. An application of a gene chip in identifying japonica rice grain length, characterized in that: The gene chip includes a primer set with nucleotide sequences as shown in SEQ ID NO.1-3, and competitive allele-specific PCR is performed using the primer set SEQ ID NO.1-3 to determine the genotype corresponding to the KASP molecular marker, and the japonica rice grain length of the genotype is A / A is greater than G / G; the physical position of the KASP molecular marker is determined based on the MSU7.0 version of the whole genome sequence of Nipponbare, and the KASP molecular marker is located at 22840530bp on chromosome 6, and the polymorphism is A and G.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker primer combination of rice grain length gene GL6.1 and application of SNP molecular marker primer combination

    CN118048473A

  • KASP molecular marker primer for identifying rice grain length and application of KASP molecular marker primer

    CN118600072A