Double chain cleat adapter and method of use

Abstract

The present disclosure provides compositions comprising nucleic acid double stranded splint adapters, including kits, as well as methods of employing the double stranded splint adapters. The double-stranded splint adaptor (200) can be used in a one-pot multienzyme reaction to introduce one or more new adaptor sequences into a library molecule. The double-stranded splint adaptor (200) comprises a first splint chain (long splint chain (300)) and a second splint chain (short splint chain (400)), where the first splint chain and the second splint chain hybridize together to form the double-stranded splint adaptor (200) having a double-stranded region and two flanked single-stranded regions. The second splint chain (400) carries a new adapter sequence to be introduced, such as, for example, a universal binding sequence and / or an index sequence.

Description

[0001] Related applications

[0002] This application claims priority to and benefits from U.S. Provisional Patent Application No. 63 / 316,784, filed March 4, 2022, and U.S. Patent Application No. 17 / 725,065, filed April 20, 2022, the contents of each of which are incorporated herein by reference in their entirety.

[0003] By referencing and incorporating into the sequence list

[0004] The contents of the electronic sequence list (ELEM-003_001WO_SequenceListing_ST26.xml; size: 65,027 bytes; and creation date: March 3, 2023) are incorporated herein by reference in their entirety. Technical Field

[0005] This disclosure provides compositions comprising a double-stranded nucleic acid clip-on adapter and methods for using the double-stranded clip-on adapter. The double-stranded clip-on adapter can partially hybridize with a library molecule to form a nicked library-scraper complex, wherein the nick can be joined to form a covalently closed circular molecule that can be used in downstream amplification and sequencing workflows. Background Art

[0006] This disclosure relates to the preparation and sequencing of polynucleotides from covalently closed circular molecular libraries. Advances in next-generation sequencing (NGS) technology have significantly increased sequencing speed and data output, leading to high sample throughput on current sequencing platforms. Efficient preparation of closed circular libraries with target sequences is crucial for downstream amplification and sequencing workflows. Another aspect of increasing sequencing throughput is the addition of unique index sequences to DNA fragments during library preparation, which allows for the aggregation of large libraries and simultaneous sequencing during each sequencing run. Therefore, there is a need for alternative methods for generating and sequencing circular libraries containing both target and unique index sequences, compatible with downstream NGS technologies. This document provides compositions, methods, and kits that meet this need. Summary of the Invention

[0007] This disclosure provides a library-sandwich complex (500) comprising: (i) a single-stranded nucleic acid library molecule (100) including a target sequence (110) having at least a first left universal adaptor sequence (120) on one side and at least a first right universal adaptor sequence (130) on the other side; and (ii) a double-stranded sandwich adaptor (200) including a first sandwich chain (long sandwich chain (300)) and a second sandwich chain (short sandwich chain (400)), wherein the double-stranded sandwich adaptor (200) includes a double... The library contains a first splint chain region and two side-attached single-stranded regions, wherein the first splint chain comprises a first region (320), an inner region (310), and a second region (330); wherein the inner region (310) of the first splint chain hybridizes with the second splint chain (400); wherein the first region (320) of the first splint chain hybridizes with at least a first left universal connective sequence (120) of the library molecule; and wherein the second region (330) of the first splint chain hybridizes with at least a first right universal sequence (130) of the library molecule, thereby circulating the library molecule to produce a library-sponge complex (500).

[0008] In some embodiments, the nucleic acid library molecule (100) further comprises: a second left universal adaptor sequence (140). In some embodiments, the nucleic acid library molecule (100) further comprises: a second right universal adaptor sequence (150). In some embodiments, the nucleic acid library molecule (100) further comprises: a first left index sequence (160). In some embodiments, the nucleic acid library molecule (100) further comprises: a first right index sequence (170). In some embodiments, the nucleic acid library molecule (100) further comprises: a first left unique identifier sequence (180). In some embodiments, the nucleic acid library molecule (100) further comprises: a first right unique identifier sequence (190).

[0009] In some embodiments, the nucleic acid library molecule (100) further comprises any one or any combination of two or more of the following: (i) a second left universal adaptor sequence (140); (ii) a second right universal adaptor sequence (150); (iii) a first left index sequence (160); (iv) a first right index sequence (170); (v) a first left unique identifier sequence (180); and / or (vi) a first right unique identifier sequence (190).

[0010] In some embodiments, the first left universal adaptor sequence (120) and / or the second left universal adaptor sequence (140) comprises: (i) a universal binding sequence for forward sequencing primers; (ii) a universal binding sequence for reverse sequencing primers; (iii) a universal binding sequence for a first surface primer; (iv) a universal binding sequence for a second surface primer; (v) a universal binding sequence for forward amplification primers; (vi) a universal binding sequence for reverse amplification primers; and / or (vii) a universal binding sequence for compacted oligonucleotides.

[0011] In some embodiments, the first right universal adaptor sequence (130) and / or the second right universal adaptor sequence (150) comprises: (i) a universal binding sequence for forward sequencing primers; (ii) a universal binding sequence for reverse sequencing primers; (iii) a universal binding sequence for a first surface primer; (iv) a universal binding sequence for a second surface primer; (v) a universal binding sequence for forward amplification primers; (vi) a universal binding sequence for reverse amplification primers; and / or (vii) a universal binding sequence for compacted oligonucleotides.

[0012] In some embodiments, the second splint chain (400) includes at least two subregions: a first subregion containing a universal binding sequence for a third surface primer; and a second subregion containing a universal binding sequence for a fourth surface primer, wherein the first and second subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization).

[0013] In some embodiments, the second splint chain (400) further includes an optional third subregion containing a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases.

[0014] In some embodiments, the first splint chain (300) includes an inner region (310) comprising at least two subregions: a fourth subregion containing a universal binding sequence for a third surface primer and hybridizing with a first subregion of the second splint chain (400); and a fifth subregion containing a universal binding sequence for a fourth surface primer and hybridizing with a second subregion of the second splint chain (400); wherein the fourth and fifth subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the first splint chain (300) includes an inner region (310) further comprising a sixth subregion containing a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases, wherein the sixth subregion hybridizes with a third subregion of the second splint chain (400).

[0015] This disclosure provides a library-sandwich complex (500) comprising: a) a single-stranded nucleic acid library molecule (100) comprising components arranged in a 5' to 3' order: (i) a first left universal adaptor sequence (120) having a binding sequence (120) for a first surface primer; (ii) a second left universal adaptor sequence (140) having a binding sequence for a first sequencing primer; (iii) a target sequence (110); (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer; and (v) a first right universal adaptor sequence (130) having a binding sequence (130) for a second surface primer; b) a first sandwich chain (300) comprising components arranged in a 5' to 3' order: a first region (320); an inner region (310); and a second region (330); and c) a second sandwich chain (400) comprising components arranged in a 3' to 5' order. Region: A first subregion having a universal binding sequence for a third surface primer; and a second subregion having a universal binding sequence for a fourth surface primer; wherein the first splint chain (300) partially hybridizes with the library molecule (100), thereby circulating the library molecule to produce a library-splice complex (500), such that the first region (320) of the first splint chain hybridizes with the binding sequence (120) for the first surface primer, and the third region (330) of the first splint chain hybridizes with the binding sequence (130) for the second surface primer, wherein the second splint chain (400) hybridizes with the inner region (310) of the first splint chain (300), wherein the library-splice complex (500) contains a first gap between the 5' end of the library molecule and the 3' end of the second splint chain, wherein the library-splice complex (500) contains a second gap between the 5' end of the second splint chain and the 3' end of the library molecule, and wherein the first and second gaps are enzymatically ligated.

[0016] In some embodiments, the library-splice complex (500) further comprises a plurality of library-splice complexes (500), wherein the target sequence (110) of each of the plurality of library-splice complexes contains the same target sequence or different target sequences.

[0017] This disclosure provides a reaction mixture comprising multiple library-splice complexes (500) including the present disclosure and T4 polynucleotide kinase. This disclosure also provides a reaction mixture comprising multiple library-splice complexes (500) including the present disclosure and a ligase. In some embodiments, the ligase comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0018] This disclosure provides a covalently closed circular library molecule (600) comprising: a target sequence (110), at least a first left universal adaptor sequence (120), at least a first right universal adaptor sequence (130), and a second splint chain sequence (400).

[0019] In some embodiments, the covalently closed circular library molecule (600) of this disclosure further includes: a second left universal connective sequence (140). In some embodiments, the covalently closed circular library molecule (600) of this disclosure further includes: a second right universal connective sequence (150). In some embodiments, the covalently closed circular library molecule (600) of this disclosure further includes: a first left index sequence (160). In some embodiments, the covalently closed circular library molecule (600) of this disclosure further includes: a first right index sequence (170). In some embodiments, the covalently closed circular library molecule (600) of this disclosure further includes: a first left unique identifier sequence (180). In some embodiments, the covalently closed circular library molecule (600) of this disclosure further includes: a first right unique identifier sequence (190).

[0020] In some embodiments, the covalently closed circular library molecule (600) of this disclosure further comprises any one or any combination of two or more of the following: (i) a second left universal connector sequence (140); (ii) a second right universal connector sequence (150); (iii) a first left index sequence (160); (iv) a first right index sequence (170); (v) a first left unique identifier sequence (180); and / or (vi) a first right unique identifier sequence (190).

[0021] In some embodiments, the first left universal adaptor sequence (120) and / or the second left universal adaptor sequence (140) comprises: (i) a universal binding sequence for forward sequencing primers; (ii) a universal binding sequence for reverse sequencing primers; (iii) a universal binding sequence for a first surface primer; (iv) a universal binding sequence for a second surface primer; (v) a universal binding sequence for forward amplification primers; (vi) a universal binding sequence for reverse amplification primers; and / or (vii) a universal binding sequence for compacted oligonucleotides.

[0022] In some embodiments, the first right universal adaptor sequence (130) and / or the second right universal adaptor sequence (150) comprises: (i) a universal binding sequence for forward sequencing primers; (ii) a universal binding sequence for reverse sequencing primers; (iii) a universal binding sequence for a first surface primer; (iv) a universal binding sequence for a second surface primer; (v) a universal binding sequence for forward amplification primers; (vi) a universal binding sequence for reverse amplification primers; and / or (vii) a universal binding sequence for compacted oligonucleotides.

[0023] In some embodiments, the closed-loop library molecule (600) of this disclosure hybridizes with a first splint chain (long splint chain (300)), the first splint chain comprising a first region (320), an inner region (310) and a second region (330), wherein the second splint chain sequence (400) of the covalently closed-loop library molecule hybridizes with the inner region (310) of the first splint chain, wherein the first region (320) of the first splint chain hybridizes with at least a first left universal connective sequence (120) of the library molecule, and wherein the second region (330) of the first splint chain hybridizes with at least a first right universal sequence (130) of the library molecule.

[0024] In some embodiments, the second splint chain (400) includes at least two subregions: a first subregion containing a universal binding sequence for a third surface primer; and a second subregion containing a universal binding sequence for a fourth surface primer, wherein the first and second subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization).

[0025] In some embodiments, the second splint chain (400) further includes an optional third subregion containing a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases.

[0026] In some embodiments, the first splint chain (300) includes an inner region (310) comprising at least two subregions: a fourth subregion containing a universal binding sequence for a third surface primer and hybridizing with a first subregion of the second splint chain (400); and a fifth subregion containing a universal binding sequence for a fourth surface primer and hybridizing with a second subregion of the second splint chain (400); wherein the fourth and fifth subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the first splint chain (300) includes an inner region (310) further comprising a sixth subregion containing a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases, wherein the sixth subregion hybridizes with a third subregion of the second splint chain (400).

[0027] This disclosure provides a single-stranded covalently closed circular molecule (600) comprising: (i) a first left universal adaptor sequence (120) having a binding sequence (120) for a first surface primer; (ii) a second left universal adaptor sequence (140) having a binding sequence for a first sequencing primer; (iii) a target sequence (110); (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer; (v) a first right universal adaptor sequence (130) having a binding sequence (130) for a second surface primer; and (vi) a second splint strand (400), wherein the covalently closed circular molecule (600) optionally hybridizes with the first splint strand (300).

[0028] In some embodiments, the covalently closed circular library molecule (600) further comprises a plurality of covalently closed circular library molecules (600), wherein the target sequence (110) of each of the plurality of covalently closed circular library molecules (600) contains the same target sequence or different target sequences.

[0029] This disclosure provides a reaction mixture comprising a plurality of covalently closed circular library molecules (600) comprising this disclosure, wherein each covalently closed circular library molecule (600) hybridizes with a first splint chain (300). In some embodiments, the plurality of covalently closed circular library molecules (600) and at least one exonuclease. In some embodiments, the exonuclease comprises exonuclease I, thermostable exonuclease I, or T7 exonuclease.

[0030] This disclosure provides a kit comprising: a double-stranded splint connector (200) including (i) a first splint chain (long splint chain (300)) and (ii) a second splint chain (short splint chain (400)), wherein the first splint chain (300) can hybridize with the second splint chain (400) to form a double-stranded region and two side-connected single-stranded regions, wherein the first splint chain (300) includes a first region (320), an inner region (310) and a second region (330), and wherein the inner region (310) of the first splint chain can hybridize with the second splint chain (400). In some embodiments, the first splint chain (300) and the second splint chain (400) hybridize with each other to form a double-stranded splint connector (200) having a double-stranded region and two side-connected single-stranded regions, and wherein the inner region (310) of the first splint chain can hybridize with the second splint chain (400).

[0031] In some embodiments, the kit of this disclosure is used to circularize a single-stranded nucleic acid library molecule (100) having a target sequence (110) with at least a first left universal adaptor sequence (120) on one side and at least a first right universal adaptor sequence (130) on the other side. In some embodiments, a first region (320) of a first splint strand may hybridize with at least the first left universal adaptor sequence (120) of the library molecule (100), and a second region (330) of the first splint strand may hybridize with at least the first right universal adaptor sequence (130) of the library molecule. In some embodiments, at least a first left universal adaptor sequence (120) of the library molecule (100) comprises: (i) a universal binding sequence for forward sequencing primers; (ii) a universal binding sequence for reverse sequencing primers; (iii) a universal binding sequence for a first surface primer; (iv) a universal binding sequence for a second surface primer; (v) a universal binding sequence for forward amplification primers; (vi) a universal binding sequence for reverse amplification primers; and / or (vii) a universal binding sequence for compacted oligonucleotides.

[0032] In some embodiments, at least a first right universal adaptor sequence (130) of the library molecule (100) comprises: (i) a universal binding sequence for forward sequencing primers; (ii) a universal binding sequence for reverse sequencing primers; (iii) a universal binding sequence for a first surface primer; (iv) a universal binding sequence for a second surface primer; (v) a universal binding sequence for forward amplification primers; (vi) a universal binding sequence for reverse amplification primers; and / or (vii) a universal binding sequence for compacted oligonucleotides.

[0033] In some embodiments, the second splint chain (400) includes at least two subregions: a first subregion containing a universal binding sequence for a third surface primer; and a second subregion containing a universal binding sequence for a fourth surface primer, wherein the first and second subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the second splint chain (400) further includes an optional third subregion containing a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases.

[0034] In some embodiments, the first splint chain (300) includes an inner region (310) comprising at least two subregions: a fourth subregion containing a universal binding sequence for a third surface primer and hybridizing with a first subregion of the second splint chain (400); and a fifth subregion containing a universal binding sequence for a fourth surface primer and hybridizing with a second subregion of the second splint chain (400); wherein the fourth and fifth subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the first splint chain (300) includes an inner region (310) further comprising a sixth subregion containing a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases, wherein the sixth subregion hybridizes with a third subregion of the second splint chain (400).

[0035] In some embodiments, the kit of this disclosure further comprises T4 polynucleotide kinase. In some embodiments, the kit of this disclosure further comprises a ligase. In some embodiments, the kit of this disclosure further comprises T4 polynucleotide kinase and a ligase. In some embodiments, the ligase comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0036] This disclosure provides a method for forming multiple library-sandwich complexes (500), comprising: a) providing multiple double-stranded sandwich termini, wherein each double-stranded sandwich termini (200) includes a first sandwich chain (300) hybridizing with a second sandwich chain (400), wherein the double-stranded sandwich termini includes a double-stranded region and two side-attached single-stranded regions, wherein the first sandwich chain includes a first region (320), an inner region (310), and a second region (330), and wherein the inner region (310) of the first sandwich chain hybridizes with the second sandwich chain (400); and b) combining the multiple double-stranded sandwich termini with multiple single-stranded nucleic acid library molecules. (100) Hybridization, wherein each library molecule includes a target sequence (110) with at least a first left universal adaptor sequence (120) on one side and at least a first right universal adaptor sequence (130) on the other side, wherein the hybridization is performed under conditions suitable for hybridizing a first region (320) of a first splint chain with at least a first left universal adaptor sequence (120) of the library molecule, and such conditions are suitable for hybridizing a second region (330) of the first splint chain with at least a first right universal sequence (130) of the library molecule, thereby circulating the plurality of library molecules to form a plurality of library-splice complexes (500).

[0037] In some embodiments, each library-splice complex (500) in the plurality of library-splice complexes includes a first gap between the 5' end of the library molecule and the 3' end of the second splint chain, and wherein each library-splice complex (500) in the plurality of library-splice complexes includes a second gap between the 5' end of the second splint chain and the 3' end of the library molecule. In some embodiments, each nucleic acid library molecule (100) in the plurality of nucleic acid libraries further includes: a second left universal adaptor sequence (140). In some embodiments, each nucleic acid library molecule (100) in the plurality of nucleic acid libraries further includes: a second right universal adaptor sequence (150). In some embodiments, each nucleic acid library molecule (100) in the plurality of nucleic acid libraries further includes: a first left index sequence (160). In some embodiments, each nucleic acid library molecule (100) in the plurality of nucleic acid libraries further includes: a first right index sequence (170). In some embodiments, each nucleic acid library molecule (100) in the plurality of nucleic acid libraries further includes: a first left unique identifier sequence (180). In some embodiments, each nucleic acid library molecule (100) in the plurality of nucleic acid library molecules further includes: a first right unique identification sequence (190).

[0038] In some embodiments, each nucleic acid library molecule (100) in a plurality of nucleic acid library molecules further comprises any one or any combination of two or more of the following: (i) a second left universal adaptor sequence (140); (ii) a second right universal adaptor sequence (150); (iii) a first left index sequence (160); (iv) a first right index sequence (170); (v) a first left unique identifier sequence (180); and / or (vi) a first right unique identifier sequence (190). In some embodiments, the first and / or second left universal adaptor sequences comprise: (i) a universal binding sequence for forward sequencing primers; (ii) a universal binding sequence for reverse sequencing primers; (iii) a universal binding sequence for a first surface primer; (iv) a universal binding sequence for a second surface primer; (v) a universal binding sequence for forward amplification primers; (vi) a universal binding sequence for reverse amplification primers; and / or (vii) a universal binding sequence for compacted oligonucleotides.

[0039] In some embodiments, the first and / or second universal right adaptor sequence comprises: (i) a universal binding sequence for forward sequencing primers; (ii) a universal binding sequence for reverse sequencing primers; (iii) a universal binding sequence for a first surface primer; (iv) a universal binding sequence for a second surface primer; (v) a universal binding sequence for forward amplification primers; (vi) a universal binding sequence for reverse amplification primers; and / or (vii) a universal binding sequence for compacted oligonucleotides.

[0040] In some embodiments, the second splint chain (400) includes at least two subregions: a first subregion containing a universal binding sequence for a third surface primer; and a second subregion containing a universal binding sequence for a fourth surface primer, wherein the first and second subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the second splint chain (400) further includes an optional third subregion containing a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases.

[0041] In some embodiments, the first splint chain (300) includes an inner region (310) comprising at least two subregions: a fourth subregion containing a universal binding sequence for a third surface primer and hybridizing with a first subregion of the second splint chain (400); and a fifth subregion containing a universal binding sequence for a fourth surface primer and hybridizing with a second subregion of the second splint chain (400); wherein the fourth and fifth subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the first splint chain (300) includes an inner region (310) further comprising a sixth subregion containing a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases, wherein the sixth subregion hybridizes with a third subregion of the second splint chain (400).

[0042] This disclosure provides a method for forming a plurality of library-splice complexes (500), comprising: a) providing a plurality of double-stranded splint connectors (200), wherein each double-stranded splint connector (200) includes a first splint chain (300) hybridizing with a second splint chain (400), wherein the first splint chain (300) includes regions arranged in a 5' to 3' order: a first region (320), an inner region (310), and a second region (330), and wherein the inner region (310) of the first splint chain hybridizes with the second splint chain (400), wherein the second splint chain... The chain contains regions arranged in a 5' to 3' order: (i) a second sub-region having a universal binding sequence for a fourth surface primer, and (ii) a first sub-region having a universal binding sequence for a third surface primer; and b) hybridization of multiple double-stranded splice adapters with multiple single-stranded nucleic acid library molecules (100), wherein each library molecule contains regions arranged in a 5' to 3' order: (i) a first left universal adapter sequence (120) having a binding sequence (120) for a first surface primer; (ii) a second left universal adapter sequence (140) having a binding sequence (120) for a first surface primer; The library comprises: (iii) a target sequence (110); (iv) a second right universal adaptor sequence (150) having a binding sequence for the second sequencing primer; and (v) a first right universal adaptor sequence (130) having a binding sequence (130) for the second surface primer, wherein hybridization is performed under conditions suitable for hybridizing a portion of the first splint strand (300) with a portion of the library molecule (100), thereby circulating the library molecule to produce a library-splice complex (500), such that the first splint strand... Region 1 (320) hybridizes with the binding sequence (120) for the first surface primer, and region 330 of the first splint chain hybridizes with the binding sequence (130) for the second surface primer, wherein the library-splice complex (500) contains a first gap between the 5' end of the library molecule and the 3' end of the second splint chain (300), wherein the library-splice complex (500) contains a second gap between the 5' end of the second splint chain (300) and the 3' end of the library molecule (100), and wherein the first and second gaps are enzymatically ligated.

[0043] In some embodiments, the plurality of single-stranded nucleic acid library molecules (100) further include a first left index sequence (160) and / or a first right index sequence (170). In some embodiments, the plurality of single-stranded nucleic acid library molecules (100) further include a first left unique identifier sequence (180) and / or a first right unique identifier sequence (190).

[0044] In some embodiments, the method further includes contacting the multiple double-stranded splint initiators (200) and the multiple single-stranded nucleic acid library molecules (100) with T4 polynucleotide kinase under conditions suitable for phosphorylating the 5' ends of the multiple double-stranded splint initiators (200) and / or multiple single-stranded nucleic acid library molecules (100).

[0045] In some embodiments, the method further includes: contacting a plurality of double-stranded splint adapters (200) and a plurality of single-stranded nucleic acid library molecules (100) with a ligase under conditions suitable for enzymatic ligation of the first and second gaps, thereby generating a plurality of covalently closed circular library molecules (600), each covalently closed circular library molecule hybridizing with the first splint strand (300).

[0046] In some embodiments, the method further includes performing the following sequential steps: a) contacting the plurality of double-stranded clamp initiators (200) and the plurality of single-stranded nucleic acid library molecules (100) with T4 polynucleotide kinase under conditions suitable for phosphorylating the 5' ends of the plurality of double-stranded clamp initiators (200) and the plurality of single-stranded nucleic acid library molecules (100); and b) contacting the phosphorylated double-stranded clamp initiators (200) and the phosphorylated single-stranded nucleic acid library molecules (100) with a ligase under conditions suitable for enzymatically ligating the first and second gaps, thereby generating a plurality of covalently closed circular library molecules (600), each covalently closed circular library molecule hybridizing with the first clamp strand (300).

[0047] In some embodiments, the method further includes performing the following substantially simultaneous steps: under conditions suitable for phosphorylating the 5' ends of a plurality of double-stranded splint initiators (200) and a plurality of single-stranded nucleic acid library molecules (100), and said conditions suitable for enzymatically ligating the first and second gaps, contacting the plurality of double-stranded splint initiators (200) and the plurality of single-stranded nucleic acid library molecules (100) with (i) T4 polynucleotide kinase and (ii) ligase, thereby generating a plurality of covalently closed circular library molecules (600), each library molecule hybridizing with a first splint strand (300).

[0048] In some embodiments, the method further includes contacting a plurality of covalently closed circular library molecules (600) with at least one exonuclease to remove a plurality of first splint chains (300) and retain the plurality of covalently closed circular library molecules (600). In some embodiments, the at least one exonuclease comprises exonuclease I, thermostable exonuclease I, and / or T7 exonuclease.

[0049] In some embodiments, each of the plurality of covalently closed circular library molecules (600) includes a second splint chain region (400) comprising a universal binding sequence for a third surface primer, and wherein the method further comprises: distributing the retained plurality of covalently closed circular library molecules (600) onto a support having a plurality of third surface primers fixed thereon, under conditions suitable for hybridizing the respective covalently closed circular library molecules (600) with the respective fixed third surface primers, thereby fixing the plurality of covalently closed circular library molecules (600).

[0050] In some embodiments, the method further includes: contacting the plurality of fixed covalently closed circular library molecules (600) with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for using a plurality of third surface primers as immobilized amplification primers and using a plurality of covalently closed circular library molecules (600) as template molecules for rolling circle amplification on a support, thereby generating a plurality of immobilized nucleic acid polymer molecules. In some embodiments, the plurality of nucleotides include dATP, dGTP, dCTP, dTTP, and / or dUTP.

[0051] In some embodiments, the first (120) or second (140) left universal adaptor sequence of each of the plurality of library molecules contains a universal binding sequence against the forward amplification primers, and the method further includes: a) hybridizing a plurality of soluble forward amplification primers with the first or second left universal adaptor sequence, the first or second left universal adaptor sequence containing a universal binding sequence against the forward amplification primers; and b) performing a rolling circle amplification reaction, thereby generating a plurality of nucleic acid multiply molecules.

[0052] In some embodiments, the first (130) or second (150) right universal adaptor sequence of each of the plurality of library molecules contains a universal binding sequence for the forward amplification primers, and the method further includes: a) hybridizing a plurality of soluble forward amplification primers with the first or second right universal adaptor sequence, the first or second right universal adaptor sequence containing a universal binding sequence for the forward amplification primers; and b) performing a rolling circle amplification reaction, thereby generating a plurality of nucleic acid multiply molecules, each nucleic acid multiply molecule hybridizing with a covalently closed circular library molecule (600).

[0053] In some embodiments, each of the plurality of polyp molecules includes a second splint chain region (400) having a universal binding sequence for a third surface primer, wherein each polyp molecule hybridizes with a covalently closed circular library molecule (600), and the method further includes distributing the plurality of polyp molecules onto a support having a plurality of third surface primers fixed thereon under conditions suitable for hybridizing at least a portion of the polyp with at least a portion of a plurality of fixed third surface primers, thereby fixing the plurality of polyp molecules.

[0054] In some embodiments, the method further includes: under conditions suitable for rolling circle amplification on a support using multiple covalently closed circular library molecules (600) as template molecules, contacting immobilized multiple polymer molecules (which hybridize with the covalently closed circular library molecules (600)) with multiple strand displacement polymerases and multiple nucleotides, thereby extending multiple immobilized nucleic acid polymer molecules. In some embodiments, the multiple nucleotides include dATP, dGTP, dCTP, dTTP, and / or dUTP.

[0055] In some embodiments, each library molecule (600) in a plurality of covalently closed circular library molecules hybridizes with a first splint chain (300), and the method further includes: contacting the plurality of covalently closed circular library molecules (600) with a plurality of chain displacement polymerases and a plurality of nucleotides under conditions suitable for using the first splint chain (300) as an amplification primer for rolling circle amplification reaction, thereby generating a plurality of multiply molecules.

[0056] In some embodiments, each of the plurality of polymolecules includes a second splint chain region (400) comprising a universal binding sequence for a third surface primer, and the method further comprises: distributing the plurality of polymolecules hybridized with a covalently closed circular library molecule (600) onto a support having a plurality of third surface primers fixed thereon, under conditions suitable for hybridizing at least a portion of the polymolecules with at least a portion of a plurality of fixed third surface primers, thereby fixing the plurality of polymolecules hybridized with the covalently closed circular library molecule (600).

[0057] In some embodiments, the method further includes: contacting multiple immobilized multiply molecules with multiple strand displacement polymerases and multiple nucleotides under conditions suitable for rolling circle amplification on a support using multiple covalently closed circular library molecules (600) as template molecules, thereby extending multiple immobilized nucleic acid multiply molecules. In some embodiments, the multiple nucleotides include dATP, dGTP, dCTP, dTTP, and / or dUTP. In some embodiments, the support further comprises multiple fourth surface primers immobilized on the support.

[0058] In some embodiments, the plurality of immobilized nucleic acid polymolecules comprises at least two second splint regions (400), each second splint region having a universal binding sequence for a third and a fourth surface primer, and the method further comprises: incubating the plurality of immobilized nucleic acid polymolecules under conditions suitable for hybridizing at least one second splint region (400) of at least one polymolecule with an immobilized fourth surface primer, thereby immobilizing at least a portion of the immobilized polymolecules to a support.

[0059] In some embodiments, the method further includes sequencing a plurality of immobilized multiply molecules, the method comprising: a) contacting the plurality of immobilized multiply molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble sequencing primers, wherein the contact is performed under conditions suitable for forming a plurality of complex polymerases, each complex polymerase comprising a sequencing polymerase that binds to a nucleic acid duplex, wherein the nucleic acid duplex comprises a multiply molecule that hybridizes to the soluble sequencing primers; b) contacting the plurality of complex sequencing polymerases with a plurality of nucleotides under conditions suitable for binding at least one nucleotide to the complex sequencing polymerases, wherein the plurality of nucleotides comprises at least one nucleotide analog labeled with a fluorescent group and having a removable chain termination portion at the 3' position of the sugar; c) incorporating at least one nucleotide into the 3' end of the hybridized sequencing primers, thereby generating a plurality of nascent extended sequencing primers; and d) detecting the incorporated nucleotide and identifying the nucleobases of the incorporated nucleotide.

[0060] In some embodiments, the method further includes sequencing a plurality of immobilized multiply molecules, the method comprising: a) contacting the plurality of immobilized multiply molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble sequencing primers, wherein the contact is performed under conditions suitable for forming a plurality of first complex polymerases, each first complex polymerase comprising a sequencing polymerase that binds to a nucleic acid duplex, wherein the nucleic acid duplex comprises a multiply molecule that hybridizes to the soluble sequencing primers; b) combining complementary nucleotide units of a multivalent molecule with at least two of the plurality of first complex polymerases to form a plurality of multivalent- Under conditions of complex polymerase, multiple complex sequencing polymerases are contacted with multiple detectably labeled multivalent molecules, thereby forming multiple multivalent-complex polymerases, and the conditionally inhibited complementary nucleotide units are incorporated into the sequencing primers of the multiple multivalent-complex polymerases, wherein each of the multiple multivalent molecules contains a core attached to multiple nucleotide arms, and each nucleotide arm is attached to a nucleotide unit; c) detecting the multiple multivalent-complex polymerases; and d) identifying the nucleobases of the complementary nucleotide units that bind to the multiple first complex polymerases of the multiple multivalent-complex polymerases, thereby determining the sequence of the nucleic acid template.

[0061] In some embodiments, the method further includes: e) dissociating a plurality of multivalent-complex polymerases and removing a plurality of first sequencing polymerases and the multivalent molecules bound thereto, while retaining a plurality of nucleic acid duplexes; f) contacting the plurality of retained nucleic acid duplexes from step (e) with a plurality of second sequencing polymerases, wherein the contact is performed under conditions suitable for binding the plurality of second sequencing polymerases with the plurality of retained nucleic acid duplexes, thereby forming a plurality of second complex polymerases of second sequencing polymerases bound to the retained nucleic acid duplexes; g) contacting the plurality of second complex polymerases with a plurality of nucleotides, wherein the contact is performed under conditions suitable for binding complementary nucleotides of the plurality of nucleotides with at least two of the second complex polymerases from step (f), thereby forming a plurality of nucleotide-complex polymerases, and the conditions are suitable for incorporating the binding complementary nucleotides into the sequencing primers of the nucleotide-complex polymerases. In some embodiments, the plurality of nucleotides includes at least one nucleotide analog labeled with a fluorescent group and having a removable chain termination portion at the 3' position of the sugar.

[0062] In some embodiments, the method further includes: h) detecting complementary nucleotides incorporated into the sequencing primers of the nucleotide-complex polymerase. In some embodiments, the method further includes: h) detecting complementary nucleotides incorporated into the sequencing primers of the nucleotide-complex polymerase; and i) identifying the nucleobases of the complementary nucleotides incorporated into the sequencing primers of the nucleotide-complex polymerase.

[0063] This disclosure provides a method for forming at least one affinity complex, comprising: a) binding a first universal nucleic acid primer, a first DNA polymerase, and a first multivalent molecule to a first portion of any multivalent molecule of any of claims 80, 85, 89, or 92, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule binds to the first DNA polymerase; and b) binding a second universal nucleic acid primer, a second DNA polymerase, and the first multivalent molecule to a second portion of the same multivalent template molecule, thereby forming a second binding complex, wherein a second nucleotide unit of the first multivalent molecule binds to the second DNA polymerase, wherein the first and second binding complexes of the same multivalent molecule form an affinity complex, wherein the first multivalent molecule comprises a core attached to a plurality of nucleotide arms, and each nucleotide arm is attached to a nucleotide unit, and wherein the multivalent molecule comprises two or more tandem repeat sequences of a target sequence (110) and universal primer binding sites for binding the first and second universal nucleic acid primers.

[0064] This disclosure provides a method for sequencing by forming at least one affinity complex, comprising: a) binding a first universal nucleic acid primer, a first DNA polymerase, and a first multivalent molecule to a first portion of any multivalent molecule of this disclosure, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule binds to the first DNA polymerase; b) binding a second universal nucleic acid primer, a second DNA polymerase, and the first multivalent molecule to a second portion of the same multivalent template molecule, thereby forming a second binding complex, wherein a second nucleotide unit of the first multivalent molecule binds to the second DNA polymerase, wherein the first and second binding complexes of the same multivalent molecule form an affinity complex, wherein the first multivalent molecule... The multiplex molecule comprises a core attached to multiple nucleotide arms and each nucleotide arm attached to a nucleotide unit, wherein the multiplex molecule contains two or more tandem repeat sequences of the target sequence (110) and universal primer binding sites for binding first and second universal nucleic acid primers, and wherein contact is performed under conditions where first and second nucleotide unit polymerases suitable for inhibiting binding catalyze incorporation into first and second binding complexes; c) detecting first and second binding complexes on the same multiplex template molecule, and d) identifying a first nucleotide unit in the first binding complex, thereby determining the sequence of a first portion of the multiplex template molecule, and identifying a second nucleotide unit in the second binding complex, thereby determining the sequence of a second portion of the multiplex template molecule.

[0065] This disclosure provides a method for preparing a multiplex mixture of target sequences isolated from multiple sample sources, comprising: a) providing two or more populations of single-stranded nucleic acid library molecules (100), each population of library molecules (100) being contained in a separate compartment, wherein the nucleic acid library molecules in a given population contain (i) a first left universal adaptor sequence (120) having a binding sequence for a first surface primer, (ii) a second left universal adaptor sequence (140) having a binding sequence for a first sequencing primer; (iii) a target sequence (110) isolated from a sample source, and (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer. (v) a first right universal adapter sequence (130) having a binding sequence for the second surface primer, and (vii) a first left index sequence (160) and / or a first right index sequence (170), wherein the sequences of the left (160) and / or right (170) indexes individually or in combination identify the sample source from which the target sequence (110) is isolated; (b) providing a plurality of double-stranded clamp adapters (200), wherein each double-stranded clamp adapter (200) comprises a first clamp chain (300) hybridizing with a second clamp chain (400), wherein the first clamp chain (300) comprises regions arranged in a 5' to 3' order: a first region (320), an inner region (310), and a third region (320). Region 2 (330), wherein the inner region (310) of the first splint chain hybridizes with the second splint chain (400), wherein the second splint chain comprises regions arranged in a 5' to 3' order: (i) a second subregion having a universal binding sequence for a fourth surface primer, and (ii) a first subregion having a universal binding sequence for a third surface primer; c) contacting a population of single-stranded nucleic acid library molecules (100) with a plurality of double-stranded splint connectives (200) in separate compartments, wherein the contact is performed under conditions suitable for partially hybridizing a portion of the first splint chain (300) with the library molecules (100), thereby circulating the library molecules to generate a population of library-sponge complexes (500), such that Each first region (320) of the first splint chain hybridizes with the binding sequence (120) of the library molecule (100) for the first surface primer, and each third region (330) of the first splint chain hybridizes with the binding sequence (130) of the library molecule (100) for the second surface primer, wherein each of the library-splice complexes (500) contains a first gap between the 5' end of the library molecule and the 3' end of the second splint chain (300), wherein each of the library-splice complexes (500) contains a second gap between the 5' end of the second splint chain (300) and the 3' end of the library molecule (100), and wherein the first and second gaps are enzymatically ligated.d) In separate compartments, under conditions suitable for enzymatic ligation of the first and second gaps, a population of library-sandwich complexes (500) is contacted with a ligase, thereby generating two or more populations of covalently closed circular library molecules (600), each population hybridizing with the first sandwich strand (300); and e) the two or more populations of covalently closed circular library molecules (600) from the separate compartments are pooled together to generate a multiplex mixture of covalently closed circular library molecules (600) containing a multiplex mixture of target sequences isolated from multiple sample sources.

[0066] In some embodiments, each covalently closed circular library molecule (600) in the multiplex mixture of step (e) comprises a second splint chain region (400) including a universal binding sequence for a third surface primer, and the method further comprises: a) distributing the multiplex mixture of covalently closed circular library molecules (600) onto a support having a plurality of third surface primers fixed thereon, under conditions suitable for hybridizing each covalently closed circular library molecule (600) with each fixed third surface primer, thereby fixing the plurality of third surface primers. A covalently closed circular library molecule (600); and b) under conditions suitable for using multiple third-surface primers as immobilized amplification primers and using multiple covalently closed circular library molecules (600) as template molecules for rolling circle amplification on a support, a multiple mixture of immobilized covalently closed circular library molecules (600) is contacted with multiple strand displacement polymerases and multiple nucleotides, thereby generating multiple immobilized nucleic acid multiply molecules, wherein the multiple nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

[0067] In some embodiments, the method further includes performing a rolling circle amplification reaction by: a) contacting two or more populations of covalently closed circular library molecules (600) hybridized with the first splint strands (300) of step (d) or (e) with at least one exonuclease under conditions suitable for removing a plurality of first splint strands (300) and retaining a population of covalently closed circular library molecules (600); and b) contacting two or more populations of the retained covalently closed circular library molecules (600) with a plurality of soluble amplification primers, a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction, thereby generating a plurality of nucleic acid multiply molecules, wherein the plurality of nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

[0068] In some embodiments, the method further includes: a) distributing multiple polyp molecules onto a support to which multiple third surface primers are immobilized, under conditions suitable for hybridizing at least a portion of the polyp with at least a portion of multiple immobilized third surface primers, thereby immobilizing multiple polyp molecules; and b) contacting the immobilized multiple polyp molecules (which hybridize with the covalently closed circular library molecules (600)) with multiple strand displacement polymerases and multiple nucleotides, thereby extending multiple immobilized nucleic acid polyp molecules, wherein the multiple nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

[0069] In some embodiments, the method further includes: performing a rolling circle amplification reaction under conditions suitable for performing the rolling circle amplification reaction by contacting two or more groups of covalently closed circular library molecules (600) that hybridize with the first splint chain (300) of step (d) or (e) with a plurality of chain displacement polymerases and a plurality of nucleotides, thereby generating a plurality of multiply molecules, wherein the plurality of nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

[0070] In some embodiments, the method further includes: a) distributing a plurality of polyp molecules hybridized with a covalently closed circular library molecule (600) onto a support to which a plurality of third surface primers are immobilized, under conditions suitable for hybridizing at least a portion of the polyp molecules with at least a portion of a plurality of immobilized third surface primers, thereby immobilizing the plurality of polyp molecules hybridized with the covalently closed circular library molecule (600); and b) contacting the plurality of immobilized polyp molecules with a plurality of strand displacement polymerases and a plurality of nucleotides, under conditions suitable for using the plurality of covalently closed circular library molecules (600) as template molecules for rolling circle amplification on the support, thereby extending the plurality of immobilized nucleic acid polyp molecules, wherein the plurality of nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

[0071] In some embodiments, the method further includes sequencing the insertion region (110) and first left index sequence (160) and / or first right index sequence (170) of a plurality of fixed nucleic acid polymer molecules, wherein the sequence of the insertion region (110) and the first left index sequence (160) and / or the first right index sequence (170) can be used to identify the sample source of the target sequence.

[0072] In some embodiments, the sequencing reaction comprises: a) binding a plurality of immobilized nucleic acid polymer molecules to a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled nucleotide analogs, each nucleotide analog comprising a 2' or 3' chain termination portion, under conditions suitable for incorporating detectably labeled nucleotide analogs into the 3' end of sequencing primers; b) detecting the bound detectably labeled nucleotide analogs; and c) recognizing the nuclei of the detectably labeled nucleotide analogs. In some embodiments, the sequencing reaction employs a two-stage sequencing reaction, wherein the first stage comprises: a) binding a plurality of immobilized nucleic acid polymer molecules to a plurality of sequencing primers, a plurality of first sequencing polymerases, and a plurality of detectably labeled multivalent molecules (e.g., forming a plurality of multivalent-complex polymerases) under conditions suitable for binding each polymer molecule to sequencing primers, a first sequencing polymerase, and a detectably labeled multivalent molecule; b) detecting the bound detectably labeled multivalent molecule; and c) recognizing the nuclei of the detectably labeled multivalent molecule. In some embodiments, the detectably labeled multivalent molecule binds to a plurality of fixed nucleic acid multiply molecules to form at least one affinity complex.

[0073] In some embodiments, the method further includes performing a second stage comprising: d) removing a plurality of first sequencing polymerases and a plurality of bound multivalent molecules from a plurality of immobilized nucleic acid multiply molecules, while retaining the immobilized multiply molecules (nucleic acid duplexes) that hybridize with the sequencing primers; and e) contacting the retained immobilized multiply molecules and the hybridized sequencing primers with a plurality of second polymerases and a plurality of nucleotides under conditions suitable for incorporating nucleotides into the 3' end of the sequencing primers.

[0074] This disclosure provides a method for preparing a multiplex mixture of target sequences isolated from multiple sample sources, comprising: a) providing two or more populations of single-stranded nucleic acid library molecules (100), each population of library molecules (100) and each population of single-stranded nucleic acid library molecules being contained in a separate compartment, wherein the nucleic acid library molecules in a given population contain (i) a first left universal adaptor sequence (120) having a binding sequence for a first surface primer, (ii) a second left universal adaptor sequence (140) having a binding sequence for a first sequencing primer; (iii) a target sequence (110) isolated from a sample source, and (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer. (v) a first right universal adaptor sequence (130) having a binding sequence for the second surface primer, and (vi) a first left index sequence (160) and / or a first right index sequence (170), wherein the left (160) and / or right (170) index sequences individually or in combination identify the sample source from which the target sequence (110) is isolated; b) pooling two or more populations of single-stranded nucleic acid library molecules (100) into the same compartment; c) adding a plurality of double-stranded splint adaptors (200) to the compartment of step (b), wherein each double-stranded splint adaptor (200) contains a first splint strand (300) hybridizing with a second splint strand (400), wherein the first splint strand (300) contains a 5' to The regions are arranged in a 3' sequence: a first region (320), an inner region (310), and a second region (330), wherein the inner region (310) of the first splint hybridizes with the second splint strand (400), wherein the second splint strand contains regions arranged in a 5' to 3' sequence: (i) a second subregion having a universal binding sequence for a fourth surface primer, and (ii) a first subregion having a universal binding sequence for a third surface primer; d) under conditions suitable for hybridizing a portion of the first splint (300) with a portion of the library molecule (100), in the same compartment of step (c), a population of single-stranded nucleic acid library molecules (100) and a plurality of double-stranded splint adaptors (200) are incubated, thereby circulating the library molecules to generate a library-sponge. The complex (500) population hybridizes the first region (320) of each first splint chain with the binding sequence (120) of each library molecule (100) against the first surface primer, and the third region (330) of each first splint chain hybridizes with the binding sequence (130) of each library molecule (100) against the second surface primer, wherein each of the library-splice complexes (500) contains a first gap between the 5' end of the library molecule and the 3' end of the second splint chain (300), wherein each of the library-splice complexes (500) contains a second gap between the 5' end of the second splint chain (300) and the 3' end of the library molecule (100), and wherein the first and second gaps are enzymatically ligated;and e) under conditions suitable for enzymatic ligation of the first and second gaps, the library-sandwich complex (500) population in the compartment of step (d) is contacted with the ligase, thereby generating a population of covalently closed circular library molecules (600), each hybridized to the first sandwich chain (300), thus generating a multiple mixture of covalently closed circular library molecules (600) containing a multiple mixture of target sequences isolated from multiple sample sources.

[0075] In some embodiments, each covalently closed circular library molecule (600) in the multiple mixture of step (e) comprises a second splint chain region (400) including a universal binding sequence for a third surface primer, and the method further comprises: a) distributing a plurality of covalently closed circular library molecules (600) onto a support having a plurality of third surface primers fixed thereon under conditions suitable for hybridizing each covalently closed circular library molecule (600) with each fixed third surface primer, thereby fixing a plurality of covalently closed circular library molecules (600) to a support having a plurality of third surface primers fixed thereon. A closed circular library molecule (600); and b) under conditions suitable for using multiple third-surface primers as immobilized amplification primers, using multiple covalently closed circular library molecules (600) as template molecules, and performing rolling circle amplification on a support, contacting multiple immobilized covalently closed circular library molecules (600) with multiple strand displacement polymerases and multiple nucleotides, thereby generating multiple immobilized nucleic acid multiply molecules, wherein the multiple nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

[0076] In some embodiments, the method further includes performing a rolling circle amplification reaction by: a) contacting the covalently closed circular library molecules (600) hybridized with the first splint strands (300) of step (d) or (e) with at least one exonuclease under conditions suitable for removing a plurality of first splint strands (300) and retaining a population of covalently closed circular library molecules (600); b) contacting the retained population of covalently closed circular library molecules (600) with a plurality of soluble amplification primers, a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction, thereby generating a plurality of nucleic acid multiply molecules, wherein the plurality of nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

[0077] In some embodiments, the method further includes: c) distributing multiple polyp molecules onto a support to which multiple third surface primers are immobilized, under conditions suitable for hybridizing at least a portion of the polyp with at least a portion of multiple immobilized third surface primers, thereby immobilizing multiple polyp molecules; and d) contacting the immobilized multiple polyp molecules (which hybridize with the covalently closed circular library molecules (600)) with multiple strand displacement polymerases and multiple nucleotides, thereby extending multiple immobilized nucleic acid polyp molecules, wherein the multiple nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

[0078] In some embodiments, the method further includes: performing a rolling circle amplification reaction under conditions suitable for performing a rolling circle amplification reaction by contacting a population of covalently closed circular library molecules (600) each hybridized with the first splint chain (300) of step (d) or (e) with a plurality of chain displacement polymerases and a plurality of nucleotides, thereby generating a plurality of multiply molecules, wherein the plurality of nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

[0079] In some embodiments, the method further includes: c) distributing a plurality of polyp molecules hybridized with a covalently closed circular library molecule (600) onto a support to which a plurality of third surface primers are immobilized, under conditions suitable for hybridizing at least a portion of the polyp molecules with at least a portion of a plurality of immobilized third surface primers, thereby immobilizing the plurality of polyp molecules hybridized with the covalently closed circular library molecule (600); and d) contacting the plurality of immobilized polyp molecules with a plurality of strand displacement polymerases and a plurality of nucleotides, under conditions suitable for using the plurality of covalently closed circular library molecules (600) as template molecules for rolling circle amplification on the support, thereby extending the plurality of immobilized nucleic acid polyp molecules, wherein the plurality of nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

[0080] In some embodiments, the method further includes sequencing the insertion region (110) and first left index sequence (160) and / or first right index sequence (170) of a plurality of fixed nucleic acid polymer molecules, wherein the insertion region sequence (110) and the first left index sequence (160) and / or first right index sequence (170) can be used to identify the sample source of the target sequence.

[0081] In some embodiments, the sequencing reaction comprises: a) binding a plurality of immobilized nucleic acid polymer molecules to a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled nucleotide analogs, each nucleotide analog comprising a 2' or 3' chain termination portion, under conditions suitable for incorporating detectably labeled nucleotide analogs into the 3' end of sequencing primers; b) detecting the bound detectably labeled nucleotide analogs; and c) recognizing the nucleobases of the detectably labeled nucleotide analogs.

[0082] In some embodiments, the sequencing reaction employs a two-stage sequencing reaction, wherein the first stage comprises: a) binding a plurality of immobilized nucleic acid polymer molecules to a plurality of sequencing primers, a plurality of first sequencing polymerases, and a plurality of detectably labeled polyvalent molecules under conditions suitable for binding each polymer molecule to sequencing primers, a first sequencing polymerase, and a detectably labeled polyvalent molecule (e.g., forming a plurality of multivalent-complex polymerases); b) detecting the bound detectably labeled polyvalent molecule; and c) recognizing the nucleobases of the detectably labeled polyvalent molecule. In some embodiments, the detectably labeled polyvalent molecule forms at least one affinity complex with the plurality of immobilized nucleic acid polymer molecules.

[0083] In some embodiments, the method further includes performing a second stage comprising: d) removing a plurality of first sequencing polymerases and a plurality of bound multivalent molecules from a plurality of immobilized nucleic acid multiply molecules, while retaining the immobilized multiply molecules (nucleic acid duplexes) that hybridize with the sequencing primers; and e) contacting the retained immobilized multiply molecules and the hybridized sequencing primers with a plurality of second polymerases and a plurality of nucleotides under conditions suitable for incorporating nucleotides into the 3' end of the sequencing primers.

[0084] This disclosure provides a method for attaching additional universal adaptor sequences to nucleic acid library molecules, comprising: a) providing a plurality of nucleic acid library molecules (100), each nucleic acid library molecule containing sequences arranged in a 5' to 3' order: (i) a first left universal adaptor sequence (120), (ii) a second left universal adaptor sequence (140), (iii) a target sequence (110), (iv) a second right universal adaptor sequence (150), and (v) a first right universal adaptor sequence (130); b) hybridizing each library molecule of step (a) with a first tailed primer and performing a first primer extension reaction (or a first PCR), wherein the first tailed primer contains a 5' region carrying a third left universal adaptor sequence and a 3' region complementary to at least a portion of the first left universal adaptor sequence (120) of the library molecule (100), wherein the first primer extension reaction (or the first PCR) generates a plurality of first modified library molecules, each first modified library molecule having a third left universal adaptor sequence appended to one end, wherein the first tailed primer's 5' region carries a third left universal adaptor sequence (140) and the 3' region is ... tailed primer's 5' region carries a third left universal adaptor sequence (140) and the 3' region is complementary to at least a portion of the first left universal adaptor sequence (120) of the library molecule (100), wherein the first primer's 5' region carries a third left universal adaptor sequence (140) and the 3' The three-left universal adaptor sequence includes a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for the first or second surface primer, a universal binding sequence for forward or reverse amplification primers, and / or a universal binding sequence for compacted oligonucleotides; and c) hybridizing each of the first modified library molecules from step (a) with a second tailed primer and performing a second primer extension reaction (or a second PCR), wherein the second tailed primer includes a 5' region carrying a third right universal adaptor sequence and a 3' region complementary to at least a portion of the first right universal adaptor sequence (130) of the first modified library molecule, wherein the second primer extension reaction (or second PCR) generates a plurality of second modified library molecules, each second modified library molecule having a third right universal adaptor sequence appended to one end, wherein the third right universal adaptor sequence of the second tailed primer includes a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for the first or second surface primer, a universal binding sequence for forward or reverse amplification primers, and / or a universal binding sequence for compacted oligonucleotides.

[0085] In some embodiments, each nucleic acid library molecule comprises sequences arranged in a 5' to 3' order: (i) a first left universal adaptor sequence (120) having a binding sequence for a first surface primer, (ii) a second left universal adaptor sequence (140) having a binding sequence for a first sequencing primer, (iii) a target sequence (110), (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer, and (v) a first right universal adaptor sequence (130) having a binding sequence for a second surface primer.

[0086] In some embodiments, the method further includes: d) hybridizing each of the second modified library molecules from step (c) with a third tailed primer and performing a third primer extension reaction (or third PCR), wherein the third tailed primer comprises a 5' region carrying a fourth left universal adaptor sequence and a 3' region complementary to at least a portion of the third left universal adaptor sequence of the second modified library molecule, wherein the third primer extension reaction (or third PCR) generates a plurality of third modified library molecules, each third modified library molecule having a fourth left universal adaptor sequence appended to one end, wherein the fourth left universal adaptor sequence of the third tailed primer comprises a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for the first or second surface primers, a universal binding sequence for forward or reverse amplification primers, and / or a binding sequence for compaction oligomers. The universal binding sequence of nucleotides; and e) hybridizing each of the third modified library molecules from step (d) with a fourth tailed primer and performing a fourth primer extension reaction (or fourth PCR), wherein the fourth tailed primer contains a 5' region carrying a fourth right universal adaptor sequence and a 3' region complementary to at least a portion of the third right universal adaptor sequence of the third modified library molecule, wherein the fourth primer extension reaction (or fourth PCR) generates a plurality of fourth modified library molecules, each fourth modified library molecule having a fourth right universal adaptor sequence appended to one end, wherein the fourth right universal adaptor sequence of the fourth tailed primer contains a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for the first or second surface primers, a universal binding sequence for forward or reverse amplification primers, and / or a universal binding sequence for compacted oligonucleotides.

[0087] In some embodiments, the method further includes: f) hybridizing each of the fourth modified library molecules from step (e) with a fifth tailed primer and performing a fifth primer extension reaction (or fifth PCR), wherein the fifth tailed primer comprises a 5' region carrying a fifth left universal adaptor sequence and a 3' region complementary to at least a portion of the fourth left universal adaptor sequence of the fourth modified library molecule, wherein the fifth primer extension reaction (or fifth PCR) generates a plurality of fifth modified library molecules, each fifth modified library molecule having a fifth left universal adaptor sequence appended to one end, wherein the fifth left universal adaptor sequence of the fifth tailed primer comprises a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for the first or second surface primers, a universal binding sequence for forward or reverse amplification primers, and / or a binding sequence for compacted oligonucleotides. The universal binding sequence; and g) hybridizing each of the fifth modified library molecules from step (f) with a sixth tailed primer and performing a sixth primer extension reaction (or sixth PCR), wherein the sixth tailed primer contains a 5' region carrying a sixth right universal adaptor sequence and a 3' region complementary to at least a portion of the fourth right universal adaptor sequence of the fifth modified library molecule, wherein the sixth primer extension reaction (or sixth PCR) generates a plurality of sixth modified library molecules, each sixth modified library molecule having a sixth right universal adaptor sequence appended to one end, wherein the sixth right universal adaptor sequence of the sixth tailed primer contains a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for the first or second surface primers, a universal binding sequence for forward or reverse amplification primers and / or a universal binding sequence for compacted oligonucleotides.

[0088] In some embodiments, the first tailed primer, the third tailed primer, and / or the fifth tailed primer further include a left index sequence. In some embodiments, the first tailed primer, the third tailed primer, and / or the fifth tailed primer further include a left unique identifier sequence. In some embodiments, the second tailed primer, the fourth tailed primer, and / or the sixth tailed primer further include a right index sequence. In some embodiments, the second tailed primer, the fourth tailed primer, and / or the sixth tailed primer further include a right unique identifier sequence. In some embodiments, the additional third left universal connector sequence in step (b) may be incorporated into the first region (320) of the first splint chain. In some embodiments, the additional third right universal connector sequence in step (c) may be incorporated into the second region (330) of the first splint chain. In some embodiments, the additional fourth left universal connector sequence in step (d) may be incorporated into the first region (320) of the first splint chain. In some embodiments, the additional fourth right universal connector sequence in step (e) may be incorporated into the second region (330) of the first splint chain.

[0089] In some embodiments, the additional fifth left universal connector sequence in step (f) may be combined with the first region (320) of the first clamp chain. In some embodiments, the additional fifth right universal connector sequence in step (g) may be combined with the second region (330) of the first clamp chain.

[0090] This disclosure provides a method for forming a plurality of library-splice complexes (500), comprising: a) providing a plurality of double-stranded splint connectors (200), wherein each double-stranded splint connector (200) includes a first splint chain (300) hybridizing with a second splint chain (400), wherein the first splint chain (300) includes regions arranged in a 5' to 3' order: a first region (320), an inner region (310), and a second region (330), and wherein the inner region (310) of the first splint chain hybridizes with the second splint chain (400), wherein the second The splint chain comprises regions arranged in a 5' to 3' order: (i) a second subregion having a universal binding sequence for a fourth surface primer, and (ii) a first subregion having a universal binding sequence for a third surface primer; and b) hybridization of multiple double-stranded splint adaptors with multiple single-stranded nucleic acid library molecules (100), wherein each library molecule comprises regions arranged in a 5' to 3' order: (i) a first left universal adaptor sequence (120) having a binding sequence for a third surface primer; (ii) a second left universal adaptor sequence (140) having a binding sequence for a third surface primer; and (iii) a second left universal adaptor sequence (140) having a binding sequence for a third surface primer. The library comprises: (iii) a target sequence (110); (iv) a second right universal adaptor sequence (150) having a binding sequence for the second sequencing primer; and (v) a first right universal adaptor sequence (130) having a binding sequence for the fourth surface primer, wherein hybridization is performed under conditions suitable for hybridizing a portion of the first splint strand (300) with a portion of the library molecule (100), thereby circulating the library molecule to produce a library-splice complex (500), such that the first region of the first splint strand... (320) hybridizes with the binding sequence (120) for the third surface primer, and the third region (330) of the first splint chain hybridizes with the binding sequence (130) for the fourth surface primer, wherein the library-splice complex (500) contains a first gap between the 5' end of the library molecule and the 3' end of the second splint chain (400), wherein the library-splice complex (500) contains a second gap between the 5' end of the second splint chain (400) and the 3' end of the library molecule (100), and wherein the first and second gaps are enzymatically ligated.

[0091] In some embodiments, the plurality of single-stranded nucleic acid library molecules (100) further include a first left index sequence (160) and / or a first right index sequence (170). In some embodiments, the plurality of single-stranded nucleic acid library molecules (100) further include a first left unique identifier sequence (180) and / or a first right unique identifier sequence (190).

[0092] In some embodiments, the method further includes: contacting a plurality of double-stranded clamping adaptors (200) and a plurality of single-stranded nucleic acid library molecules (100) with a ligase under conditions suitable for enzymatic ligation of the first and second gaps, thereby generating a plurality of covalently closed circular library molecules (600), each covalently closed circular library molecule hybridizing with a first clamping strand (300). In some embodiments, the method further includes contacting the plurality of covalently closed circular library molecules (600) with at least one exonuclease to remove the plurality of first clamping strands (300) and retain the plurality of covalently closed circular library molecules (600).

[0093] In some embodiments, each of the plurality of covalently closed circular library molecules (600) includes a second splint chain region (400) comprising a universal binding sequence for a second surface primer, and the method further comprises: distributing the retained plurality of covalently closed circular library molecules (600) onto a support having a plurality of second surface primers fixed thereon, under conditions suitable for hybridizing the respective covalently closed circular library molecules (600) with the respective fixed second surface primers, thereby fixing the plurality of covalently closed circular library molecules (600).

[0094] In some embodiments, the method further includes: contacting multiple immobilized covalently closed circular library molecules (600) with multiple strand displacement polymerases and multiple nucleotides under conditions suitable for using multiple second surface primers as immobilized amplification primers and using multiple covalently closed circular library molecules (600) as template molecules for rolling circle amplification on a support, thereby generating multiple immobilized nucleic acid multiply molecules. In some embodiments, the multiple nucleotides include dATP, dGTP, dCTP, dTTP, and / or dUTP.

[0095] In some embodiments, a plurality of immobilized second surface capture primers on the support are located at predetermined or random positions on the support. In some embodiments, the plurality of immobilized second surface capture primers on the support are fluidly connected to each other to allow a reagent solution to flow onto the support, such that the plurality of immobilized second surface primers can react with the reagent substantially simultaneously in a large-scale parallel manner, optionally wherein the reagent solution contains an enzyme, a nucleotide, and a divalent cation. In some embodiments, the density of the plurality of immobilized nucleic acid polymolecules on the support is 10. 4 -108 pcs / mm 2 .

[0096] In some embodiments, the method further includes: sequencing a plurality of fixed polymers, wherein sequencing comprises: a) contacting the plurality of fixed polymer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble sequencing primers, wherein the contact is performed under conditions suitable for forming a plurality of complex polymerases, each complex polymerase comprising a sequencing polymerase that binds to a nucleic acid duplex, wherein the nucleic acid duplex comprises a polymer molecule that hybridizes to the soluble sequencing primers; b) contacting the plurality of complex sequencing polymerases with a plurality of nucleotides under conditions suitable for binding at least one nucleotide to the complex sequencing polymerases, wherein the plurality of nucleotides comprises at least one nucleotide analog labeled with a fluorescent group and having a removable chain termination portion at the 3' position of the sugar; c) incorporating at least one nucleotide into the 3' end of the hybridized sequencing primers, thereby generating a plurality of nascent extended sequencing primers; and d) detecting the incorporated nucleotide and identifying the nucleobases of the incorporated nucleotide.

[0097] In some embodiments, the plurality of nucleotides includes a removable chain-terminating portion at the 3' glycosyl group, wherein the removable chain-terminating portion comprises an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azide group, an azidoyl group, an O-azidomethyl group, an amine group, an amide group, a ketone group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group, or a silyl group, and wherein the removable chain-terminating portion may be cleaved using a chemical compound to generate an extendable 3'OH moiety on the glycosyl group. In some embodiments, the plurality of nucleotides comprises a nucleotide of one type selected from the group consisting of dATP, dGTP, dCTP, dTTP, and dUTP. In some embodiments, the plurality of nucleotides comprises a mixture of any combination of two or more types of nucleotides selected from the group consisting of dATP, dGTP, dCTP, dTTP, and / or dUTP.

[0098] In some embodiments, the method further includes: sequencing a plurality of immobilized multiply molecules, wherein sequencing comprises: a) contacting the plurality of immobilized multiply molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble universal sequencing primers, wherein the contact is performed under conditions suitable for forming a plurality of first complex polymerases, each first complex polymerase comprising a sequencing polymerase that binds to a nucleic acid duplex, wherein the nucleic acid duplex comprises a multiply molecule that hybridizes to the soluble sequencing primers; b) contacting the plurality of complex sequencing polymerases with a plurality of detectably labeled multivalent molecules under conditions suitable for binding complementary nucleotide units of multivalent molecules to at least two of the plurality of first complex polymerases to form a plurality of multivalent-complex polymerases, thereby forming a plurality of multivalent-complex polymerases, and wherein the conditionally inhibited complementary nucleotide units are incorporated into the sequencing primers of the plurality of multivalent-complex polymerases, wherein each of the plurality of multivalent molecules comprises a core attached to a plurality of nucleotide arms, and each nucleotide arm is attached to a nucleotide unit; and c) detecting the plurality of multivalent-complex polymerases.

[0099] In some embodiments, the method further includes: d) dissociating a plurality of multivalent-complex polymerases and removing a plurality of first sequencing polymerases and their bound multivalent molecules, while retaining a plurality of nucleic acid duplexes; e) contacting the plurality of retained nucleic acid duplexes from step d) with a plurality of second sequencing polymerases, wherein the contact is performed under conditions suitable for binding the plurality of second sequencing polymerases with the plurality of retained nucleic acid duplexes, thereby forming a plurality of second complex polymerases of second sequencing polymerases bound to the retained nucleic acid duplexes; f) contacting the plurality of second complex polymerases with a plurality of nucleotides, the plurality of nucleotides including at least one nucleotide analog having a removable chain termination portion at the sugar 3' position, wherein the contact is performed under conditions suitable for binding complementary nucleotides from the plurality of nucleotides with at least two of the second complex polymerases from step e), thereby forming a plurality of nucleotide-complex polymerases, and the conditions are suitable for incorporating the bound complementary nucleotides into the sequencing primers of the nucleotide-complex polymerases.

[0100] In some embodiments, the method further includes: g) detecting complementary nucleotides incorporated into the sequencing primers of the nucleotide-complex polymerase. In some embodiments, the method further includes: g) detecting complementary nucleotides incorporated into the sequencing primers of the nucleotide-complex polymerase; and h) identifying the nucleobases of the complementary nucleotides incorporated into the sequencing primers of the nucleotide-complex polymerase.

[0101] This disclosure provides a method for sequencing by forming at least one affinity complex, comprising: a) binding a first universal sequencing primer, a first sequencing polymerase, and a first detectably labeled multivalent molecule to a first portion of a multivalent molecule of claim 16, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule binds to the first sequencing polymerase; b) binding a second universal sequencing primer, a second sequencing polymerase, and a first detectably labeled multivalent molecule to a second portion of the same multivalent molecule, thereby forming a second binding complex, wherein a second nucleotide unit of the first multivalent molecule binds to the second sequencing polymerase, wherein the first and second binding complexes of the same multivalent molecule form an affinity complex, wherein the first detectably labeled multivalent molecule binds to a second portion of the first multivalent molecule. The labeled multivalent molecule comprises a core attached to multiple nucleotide arms, and each nucleotide arm is attached to a nucleotide unit, wherein the multivalent molecule comprises two or more tandem repeat sequences of the target sequence (110) and universal primer binding sites for binding first and second universal sequencing primers, and wherein contact is performed under conditions suitable for inhibiting polymerase-catalyzed incorporation of first and second nucleotide units bound in the first and second binding complexes; c) detecting the first and second binding complexes on the same multivalent molecule, and d) identifying the first nucleotide unit in the first binding complex, thereby determining the sequence of the first portion of the multivalent template molecule, and identifying the second nucleotide unit in the second binding complex, thereby determining the sequence of the second portion of the multivalent template molecule.

[0102] In some embodiments, multiple nucleotide arms attached to the core of each multivalent molecule have the same type of nucleotide unit, wherein the type of the nucleotide unit is selected from the group consisting of dATP, dGTP, dCTP, dTTP, and dUTP. In some embodiments, the multiple multivalent molecules comprise a mixture of any combination of two or more types of multivalent molecules, each type having a type selected from the group consisting of dATP, dGTP, dCTP, dTTP, and / or dUTP.

[0103] In some embodiments, the plurality of nucleotides include a removable chain termination portion at the 3' glycosyl group, wherein the removable chain termination portion comprises an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azide group, an azidoyl group, an O-azidomethyl group, an amine group, an amide group, a ketone group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group, or a silyl group, and wherein the removable chain termination portion may be cleaved using a chemical compound to generate an extendable 3'OH moiety on the glycosyl group.

[0104] In some embodiments, the plurality of nucleotides comprises a type of nucleotide selected from the group consisting of dATP, dGTP, dCTP, dTTP, and dUTP. In some embodiments, the plurality of nucleotides comprises a mixture of any combination of two or more types of nucleotides selected from the group consisting of dATP, dGTP, dCTP, dTTP, and / or dUTP.

[0105] In some embodiments, the support comprises a glass or plastic substrate. In some embodiments, the support is passivated with at least one hydrophilic polymer coating having a water contact angle of no more than 45 degrees. In some embodiments, the at least one hydrophilic polymer coating comprises molecules selected from the group consisting of: polyethylene glycol (PEG), poly(vinyl alcohol) (PVA), poly(vinylpyridine), poly(vinylpyrrolidone) (PVP), poly(acrylic acid) (PAA), polyacrylamide, poly(N-isopropylacrylamide) (PNIPAM), poly(methyl methacrylate) (PMA), poly(2-hydroxyethyl methacrylate) (PHEMA), poly(oligomeric (ethylene glycol) methyl ether methacrylate) (POEGMA), polyglutamic acid (PGA), polylysine, polyglucosides, streptavidin, and dextran. Attached Figure Description

[0106] The novel features of the invention are specifically set forth in the appended claims. The features and advantages of the invention will be better understood by referring to the following detailed description of exemplary embodiments, in which the principles of the invention are utilized, and in the accompanying drawings:

[0107] Figure 1 This is a schematic diagram illustrating the hybridization of an exemplary linear single-stranded library molecule (100) with a double-stranded clip molecule (200), thereby circulating the library molecule to form a library-scraper complex (500) with two notches. The library molecule (100) contains a target sequence (110) superimposed on one side by a first left universal adaptor sequence (120) and superimposed on the other side by a first right universal adaptor sequence (130). The double-stranded clip molecule contains a first clip chain (long chain (300)) that hybridizes with a second clip chain (short chain (400)). The first clip chain contains a first region (320) that hybridizes with a sequence at one end of the linear single-stranded library molecule and a second region (330) that hybridizes with a sequence at the other end of the linear single-stranded library molecule. The inner region (310) of the first clip chain hybridizes with the second clip chain (400).

[0108] Figure 2 Is with Figure 1The same schematic diagram is shown, with further details relating to embodiments of the inner region (310) of the first splint chain (300) and the second splint chain (400). The second splint chain (400) includes two subregions, wherein the first subregion contains a universal binding sequence for a third surface primer, and the second subregion contains a universal binding sequence for a fourth surface primer. The inner region (310) of the first splint chain (300) includes two subregions, wherein the fourth subregion hybridizes with the first subregion of the second splint chain (400), and the fifth subregion hybridizes with the second subregion of the second splint chain (400).

[0109] Figure 3 Is with Figure 1 The same schematic diagram is shown, with further details relating to embodiments of the inner region (310) of the first splint chain (300) and the second splint chain (400). The second splint chain (400) comprises three subregions, wherein the first subregion contains a universal binding sequence for a third surface primer, the second subregion contains a universal binding sequence for a fourth surface primer, and the third subregion contains a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases. The inner region (310) of the first splint chain (300) comprises three subregions, wherein the fourth subregion hybridizes with the first subregion of the second splint chain (400), and the fifth subregion hybridizes with the second subregion of the second splint chain (400), and the sixth subregion hybridizes with the third subregion of the second splint chain (400).

[0110] Figure 4 This is a schematic diagram illustrating the hybridization of an exemplary linear single-stranded library molecule (100) with a double-stranded clip molecule (200), thereby circulating the library molecule to form a library-scraper complex (500) with two notches. The library molecule (100) contains a target sequence (110) top-mounted with a first left universal adaptor sequence (120) and a second left universal adaptor sequence (140) on one side, and top-mounted with a second right universal adaptor sequence (150) and a first right universal adaptor sequence (130) on the other side. The double-stranded clip molecule contains a first clip chain (long chain (300)) that hybridizes with a second clip chain (short chain (400)). The first clip chain contains a first region (320) that hybridizes with a sequence at one end of the linear single-stranded library molecule and a second region (330) that hybridizes with a sequence at the other end of the linear single-stranded library molecule. The inner region (310) of the first clip chain hybridizes with the second clip chain (400).

[0111] Figure 5This is a schematic diagram illustrating the hybridization of an exemplary linear single-stranded library molecule (100) with a double-stranded clip molecule (200), thereby circulating the library molecule to form a library-scraper complex (500) with two notches. The library molecule (100) comprises: a first left universal adaptor sequence (120); a first left unique identifier sequence (180); a first left index sequence (160); a second left universal adaptor sequence (140); a target sequence (110); a second right universal adaptor sequence (150); a first right index sequence (170); and a first right universal adaptor sequence (130). The double-stranded clip molecule comprises a first clip chain (long chain (300)) that hybridizes with a second clip chain (short chain (400)). The first clip chain comprises a first region (320) that hybridizes with a sequence at one end of the linear single-stranded library molecule and a second region (330) that hybridizes with a sequence at the other end of the linear single-stranded library molecule. The internal region (310) of the first clamp chain hybridizes with the second clamp chain (400).

[0112] Figure 6 This is a schematic diagram illustrating the hybridization of an exemplary linear single-stranded library molecule (100) with a double-stranded clip molecule (200), thereby circulating the library molecule to form a library-scraper complex (500) with two notches. The library molecule (100) comprises: a first left universal adaptor sequence (120); a first left index sequence (160); a second left universal adaptor sequence (140); a target sequence (110); a second right universal adaptor sequence (150); a first right index sequence (170); a first right unique identifier sequence (190); and a first right universal adaptor sequence (130). The double-stranded clip molecule comprises a first clip chain (long chain (300)) that hybridizes with a second clip chain (short chain (400)). The first clip chain comprises a first region (320) that hybridizes with a sequence at one end of the linear single-stranded library molecule and a second region (330) that hybridizes with a sequence at the other end of the linear single-stranded library molecule. The internal region (310) of the first clamp chain hybridizes with the second clamp chain (400).

[0113] Figure 7This is a schematic diagram illustrating the hybridization of an exemplary linear single-stranded library molecule (100) with a double-stranded splice molecule (200), thereby circulating the library molecule to form a library-sponge complex (500) with two notches. The library molecule (100) comprises: a first additional left universal connective sequence (121); a first left universal connective sequence (120); a first left-conjugating connective sequence (125); a first left index sequence (160); a second left-conjugating connective sequence (165); a second left universal connective sequence (140); a third left-conjugating connective sequence (145); a target sequence (110); a third right-conjugating connective sequence (155); a second right universal connective sequence (150); a second right-conjugating connective sequence (175); a first right index sequence (170); a first right-conjugating connective sequence (135); a first right universal connective sequence (130); and a first additional right universal connective sequence (131). The double-stranded splint molecule comprises a first splint chain (long chain (300)) that hybridizes with a second splint chain (short chain (400)). The first splint chain comprises a first region (320) that hybridizes with a sequence at one end of the linear single-stranded library molecule and a second region (330) that hybridizes with a sequence at the other end of the linear single-stranded library molecule. An inner region (310) of the first splint chain hybridizes with the second splint chain (400). For simplicity, no connecting linker sequence or additional universal connecting linker sequence is shown in the library-splice complex (500). Those skilled in the art will recognize that the linear library molecule (100) may include any combination of any one or two or more connecting linkers, with or without one or both of the additional universal connecting linker sequences present in the library molecule (100). Those skilled in the art will recognize that the library-splice complex (500) may include any combination of any one or two or more connecting linkers, with or without one or both of the additional universal connecting linker sequences present in the library molecule (100).

[0114] Figure 8Three schematic diagrams of exemplary covalently closed circular library molecules are shown, each hybridizing with a first splint chain (300). The top schematic diagram shows a covalently closed circular library molecule (600) having a target sequence (110), a first right universal adaptor sequence (130), a second splint chain sequence (400), and a first left universal adaptor sequence (120). The middle schematic diagram shows a covalently closed circular library molecule (600) having a target sequence (110), a second right universal adaptor sequence (150), a first right universal adaptor sequence (130), a second splint chain sequence (400), a first left universal adaptor sequence (120), and a second left universal adaptor sequence (140). The bottom schematic shows a covalently closed circular library molecule (600) having a target sequence (110), a second right universal linker sequence (150), a first right index sequence (170), a first right universal linker sequence (130), a second splint chain sequence (400), a first left universal linker sequence (120), a first left unique identifier sequence (180), a first left index sequence (160), and a second left universal linker sequence (140).

[0115] Figure 9 This is a schematic diagram illustrating an exemplary library-sandwich complex undergoing a ligation reaction to close the gap, forming a covalently closed cyclic library molecule (600), which hybridizes with a first sandwich chain (300), wherein the first sandwich chain (300) is used as an amplification primer for rolling circle amplification. Dashed lines represent newly formed extension products.

[0116] Figure 10 The nucleotide sequence of an exemplary double-stranded sandwich molecule (200) having a first sandwich chain (300) and a second sandwich chain (400) is shown. The exemplary first sandwich chain comprises a first region (320; SEQ ID NO:4), a second region (330; SEQ ID NO:5), and an internal region (310) having a fourth sub-region (SEQ ID NO:6) and a fifth sub-region (SEQ ID NO:7). The exemplary second sandwich chain (400) comprises a first sub-region (SEQ ID NO:1) and a second sub-region (SEQ ID NO:2).

[0117] Figure 11 This is a schematic diagram of an exemplary low-binding support comprising a glass substrate and alternating hydrophilic coatings covalently or non-covalently adhered to the glass, and further comprising chemically reactive functional groups (e.g., trapping and cyclizing oligonucleotides) serving as attachment sites for oligonucleotide primers. In alternative embodiments, the support may be made of any material, such as glass, plastic, or polymeric materials.

[0118] Figure 12These are schematic diagrams of various exemplary configurations of multivalent molecules. Left: Schematic diagram of a multivalent molecule with a starburst or helter-skelter configuration. Center: Schematic diagram of a multivalent molecule with a dendritic configuration. Right: Schematic diagram of multiple multivalent molecules formed by reacting streptavidin with 4-arm or 8-arm PEG-NHS, biotin, and dNTPs. Nucleotide units are labeled 'N', biotin is labeled 'B', and streptavidin is labeled 'SA'.

[0119] Figure 13 This is a schematic diagram of an exemplary multivalent molecule comprising a universal core attached to multiple nucleotide arms.

[0120] Figure 14 This is a schematic diagram of an exemplary multivalent molecule comprising a dendritic polymer core attached to multiple nucleotide arms.

[0121] Figure 15 A schematic diagram of an exemplary multivalent molecule is shown, comprising a core attached to multiple nucleotide arms, wherein the nucleotide arms include biotin, spacer groups, linkers, and nucleotide units.

[0122] Figure 16 It is a schematic diagram of an exemplary nucleotide arm that includes a core attachment portion, a spacer, a linker, and a nucleotide unit.

[0123] Figure 17 The chemical structures of exemplary spacer groups are shown (top) and the chemical structures of various exemplary connectors, including 11-atom connectors, 16-atom connectors, 23-atom connectors and N3 connectors (bottom).

[0124] Figure 18 The chemical structures of various exemplary connectors are shown, including connectors 1-9.

[0125] Figure 19 The chemical structures of various exemplary linkers that connect / attach to nucleotide units are shown.

[0126] Figure 20 The chemical structures of various exemplary linkers that connect / attach to nucleotide units are shown.

[0127] Figure 21 The chemical structures of various exemplary linkers that connect / attach to nucleotide units are shown.

[0128] Figure 22 The chemical structure of an exemplary biotinylated nucleotide arm is shown. In this example, the nucleotide unit is connected to the linker via a propargylamine attachment at the 5-position of the pyrimidine base or the 7-position of the purine base.

[0129] Figures 23A-23FTable 1 (of 6) lists the sequences of the exemplary first left index sequence (160) and the first right index sequence (170).

[0130] Figure 24 This is a bar graph showing the average percentage recovery of covalently closed circular libraries of input DNA from different species, as determined by qPCR. Lane 1: Haemophilus influenzae (38% GC); Lane 2: Escherichia coli (51% GC); Lane 3: Rhodopseudomonas palustris (65% GC); Lane 4: PhiX; Lane 5: Human; Lane 6: Human exome; Lane 7: Human mRNA. See Examples 1-3.

[0131] Figure 25 This is a bar chart showing the average polymerase clonal density, obtained by distributing covalently closed circular library molecules onto a support and performing rolling circle amplification on the support. The covalently closed circular library molecules were prepared from input DNA from different species. Lane 1: Cell-free DNA; Lane 2: E. coli; Lane 3: Human; Lane 4: Metagenomic DNA; Lane 5: PhiX. See Example 4.

[0132] Figure 26 This is a graph showing the nucleotide base diversity of the right sample index sequence (170), which includes the trimeric random sequence (NNN). The graph shows that the nucleotide diversity of the trimeric random sequence (NNN) recognized by A and T bases is approximately 30%, and the nucleotide diversity of the nucleotides recognized by C and G bases is approximately 20%.

[0133] Figure 27 This is a graph showing the nucleotide base diversity of the left sample index sequence (160) lacking the trimeric random sequence (NNN). The graph shows that the nucleotide diversity for A and T base recognition is approximately 40%, for C base recognition is approximately 15%, and for G base recognition is approximately 5%. DETAILED DESCRIPTION

[0134] Throughout this application, various publications, patents, and / or patent applications have been cited. The disclosures of these publications, patents, and / or patent applications are hereby incorporated, in their entirety, by reference in order to provide a more comprehensive description of the current state of the art to which this disclosure pertains.

[0135] definition:

[0136] The headings provided herein are not intended to limit the various aspects of this disclosure, which can be understood by referring to the specification as a whole.

[0137] Unless otherwise defined, the technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art. Generally, terms related to the techniques of molecular biology, nucleic acid chemistry, protein chemistry, genetics, microbiology, transgenic cell production, and hybridization described herein are those well-known and commonly used in the art. The techniques and procedures described herein are generally performed according to conventional methods well-known in the art and as described in the various general and more specific references cited and discussed throughout this specification. For example, see Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 2000). See also Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992). The nomenclature used in conjunction with the laboratory procedures and techniques described herein is those well-known and commonly used in the art.

[0138] Unless the context otherwise requires, singular terms shall include the plural, and plural terms shall include the singular. The singular forms “a,” “one,” and “the,” as well as the singular use of any word, shall include the plural referent unless explicitly and unambiguously limited to one referent.

[0139] It should be understood that the use of alternative terms (e.g., "or") is considered to refer to one or both of the alternatives or any combination thereof.

[0140] The term “and / or” as used herein should be considered as referring to a specific disclosure of each of the specified features or components, whether or not they are together with another. For example, the term “and / or” as used in phrases such as “A and / or B” herein is intended to include: “A and B”; “A or B”; “A” (A only); and “B” (B only). Similarly, the term “and / or” as used herein, such as “A, B and / or C”, is intended to cover each of the following aspects: “A, B and C”; “A, B or C”; “A or C”; “A or B”; “B or C”; “A and B”; “B and C”; “A and C”; “A” (A only); “B” (B only); and “C” (C only).

[0141] As used herein and in the appended claims, the terms “comprising,” “including,” “having,” and “containing,” and their grammatical variations, are intended to be non-limiting, such that one or more items in the list do not exclude other items that may be substituted for or added to the listed items. It should be understood that whenever an aspect is described herein with the language “comprising,” similar aspects described as “consisting of” and / or “substantially consisting of” are also provided in other ways.

[0142] As used herein, the terms “about” and “approximately” mean a value or composition within an acceptable error range for a particular value or composition, as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined, i.e., the limitations of the measurement system. For example, according to practice in the art, “about” or “approximately” may mean within one or more standard deviations. Alternatively, “about” or “approximately” may mean a range of up to 10% (i.e., ±10%) or greater, depending on the limitations of the measurement system. For example, about 5 mg may include any amount between 4.5 mg and 5.5 mg. Furthermore, particularly for biological systems or processes, these terms may mean a value of up to one order of magnitude or up to five times. When a particular value or composition is provided in this disclosure, unless otherwise stated, the meaning of “about” or “approximately” should be assumed to be within an acceptable error range for that particular value or composition. Furthermore, in the case of providing ranges and / or subranges of values, said ranges and / or subranges may include the endpoints of said ranges and / or subranges.

[0143] The terms “peptide,” “polypeptide,” and “protein,” as used herein, and other related terms, are used interchangeably and refer to polymers of amino acids and are not limited to any particular length. Polypeptides can contain both natural and non-natural amino acids. Polypeptides include recombinant or chemically synthesized forms. Polypeptides also include precursor molecules that have not undergone post-translational modifications, such as protein hydrolysis, cleavage due to ribosome jumping, hydroxylation, methylation, esterification, acetylation, ubiquitination, glycosylation, phosphorylation, and / or disulfide bond formation. These terms encompass natural and artificial proteins, protein fragments and polypeptide analogs (e.g., mutant proteins, variants, chimeric proteins, and fusion proteins), and proteins that are post-translationally or otherwise covalently or non-covalently modified.

[0144] The term "cellular biological sample" refers to a section of a single cell, multiple cells, tissue, organ, organism, or any of these cellular biological samples. Cellular biological samples can be extracted from an organism (e.g., by biopsy) or obtained from cell cultures grown in liquid or in petri dishes. Cellular biological samples can be fresh, frozen, fresh-frozen, or archived (e.g., formalin-fixed paraffin-embedded; FFPE). Cellular biological samples can be embedded in wax, resin, epoxy resin, or agar. Cellular biological samples can be fixed in any one or more of, such as acetone, ethanol, methanol, formaldehyde, paraformaldehyde-triton, or glutaraldehyde. Cellular biological samples can be sectioned or unsectioned. Cellular biological samples can be stained, destained, or unstained.

[0145] Desired nucleic acids can be extracted from cells or cellular biological samples using any of a variety of techniques known to those skilled in the art. For example, a typical DNA extraction procedure includes: (i) collecting a cell or tissue sample from which DNA is to be extracted; (ii) disrupting the cell membrane (i.e., cell lysis) to release DNA and other cytoplasmic components; (iii) treating the dissolved sample with a concentrated salt solution to precipitate proteins, lipids, and RNA, followed by centrifugation to separate the precipitated proteins, lipids, and RNA; and (iv) purifying the DNA from the supernatant to remove detergents, proteins, salts, or other reagents used during cell membrane lysis. A variety of suitable commercial nucleic acid extraction and purification kits are consistent with the disclosure herein. Examples include, but are not limited to: the QIAamp kit (for isolating genomic DNA from human samples) and the DNAeasy kit (for isolating genomic DNA from animal or plant samples) from Qiagen (Germantown, MD), or the Promega kit (Madison, WI). and ReliaPrep TM Series of reagent kits.

[0146] As used herein, the term "polymerase" and its variants encompass an enzyme containing a domain that binds a nucleotide (or nucleoside), wherein the polymerase can form a complex having a template nucleic acid and a complementary nucleotide. A polymerase may have one or more activities, including but not limited to: base analog detection activity, DNA polymerization activity, reverse transcriptase activity, DNA binding, strand substitution activity, and nucleotide binding and recognition. A polymerase can be any enzyme capable of catalyzing the polymerization of nucleotides (including their analogs) into a nucleic acid chain. Typically, but not necessarily, such nucleotide polymerization can occur in a template-dependent manner. Typically, a polymerase contains one or more active sites thereon where catalytic action can occur for nucleotide binding and / or nucleotide polymerization. In some embodiments, the polymerase includes other enzymatic activities, such as, for example, 3' to 5' exonuclease activity or 5' to 3' exonuclease activity. In some embodiments, the polymerase has strand substitution activity. Polymerases may include, but are not limited to: naturally occurring polymerases and any subunits and truncated forms thereof, mutant polymerases, variant polymerases, recombinant, fusion, or otherwise engineered polymerases, chemically modified polymerases, synthetic molecules or assemblies, and any analogs, derivatives, or fragments thereof (e.g., catalytically active fragments) that retain the ability to catalyze nucleotide polymerization. Polymerases include catalytically inactive polymerases, catalytically active polymerases, reverse transcriptases, and other enzymes containing nucleotide-binding domains. In some embodiments, polymerases may be isolated from cells or generated using recombinant DNA technology or chemical synthesis methods. In some embodiments, polymerases may be expressed in prokaryotes, eukaryotes, viruses, or bacteriophages. In some embodiments, polymerases may be post-translational modified proteins or fragments thereof. Polymerases may be derived from prokaryotes, eukaryotes, viruses, or bacteriophages. Polymerases include DNA-directed DNA polymerases and RNA-directed DNA polymerases.

[0147] The term "strand displacement" refers to the ability of a polymerase to locally separate double-stranded nucleic acid strands and synthesize a new strand in a template-based manner. Strand displacement polymerases replace the complementary strand from the template strand and catalyze the synthesis of the new strand. Strand displacement polymerases include room-temperature and thermophilic polymerases. Strand displacement polymerases include wild-type enzymes and variants (including exonuclease subtraction mutants, mutant versions, chimeric enzymes, and truncated enzymes). Examples of strand displacement polymerases include phi29 DNA polymerase, large fragment Bst DNA polymerase, large fragment Bsu DNA polymerase (exo-), Bca DNA polymerase (exo-), the Klenow fragment of E. coli DNA polymerase, T5 polymerase, M-MuLV reverse transcriptase, HIV reverse transcriptase, Deep Vent DNA polymerase, and KOD DNA polymerase. The phi29 DNA polymerase can be a wild-type phi29 DNA polymerase (e.g., MagniPhi from Expedeon), a variant EquiPhi29 DNA polymerase (e.g., from Thermo Fisher Scientific), or a chimeric QualiPhi DNA polymerase (e.g., from 4basebio).

[0148] The terms “nucleic acid,” “polynucleotide,” and “oligonucleotide,” as used herein, and other related terms, are used interchangeably and refer to nucleotide polymers and are not limited to any particular length. Nucleic acids include recombinant and chemically synthesized forms. Nucleic acids can be isolated. Nucleic acids include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), DNA or RNA analogs generated using nucleotide analogs (e.g., peptide nucleic acids and non-naturally occurring nucleotide analogs), and chimeric forms containing DNA and RNA. Nucleic acids can be single-stranded or double-stranded. Nucleic acids comprise polymers of nucleotides, wherein the nucleotides comprise natural or non-natural bases and / or sugars. Nucleic acids contain naturally occurring nucleoside bonds, such as phosphodiester bonds. Nucleic acids contain non-natural nucleoside bonds, including thiophosphate, thiol phosphate, or peptide nucleic acid (PNA) bonds. In some embodiments, nucleic acids comprise one type of polynucleotide or a mixture of two or more different types of polynucleotides.

[0149] As used herein, the terms “operably linked” and “operably conjoined” or related terms refer to the juxtaposition of components. The juxtaposed components may be covalently linked together. For example, two nucleic acid components may be enzymatically linked together, wherein the bond conjoining the two components comprises a phosphodiester bond. First and second nucleic acid components may be linked together, wherein the first nucleic acid component may confer function to the second nucleic acid component. For example, a link between a primer-binding sequence and a target sequence forms a nucleic acid library molecule having a primer-binding portion. In another example, a transgene (e.g., a nucleic acid encoding a polypeptide or a target nucleic acid sequence) may be linked to a vector, wherein the link allows the transgene sequence contained in the vector to be expressed or function. In some embodiments, the transgene is operably linked to a host cell regulatory sequence (e.g., a promoter sequence) that affects transgene expression. In some embodiments, the vector contains at least one host cell regulatory sequence, including a promoter sequence, an enhancer, a transcription and / or translation initiation sequence, a transcription and / or translation termination sequence, a polypeptide secretion signaling sequence, and so on. In some embodiments, the host cell regulatory sequence controls the level, timing, and / or location of transgene expression.

[0150] The terms “linked,” “joined,” “attached,” “attached,” and variations thereof encompass any type of fusion, bonding, adhesion, or association between any combination of compounds or molecules, possessing sufficient stability to withstand use in a particular procedure. This procedure may include, but is not limited to: nucleotide binding; nucleotide incorporation; deblocking (e.g., removal of chain terminations); washing; removal; flow; detection; imaging and / or recognition. For example, such bonds may include: covalent bonds, ionic bonds, hydrogen bonds, dipole-dipole bonds, hydrophilic bonds, hydrophobic bonds, or affinity bonds, bonds or associations involving van der Waals forces, mechanical bonds, and so on. In some embodiments, such bonds occur intramolecularly, for example, linking the ends of single-stranded or double-stranded linear nucleic acid molecules together to form a cyclic molecule. In some embodiments, such connections may occur between combinations of different molecules, or between molecules and non-molecules, including, but not limited to: bonds between nucleic acid molecules and solid surfaces; bonds between proteins and detectable reporter moieties; bonds between nucleotides and detectable reporter moieties; and so on. Some examples of the key can be found in, for example, the following literature: Hermanson, G., “Bioconjugate Techniques”, 2nd edition (2008); Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences”, London: Macmillan (1998); Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences”, London: Macmillan (1998).

[0151] As used herein, the term "primer" and related terms refer to oligonucleotides capable of hybridizing with DNA and / or RNA polynucleotide templates to form double-stranded molecules. Primers may be single-stranded along their entire length or have both single-stranded and double-stranded portions. Primers comprise native nucleotides and / or nucleotide analogs. Primers may be recombinant nucleic acid molecules. Primers may have any length, but typically range from 4 to 50 nucleotides. Typical primers contain a 5' end and a 3' end. The 3' end of a primer may include a 3'OH portion that acts as the initiation site for nucleotide polymerization in a polymerase-catalyzed primer extension reaction. Alternatively, the 3' end of a primer may lack the 3'OH portion, or may include a terminal 3' blocking group that inhibits nucleotide polymerization in a polymerase-catalyzed reaction. Any nucleotide or more along the length of the primer may be labeled with a detectable reporter moiety. Primers may be in solution (e.g., soluble primers) or may be immobilized to a support (e.g., capture primers).

[0152] The terms “template nucleic acid,” “template polynucleotide,” “target nucleic acid,” “target polynucleotide,” “template strand,” and other variations refer to the nucleic acid strand used as the base nucleic acid molecule in any amplification and / or sequencing method described herein. The template nucleic acid can be single-stranded or double-stranded, or may have single-stranded or double-stranded portions. The template nucleic acid can be obtained from naturally occurring sources, recombinant forms, or through chemical synthesis to include any type of nucleic acid analogue. The template nucleic acid can be linear, multiplicative, circular, or other forms.

[0153] The term "adaptor" and related terms refer to an oligonucleotide that can be operatively linked (attached) to a target polynucleotide, wherein the adaptor confers function upon co-conjugation of the adaptor-target molecule. Adaptors comprise DNA, RNA, chimeric DNA / RNA, or analogs thereof. Adaptors may include at least one ribonucleoside residue. Adaptors may be single-stranded, double-stranded, or have single-stranded and / or double-stranded portions. Adaptors may be configured as linear, stem-loop, hairpin, or Y-shaped. Adaptors can be of any length, including 4-100 nucleotides or longer. Adaptors may have blunt ends, overhanging ends, or a combination of both. Overhanging ends include 5' and 3' overhangs. The 5' end of one strand of a single-stranded or double-stranded adaptor may have a 5' phosphate group or lack a 5' phosphate group. Adaptors may include a 5' tail that does not hybridize with the target polynucleotide (e.g., a tailed adaptor), or the adaptor may be tailless. At least a portion of the adaptor contains a known and predetermined sequence. The adaptor may include a sequence complementary to at least a portion of a primer, such as an amplification primer, sequencing primer, or capture primer (e.g., a soluble or immobilized capture primer). The adaptor may include a random or degenerate sequence. The adaptor may include at least one inosine residue. The adaptor may include at least one thiophosphate, thiophosphate, and / or phosphoramide bond. The adaptor may include at least one barcode / index sequence that can be used to distinguish polynucleotides from different sample sources in multiplex assays (e.g., insert sequences). The adaptor may include at least one unique identification sequence (e.g., a molecular identifier) ​​that can be used to uniquely identify the nucleic acid molecule to which the adaptor is attached. In some embodiments, the unique identification sequence comprises 2-12 or more nucleotides having a known sequence. For example, the unique identification sequence comprises a known random sequence, wherein the nucleotides at each position are randomly selected from nucleotides having the bases A, G, C, T, or U. The adaptor may include at least one restriction enzyme recognition sequence, including any one or any combination of two or more selected from the group consisting of type I, type II, type III, type IV, Hs, or IIB.

[0154] The term "universal sequence" and related terms refer to a sequence in a nucleic acid molecule that is common to two or more polynucleotide molecules. For example, an adaptor with a universal sequence can be operatively bound to multiple polynucleotides, such that a co-bound population of molecules carries the same universal adaptor sequence. Examples of universal adaptor sequences include amplification primer sequences, sequencing primer sequences, or capture primer sequences (e.g., soluble or immobilized capture primers).

[0155] When used to refer to nucleic acid molecules, the term "hybridization" or other related terms refers to the hydrogen bonding between two different nucleic acids to form a double-stranded nucleic acid. Hybridization also includes the hydrogen bonding between two different regions of a single nucleic acid molecule to form a self-hybridized molecule with double-stranded regions. Hybridization can include Watson-Crick or Hoogstein bonding to form double-stranded nucleic acids or double-stranded regions within a nucleic acid molecule. The two different regions of a double-stranded nucleic acid or a single nucleic acid can be completely complementary or partially complementary. Complementary nucleic acid strands do not need to hybridize to each other across their entire length. Complementary base pairing can be standard AT or CG base pairing, or it can be other forms of base pairing interactions. Double-stranded nucleic acids can include mismatched base-paired nucleotides.

[0156] When used to refer to nucleic acids, the terms "extend," "extending," and other variations refer to the incorporation of one or more nucleotides into a nucleic acid molecule. Nucleotide incorporation involves the polymerization of one or more nucleotides into the terminal 3'OH end of the nucleic acid chain, resulting in the extension of the nucleic acid chain. Nucleotide incorporation can be performed using native nucleotides and / or nucleotide analogs. Typically, but not always, nucleotide incorporation occurs in a template-dependent manner. Any suitable method for extending nucleic acid molecules can be used, including primer extension catalyzed by DNA polymerase or RNA polymerase.

[0157] The term "nucleotide" and related terms refer to a molecule comprising an aromatic base, a pentose sugar (e.g., ribose or deoxyribose), and at least one phosphate ester group. Regular or irregular nucleotides are used in accordance with this term. In some embodiments, a nucleotide comprises a monophosphate, diphosphate, or triphosphate, or a corresponding phosphate analog. The term "nucleoside" refers to a molecule comprising an aromatic base and a sugar. Nucleotides and nucleosides may be unlabeled or labeled with a detectable reporting portion.

[0158] Nucleotides (and nucleosides) typically contain heterocyclic bases, including substituted or unsubstituted nitrogen-containing parent heteroaromatic rings, commonly found in nucleic acids, including naturally occurring, substituted, modified, or engineered variants or analogues thereof. The bases of nucleotides (or nucleosides) are capable of forming Watson-Crick and / or Hoogstein hydrogen bonds with suitable complementary bases. Exemplary bases include, but are not limited to, purines and pyrimidines, such as 2-aminopurine, 2,6-diaminopurine, adenine (A), ethylene adenine, N... 6 -Δ 2 -Isopentenyladenine (6iA), N 6 -Δ 2 -Isopentenyl-2-methylthioadenine (2ms6iA), N 6 -Methyladenine, guanine (G), isoguanine, N 2 -Dimethylguanine (dmG), 7-methylguanine (7mG), 2-thiopyrimidine, 6-thioguanine (6sG), hypoxanthine and O 6 -Methylguanine; 7-denitropurines, such as 7-denitroadenine (7-denitro-A) and 7-denitroguanine (7-denitro-G); pyrimidines, such as cytosine (C), 5-propynylcytosine, isocytosine, thymine (T), 4-thiothymine (4sT), 5,6-dihydrothymine, O 4 -Methylthymine, uracil (U), 4-thiouracil (4sU), and 5,6-dihydrouracil (dihydrouracil; D); indoles, such as nitroindole and 4-methylindole; pyrroles, such as nitropyrrole; muscarin; inosines; hydroxymethylcytosines; 5-methylcytosines; bases (Y); and methylated, glycosylated, and acylated base moieties; etc. Further exemplary bases can be found in Fasman, 1989, in “Practical Handbook of Biochemistry and Molecular Biology”, pp. 385–394, CRC Press, Boca Raton, Fla.

[0159] Nucleotides (and nucleosides) typically contain sugar moieties such as carbocyclic moieties (Ferraro and Gotor 2000 Chem. Rev. 100: 4319-48), acyclic moieties (Martinez et al., 1999 Nucleic Acids Research 27: 1271-1274; Martinez et al., 1997 Bioorganic & Medicinal Chemistry Letters Vol. 7: 3013-3016) and other sugar moieties (Joeng et al., 1993 J. Med. Chem. 36: 2627-2638; Kim et al., 1993 J. Med. Chem. 36: 30-7; Eschenmosser 1999 Science 284: 2118-2124; and U.S. Patent No. 5,558,991). The sugar moiety includes: ribosyl; 2'-deoxyribosyl; 3'-deoxyribosyl; 2',3'-dideoxyribosyl; 2',3'-didehydrodideoxyribosyl; 2'-alkoxyribosyl; 2'-azidoribosyl; 2'-aminoribosyl; 2'-fluororibosyl; 2'-mercaptoribosyl; 2'-alkylthioribosyl; 3'-alkoxyribosyl; 3'-azidoribosyl; 3'-aminoribosyl; 3'-fluororibosyl; 3'-mercaptocarboxyl; 3'-alkylthioribosyl carbocyclic; acyclic or otherwise modified sugars.

[0160] In some embodiments, the nucleotide comprises a chain having one, two, or three phosphorus atoms, wherein the chain is typically attached to the 5' carbon of the sugar moiety via an ester bond or a phosphoramide bond. In some embodiments, the nucleotide is an analogue having a phosphorus chain, wherein the phosphorus atoms are linked together by intercalating O, S, NH, methylene, or ethylene. In some embodiments, the phosphorus atom in the chain comprises a substituted side group, including O, S, or BH3. In some embodiments, the chain comprises a phosphate ester group substituted with an analogue, including phosphoramide, thiophosphate, dithiophosphate, and O-methylphosphoramide.

[0161] The term "rolling circle amplification" generally refers to an amplification method that employs a circularized nucleic acid template molecule containing a target sequence, an amplification primer-binding sequence, and optionally one or more adaptor sequences, such as sequencing primer-binding sequences and / or sample index sequences. Rolling circle amplification reactions can be performed under isothermal amplification conditions and include a circularized nucleic acid template molecule, amplification primers, a strand displacement polymerase, and multiple nucleotides to generate multiplexes containing tandem repeat sequences of the circular template molecule and any adaptor sequences present in the original circularized nucleic acid template molecule. The multiplexes can self-collapse to form nucleic acid nanospheres. The shape and size of the nanospheres can be further compressed by including a pair of inverted repeat sequences in the circular template molecule, or by performing rolling circle amplification with one or more compacted oligonucleotides. One advantage of using rolling circle amplification to generate clonal amplicones for sequencing workflows is that repetitive copies of the target sequence in the nanospheres can be sequenced simultaneously to increase signal strength. In some embodiments, rolling circle amplification reactions can be performed in the presence of multiple compactions having at least four consecutive guanines. The rolling circle amplification reaction generates multiplexes containing repetitive copies of a universal binding sequence for the compacted oligonucleotide. At least one compacted oligonucleotide can form a guanine tetramer and hybridize with a universal binding sequence for the compacted oligonucleotide, and the resulting polymer can fold to form an intramolecular G-quadruplex structure. The polymer can self-collapse to form a compact nanosphere. The formation of the guanine tetramer and G-quadruplex within the nanosphere increases its stability, maintaining its compact size and shape, thus allowing it to withstand repeated flowes of reagents used in any of the sequencing workflows described herein.

[0162] When used to refer to nucleic acids, the terms "amplify," "amplifying," and other related terms include generating multiple copies of the original polynucleotide template molecule, wherein the copies contain sequences complementary to the template sequence, and / or the copies contain sequences identical to the template sequence. In some embodiments, the copies contain sequences substantially identical to the template sequence, and / or sequences substantially identical to sequences complementary to the template sequence.

[0163] The term "reporter moiety" or related terms refers to a compound that generates or causes a detectable signal. A reporter moiety is sometimes referred to as a "label." Any suitable reporter moiety can be used, including luminescence, photoluminescence, electroluminescence, bioluminescence, chemiluminescence, fluorescence, phosphorescence, chromophores, radioisotopes, electrochemistry, mass spectrometry, Raman spectroscopy, haptens, affinity markers, atoms, or enzymes. A reporter moiety generates a detectable signal caused by a chemical or physical change (e.g., heat, light, electricity, pH, salt concentration, enzyme activity, or proximity events). Proximity events include two reporter mocies that are close to, associate with, or bind to each other. Those skilled in the art are well aware of the selection of reporter mocies such that each absorbs excitation radiation and / or emits fluorescence at a wavelength distinguishable from other reporter mocies, allowing for the monitoring of the presence of different reporter mocies in the same or different reactions. Two or more different reporter mocies with spectrally distinct emission profiles or with minimal overlap spectral emission profiles can be selected. The reporting portion may be linked (e.g., operatively linked) to nucleotides, nucleosides, nucleic acids, enzymes (e.g., polymerases or reverse transcriptases) or supports (e.g., surfaces).

[0164] The fluorescent reporting section (or label) contains fluorescent labels or fluorophores. Exemplary fluorescent portions that can be used as fluorescent markers or fluorophores include, but are not limited to, fluoresceins and fluorescein derivatives, such as carboxyfluorescein, tetrachlorofluorescein, hexachlorofluorescein, carboxynaphthol fluorescein, isothiocyanate fluorescein, NHS-fluorescein, iodoacetamide-fluorescein, maleimide fluorescein, SAMSA-fluorescein, aminothiourea fluorescein, hydrazine methylthioacetamide fluorescein; rhodamine and rhodamine derivatives, such as TRITC, TMR, rhodamine sulfonyl chloride, Texas red, rhodamine B, rhodamine 6G, rhodamine 10, NHS-rhodamine, TMR-iodoacetamide, rhodamine sulfonyl chloride, rhodamine sulfonyl hydrazide, Texas red sulfonyl chloride, Texas red hydrazide; coumarins and coumarin derivatives, such as AMCA, AMCA-NHS, AMCA-sulfonyl-NHS, AMCA-HPDP, DCIA, AMCE-hydrazide; and BODIPY and its derivatives, such as BODIPY FL. C3-SE, BODIPY 530 / 550 C3, BODIPY530 / 550 C3-SE, BODIPY 530 / 550 C3 acylhydrazine, BODIPY 493 / 503 C3 acylhydrazine, BODIPY FL C3 acylhydrazine, BODIPY FL IA, BODIPY 530 / 551 IA, Br-BODIPY 493 / 503, Cascade Blue and its derivatives, such as Cascade Blue acetyltriazine, Cascade Blue cadaverine, Cascade Blue ethylenediamine, Cascade Blue acylhydrazine, Lucifer Yellow and its derivatives, such as Lucifer Yellow iodoacetamide, Lucifer Yellow CH, anthocyanins and their derivatives, such as indolonyl anthocyanin dyes, benzoindolonyl anthocyanin dyes, pyridiniumyl anthocyanin dyes, thiazolonyl anthocyanin dyes, quinolinelonyl anthocyanin dyes, imidazolonyl anthocyanin dyes, Cy 3. Cy5, lanthanide chelates and derivatives, such as BCPDA, TBP, TMT, BHHCT, BCOT, europium chelates, terbium chelates, Alexa Fluor dyes, DyLight dyes, Atto dyes, LightCycler Red dyes, CAL Flour dyes, JOE and its derivatives, Oregon Green dyes, WellRED dyes, IRD dyes, phycoerythrin and phycobilin dyes, malachite green, diphenylethylene, DEG dyes, NR dyes, near-infrared dyes and other dyes known in the art, such as Haugland, Molecular Probes Handbook, (Eugene, Oreg.) 6th edition;Lakowicz, Principles of Fluorescence Spectroscopy, 2nd edition, Plenum Press New York (1999) or Hermanson, Bioconjugate Techniques, 2nd edition, those described therein, or derivatives thereof;Or any combination thereof. Anthocyanin dyes may exist in sulfonated or non-sulfonated forms and consist of two pseudoindole, benzoindole, pyridinium, thiazolylium, and / or quinolineonium groups separated by a polymethystylene bridge between two nitrogen atoms. Commercially available anthocyanin fluorophores include, for example, Cy3 (which may contain 1-[6-(2,5-dioxopyrrolidone-1-yloxy)-6-oxohexyl]-2-(3-{1-[6-(2,5-dioxopyrrolidone-1-yloxy)-6-oxohexyl]-3,3-dimethyl-1,3-dihydro-2H-indol-2-ylidene}prop-1-en-1-yl)-3,3-dimethyl-3H-indolium or 1-[6-(2,5-dioxopyrrolidone-1-yloxy)-6-oxohexyl]-2-(3-{ ...3,3-dimethyl-1,3-dihydro-2H-indol-2-ylidene}prop-1-en-1-yl)-3,3-dimethyl-3H-indolium or 1-[6-(2,5-dioxopyrrolidone-1-yloxy)-6-oxohexyl]-2-(3-{1-[6-(2,5-dioxopyrrolidone-1-yloxy)-6-oxohexyl]-2-(3-{1-[6-(2,5-dioxopyrrolidone-1-yloxy)-6-oxohexyl]-2- [Oxypyrrolidone-1-yloxy)-6-oxohexyl]-3,3-dimethyl-5-sulfonyl-1,3-dihydro-2H-indole-2-ylide]prop-1-en-1-yl)-3,3-dimethyl-3H-indole-5-sulfonate), Cy5 (which may contain 1-(6-((2,5-dioxopyrrolidone-1-yl)oxy)-6-oxohexyl)-2-((1E,3E)-5-((E)-1-(6-((2,5-dioxopyrrolidone-1-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-indole-2-ylide) 1-(6-((2,5-dioxopyrrolidone-1-yl)oxy)-6-oxohexyl)-2-((1E,3E)-5-((E)-1-(6-((2,5-dioxopyrrolidone-1-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-sulfonylindole-2-yl)penta-1,3-diene-1-yl)-3,3-dimethyl-3H-indole-1-on-5-sulfonate) and Cy7 (which may contain 1-(5-carboxypentyl) Cy2 is an oxazole derivative rather than a pseudoindole, and the benzo-derived Cy3.5, Cy5.5, and Cy7.5 are exceptions to this rule.

[0165] In some embodiments, the reporting portion may be a fluorescence resonance energy transfer (FRET) pair, allowing for multiple classifications within a single excitation and imaging step. As used herein, FRET may comprise either excitation exchange (Forster) transfer or electron exchange (Dexter) transfer.

[0166] As used herein, the term "support" refers to a substrate designed for the deposition of biological molecules or biological samples for assays and / or analyses. Examples of biological molecules to be deposited onto a support include nucleic acids (e.g., DNA, RNA), peptides, carbohydrates, lipids, single cells, or multiple cells. Examples of biological samples include, but are not limited to, saliva, sputum, mucus, blood, plasma, serum, urine, feces, sweat, tears, and fluids from tissues or organs.

[0167] In some embodiments, the support is solid, semi-solid, or a combination of both. In some embodiments, the support is porous, semi-porous, non-porous, or any combination of porosities. In some embodiments, the support can be substantially planar, concave, convex, or any combination thereof. In some embodiments, the support can be cylindrical, for example, containing capillaries or the inner surface of capillaries.

[0168] In some embodiments, the surface of the support may be substantially smooth. In some embodiments, the support may have regular or irregular textures, including bumps, etched surfaces, holes, three-dimensional supports, or any combination thereof.

[0169] In some embodiments, the support comprises microbeads of any shape, including spherical, hemispherical, cylindrical, barrel-shaped, annular, disc-shaped, rod-shaped, conical, triangular, cubic, polygonal, tubular, or linear.

[0170] The support can be made of any material, including but not limited to: glass, fused silica, silicon, polymers (e.g., polystyrene (PS), macroporous polystyrene (MPPS), polymethyl methacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high-density polyethylene (HDPE), cyclic olefin polymers (COP), cyclic olefin copolymers (COC), polyethylene terephthalate (PET)) or any combination thereof. Various combinations of both glass and plastic substrates are contemplated.

[0171] This disclosure provides multiple (e.g., two or more) nucleic acid template molecules immobilized to a support. In some embodiments, the immobilized multiple nucleic acid template molecules have the same sequence or different sequences. In some embodiments, each of the multiple nucleic acid template molecules is immobilized to a different site on the support. In some embodiments, two or more of the multiple nucleic acid template molecules are immobilized to sites on the support.

[0172] The term "array" refers to a support containing a plurality of sites located at predetermined positions on a support to form an array of sites. The sites can be discrete and separated by interstitial space. In some embodiments, the predetermined sites on the support can be arranged in one-dimensional rows or columns, or in two-dimensional rows and columns. In some embodiments, the plurality of predetermined sites are arranged in an organized manner on the support. In some embodiments, the plurality of predetermined sites are arranged in any organized pattern, including straight lines, hexagonal patterns, grid patterns, patterns with reflective symmetry, patterns with rotational symmetry, etc. The spacing between different pairs of sites can be the same or different. In some embodiments, the support contains at least 10 2 At least 10 sites 3 At least 10 sites 4 At least 10 sites 5 At least 10 sites 6 At least 10 sites 7 At least 10 sites 8 At least 10 sites 9 At least 10 sites 10 At least 10 sites 11 At least 10 sites 12 At least 10 sites 13 At least 10 sites 14 At least 10 sites 15 One or more sites, wherein the sites are located at predetermined positions on the support. In some embodiments, a plurality of predetermined sites on the support (e.g., 10) 2 -10 15 Nucleic acid template molecules are immobilized at multiple sites (one or more) to form a nucleic acid template array. In some embodiments, nucleic acid template molecules are immobilized at multiple predetermined sites by hybridization with immobilized surface capture primers, or by covalently attaching nucleic acid template molecules to surface capture primers. In some embodiments, nucleic acid template molecules are immobilized at multiple predetermined sites, for example, at 10 sites. 2 -10 15Multiple sites or more. In some embodiments, a fixed nucleic acid template molecule is cloned and amplified to generate fixed nucleic acid clusters at multiple predetermined sites. In some embodiments, each fixed nucleic acid cluster comprises a linear cluster, or comprises single-stranded or double-stranded multiples.

[0173] In some embodiments, a support comprising a plurality of sites located at random positions on a support is referred herein to as a support having randomly positioned sites thereon. The positions of the randomly positioned sites on the support are not predetermined. These plurality of randomly positioned sites are arranged on the support in a disordered and / or unpredictable manner. In some embodiments, the support comprises at least 10 2 At least 10 sites 3 At least 10 sites 4 At least 10 sites 5 At least 10 sites 6 At least 10 sites 7 At least 10 sites 8 At least 10 sites 9 At least 10 sites 10 At least 10 sites 11 At least 10 sites 12 At least 10 sites 13 At least 10 sites 14 At least 10 sites 15 One or more sites, wherein the sites are randomly located on the support. In some embodiments, multiple randomly located sites on the support (e.g., 10) 2 -10 15 Nucleic acid template molecules are immobilized at multiple randomized sites (one or more). In some embodiments, the nucleic acid template molecules are immobilized at multiple randomly located sites by hybridization with immobilized surface capture primers, or by covalently linking the nucleic acid template molecules to surface capture primers. In some embodiments, the nucleic acid template is immobilized at multiple randomly located sites, for example, at 10 sites. 2 -10 15 At one or more sites. In some embodiments, a fixed nucleic acid template is cloned and amplified to generate fixed nucleic acid clusters at multiple randomly located sites. In some embodiments, each fixed nucleic acid cluster comprises a linear cluster, or comprises single-stranded or double-stranded multiples.

[0174] In some embodiments, a plurality of fixed surface capture primers on a support (e.g., located at predetermined or random positions on the support) are fluidly connected to each other to allow reagent solutions (e.g., nucleic acid template molecules, soluble primers, enzymes, nucleotides, divalent cations, buffers, etc.) to flow onto the support, such that the plurality of fixed surface capture primers on the support can react with the reagents substantially simultaneously in a large-scale parallel manner. In some embodiments, the fluid connectivity of the plurality of fixed surface capture primers can be used to perform nucleic acid amplification reactions (e.g., RCA, MDA, PCR, and bridge amplification) substantially simultaneously on the plurality of fixed surface capture primers.

[0175] In some embodiments, multiple immobilized nucleic acid clusters on a support are fluidly connected to each other to allow reagent solutions (e.g., enzymes, nucleotides, divalent cations, etc.) to flow onto the support, such that the multiple immobilized nucleic acid clusters on the support can react with the reagents substantially simultaneously in a massively parallel manner. In some embodiments, the fluid connectivity of the multiple immobilized nucleic acid clusters can be used to perform nucleotide binding assays and / or nucleotide polymerization reactions (e.g., primer extension or sequencing) substantially simultaneously on the multiple immobilized nucleic acid clusters, and optionally to perform detection and imaging of massively parallel sequencing.

[0176] In some embodiments, the term "fixed" and related terms refer to nucleic acid molecules attached to a support, or to a coating on a support, or embedded within a matrix formed by a coating on a support via covalent bonds or non-covalent interactions, wherein the nucleic acid molecules include surface capture primers, nucleic acid template molecules, and extension products of the capture primers. Extension products of the capture primers include nucleic acid multimers (e.g., nucleic acid clusters). Nucleic acid molecules may be fixed at predetermined or random locations on the support. Nucleic acid molecules may be fixed at predetermined or random locations on or within a passivated coating on the support.

[0177] In some embodiments, the term "fixed" and related terms refer to an enzyme (e.g., a polymerase) attached to a support, or to a coating on a support, or embedded within a substrate formed by a coating on a support via covalent bonds or non-covalent interactions. The enzyme may be fixed at predetermined or random locations on the support. The enzyme may be fixed at predetermined or random locations on or within a passivated coating on the support.

[0178] In some embodiments, one or more nucleic acid template molecules are immobilized on a support, for example, at sites on the support. In some embodiments, one or more nucleic acid template molecules are cloned and amplified. In some embodiments, one or more nucleic acid template molecules are cloned and amplified from a support (e.g., in solution), then deposited onto the support and immobilized. In some embodiments, the cloning and amplification reaction of one or more nucleic acid template molecules is performed on the support, resulting in immobilization on the support. In some embodiments, the cloning and amplification of one or more nucleic acid template molecules using nucleic acid amplification reactions (e.g., in solution or on a support) includes any one or any combination of the following: polymerase chain reaction (PCR), multiple displacement amplification (MDA), transcription-mediated amplification (TMA), sequence-based amplification (NASBA), strand displacement amplification (SDA), real-time SDA, bridging amplification, isothermal bridging amplification, rolling circle amplification (RCA), loop-to-loop amplification, helicase-dependent amplification, recombinase-dependent amplification, and / or single-strand-binding (SSB) protein-dependent amplification.

[0179] The term "surface primer" and related terms refer to a single-stranded oligonucleotide immobilized to a support and containing a sequence capable of hybridizing with at least a portion of a nucleic acid template molecule. Surface capture primers can be used to immobilize template molecules to a support via hybridization. Surface capture primers can be immobilized to the support in a manner resistant to primer removal during flow, washing, aspiration, and changes in temperature, pH, salt, chemical, and / or enzymatic conditions. Typically, but not necessarily, the 5' end of the surface capture primer can be immobilized to the support or a coating on the support (or embedded in a coating on the support). Alternatively, the internal portion or the 3' end of the surface capture primer can be immobilized to the support.

[0180] The sequence of the surface capture primer may be completely or partially complementary to at least a portion of the nucleic acid template molecule along its length. The support may include multiple fixed surface capture primers having the same sequence or having two or more different sequences. The surface capture primers may be of any length, such as 4-50 nucleotides, or 50-100 nucleotides, or 100-150 nucleotides, or longer.

[0181] Surface capture primers may have a terminal 3' nucleotide with a sugar 3'OH moiety that can be extended for nucleotide polymerization (e.g., polymerase-catalyzed polymerization). Surface capture primers may also have a terminal 3' nucleotide with a 3' sugar position connected to a chain-terminating moiety that inhibits nucleotide polymerization. The 3' chain-terminating moiety can be removed (e.g., deblocked) using a deblocking agent to convert the 3' end into an extendable 3'OH end. Examples of chain-terminating moieties include alkyl groups, alkenyl groups, alkynyl groups, allyl groups, aryl groups, benzyl groups, azido groups, amine groups, amide groups, ketol groups, isocyanate groups, phosphate groups, thio groups, disulfide groups, carbonate groups, urea groups, or silyl groups. Azide-type chain-terminating moieties include azido, azidoyl, and azidomethyl groups. Examples of deblocking agents include phosphine compounds, such as tris(2-carboxyethyl)phosphine (TCEP) and bissulfotriphenylphosphine (BS-TPP), for azide, azido, and azidomethyl chain-terminating groups. Examples of deblocking agents include tetra(triphenylphosphine)palladium(O) (Pd(PPh3)4) with piperidine, or with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ), for alkyl, alkenyl, alkynyl, and allyl chain-terminating groups. Examples of deblocking agents include Pd / C, for aryl and benzyl chain-terminating groups. Examples of deblocking agents include phosphine, β-mercaptoethanol, or dithiothreitol (DTT), for amine, amide, ketone, isocyanate, phosphate, thio, and dithioyl chain-terminating groups. Examples of deblocking agents include potassium carbonate (K2CO3) in MeOH, triethylamine in pyridine, and Zn in acetic acid (AcOH), for carbonate chain-terminating groups. Examples of deblocking agents include tetrabutylammonium fluoride, pyridine-HF, ammonium fluoride, and triethylamine trihydrofluoride, used for urea and silyl chain terminating groups.

[0182] The term "sequencing" and related terms refer to methods for obtaining nucleotide sequence information from nucleic acid molecules, typically by identifying at least some nucleotides (including their nucleobase composition) within the nucleic acid molecule. In some embodiments, sequence information for a given region of the nucleic acid molecule includes identifying each nucleotide within the sequenced region. In some embodiments, sequencing information identifies only some nucleotides in the region, while the identification of some nucleotides remains undetermined or incorrectly determined. Any suitable method for sequencing can be used. In exemplary embodiments, sequencing may include label-free or ion-based sequencing methods. In some embodiments, sequencing may include labeled or dye-containing nucleotide or fluorescence-based nucleotide sequencing methods. In some embodiments, sequencing may include polymerase cloning-based sequencing or bridge sequencing methods. In some embodiments, sequencing employs polymerases and multivalent molecules to generate at least one affinity complex, wherein each multivalent molecule contains multiple nucleotide units tethered to a core. In some embodiments, sequencing employs polymerases and free nucleotides for sequencing-by-synthesis. In some embodiments, sequencing employs ligases and multiple sequence-specific oligonucleotides for sequencing-by-ligation.

[0183] Brief introduction: Double-chain clamp connector

[0184] This disclosure provides compositions comprising a double-stranded nucleic acid clip initiator, including kits, and methods for employing the double-stranded clip initiator.

[0185] The double-stranded splint initiator (200) can be used in a one-pot multi-enzyme reaction to introduce one or more novel initiator sequences into a library molecule. The double-stranded splint initiator (200) comprises a first splint chain (long splint chain (300)) and a second splint chain (short splint chain (400)), wherein the first and second splint chains hybridize together to form the double-stranded splint initiator (200), which has a double-stranded region flanked by two single-stranded regions (e.g., see...). Figure 1-7 The second splint chain (400) carries a new linker sequence to be introduced, such as, for example, a new universal binding sequence and / or a new index sequence. The first splint chain comprises a first region (320), an inner region (310), and a second region (330). The inner region (310) of the first splint chain hybridizes with the second splint chain (400). The two side-connected single-stranded regions (e.g., (320) and (330)) of the double-stranded splint linker are designed to hybridize with the universal linker sequence at the end of a single-stranded linear library molecule (100) having the target sequence (110). For example, the first region (320) of the first splint chain hybridizes with one end of the library molecule, and the second region (330) of the first splint chain hybridizes with the other end of the library molecule, thereby circulating the library molecule to produce a library-splice complex (500) which includes two notches (e.g., see Figure 1-7The gap can be enzymatically ligated to generate a covalently closed circular molecule (600), in which a second splint chain (400) is covalently attached to the library molecule at both ends, thereby introducing a new adaptor sequence into the library molecule.

[0186] Therefore, the double-stranded clip adaptor and method described herein can be used to convert any linear library molecule into a covalently closed circular molecule, which can be used in different workflows, such as different massively parallel sequencing platforms. The double-stranded clip adaptor provides flexibility because the two side-attached single-stranded regions (e.g., (320) and (330)) and the second clip strand (400) can be designed to include any combination of universal adaptor sequences. For example, the two side-attached single-stranded regions (e.g., (320) and (330)) can contain universal binding sequences (or their complements) of P5 and P7 sequences that bind to surface primers immobilized on a support (e.g., a flow cell), where P5 and P7 sequences are typically used to construct libraries for Illumina sequencing platforms. The second clip strand (400) can include at least one novel universal adaptor sequence (e.g., a novel surface primer sequence) not found on Illumina sequencing platforms, thereby allowing the covalently closed circular molecule (600) to be used on non-Illumina sequencing platforms.

[0187] The method described in this paper also offers the advantage of using linker reactions instead of interstitial filling reactions to introduce novel linker sequences. Linker reactions can achieve efficient cyclization using library molecules as low as 0.25 pmol.

[0188] The method described herein can be performed manually or automated because annealing and multi-enzyme reactions can be carried out in a single reaction vessel (one-pot) by combining some enzymatic reactions (e.g., phosphorylation and ligation) and by adding subsequent enzymes (e.g., exonucleases), without intermediate alcohol precipitation or organic extraction.

[0189] Double-chain clamp connector

[0190] This disclosure provides a nucleic acid double-stranded splint adapter (200) comprising: (i) a first splint strand (long splint strand (300)) that hybridizes with (ii) a second splint strand (short splint strand (400)) (see, for example, see...). Figure 1-7The first splint chain comprises a first region (320), an inner region (310), and a second region (330). The inner region (310) of the first splint chain hybridizes with the second splint chain (400) to form a double-stranded splint adapter (200) having a double-stranded region and two side-joined single-stranded regions. The two side-joined single-stranded regions of the double-stranded splint adapter (200) are designed to hybridize with the terminal sequences of a linear nucleic acid library molecule. The terminal sequences of the linear nucleic acid library molecule respectively contain a first and a second universal adapter sequence. In some embodiments, the first and second universal adapter sequences of the linear library molecule respectively contain binding sequences for first and second capture primers immobilized on a support.

[0191] The first region (320) of the first splint chain contains a first universal adaptor sequence that can hybridize with a first universal binding sequence at one end of a linear nucleic acid library molecule (e.g., see...). Figure 1-7 The second region (330) of the first splint chain contains a second universal adaptor sequence that can hybridize with a second universal binding sequence at the other end of the linear nucleic acid library molecule (see, for example, see...). Figure 1-7 In some embodiments, the first region (320) of the first splint chain includes a first universal adaptor sequence comprising a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for a first or second surface primer, a universal binding sequence for forward or reverse amplification primers, or a universal binding sequence for compacted oligonucleotides. In some embodiments, the second region (330) of the first splint chain includes a second universal adaptor sequence comprising a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for a first or second surface primer, a universal binding sequence for forward or reverse amplification primers, or a universal binding sequence for compacted oligonucleotides. In some embodiments, the 5' end of the first splint chain (300) is phosphorylated or non-phosphorylated. In some embodiments, the 3' end of the first splint chain (300) includes a terminal 3' OH group or a terminal 3' blocking group.

[0192] In some embodiments, the second clamp chain (400) includes at least two sub-regions, including first and second sub-regions (e.g., see...). Figure 2 and 3In some embodiments, the first subregion contains a universal binding sequence for a third or fourth surface primer, and the second subregion contains a universal binding sequence for a fourth or third surface primer, wherein the first and second subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the first subregion contains a universal binding sequence for a third surface primer, and the second subregion contains a universal binding sequence for a fourth surface primer, wherein the first and second subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the second splint chain (400) further includes an optional third subregion comprising a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases (e.g., see [link to relevant documentation]). Figure 3 In some embodiments, the second splint chain (400) contains only one subregion and lacks a second and third subregion, wherein the first subregion contains a sample index sequence having 5-20 bases. In some embodiments, the sample index sequence can be used to distinguish target sequences obtained from different sample sources in multiplex assays. In some embodiments, the unique identification sequence contains a random sequence. The unique identification sequence can be designed to exhibit reduced hybridization or no hybridization with the first, second, third, and fourth surface primers. An exemplary arrangement of the subregions in the second splint chain (400) in the 5' to 3' direction includes: 5'-[second subregion]–[first subregion]–3'. Another exemplary arrangement of the subregions in the second splint chain (400) in the 5' to 3' direction includes: 5'-[third subregion]–[second subregion]–[first subregion]–3' (see, for example, see...). Figure 2 and 3 In some embodiments, the second splint chain (400) may be 20-100 nucleotides long, 30-80 nucleotides long, or 40-60 nucleotides long. In some embodiments, the 5' end of the second splint chain (400) is phosphorylated or non-phosphorylated. In some embodiments, the 3' end of the second splint chain (400) contains a terminal 3'OH group or a terminal 3' blocking group. In some embodiments, the second splint chain (400) contains one or more phosphate thioester bonds at the 5' and / or 3' ends to confer exonuclease resistance. In some embodiments, the second splint chain (400) contains one or more phosphate thioester bonds at an internal position to confer endonuclease resistance. In some embodiments, the second splint chain (400) contains one or more 2'-O-methylcytosine bases at the 5' and / or 3' ends or at an internal position.

[0193] In some embodiments, the first clamp chain (300) includes an inner region (310) containing at least two sub-regions, including a fourth and a fifth sub-region (see, for example, see...). Figure 2 and 3The fourth subregion hybridizes with the first subregion of the second splint chain (400). The fifth subregion hybridizes with the second subregion of the second splint chain (400). The fourth and fifth subregions do not hybridize with the first and second surface primers (or at least show very little hybridization). In some embodiments, the inner region (310) of the first splint chain further includes an optional sixth subregion that hybridizes with the third subregion of the second splint chain (400) (e.g., see...). Figure 3 An exemplary arrangement of the sub-regions of the first clamp chain (300) in the 5' to 3' direction includes: 5' – [fourth sub-region] – [fifth sub-region] – 3'. Another exemplary arrangement of the sub-regions of the first clamp chain (300) in the 5' to 3' direction includes: 5' – [fourth sub-region] – [fifth sub-region] – [sixth sub-region] – 3' (see, for example, see...). Figure 2 and 3 In some embodiments, the length of the first splint chain (300) may be 50-150 nucleotides, 60-100 nucleotides, or 70-90 nucleotides. In some embodiments, the first splint chain (300) includes one or more phosphate thioester bonds at the 5' and / or 3' ends to confer exonuclease resistance. In some embodiments, the first splint chain (300) includes one or more phosphate thioester bonds at the internal position to confer endonuclease resistance. In some embodiments, the first splint chain (300) includes one or more 2'-O-methylcytosine bases at the 5' and / or 3' ends or at the internal position.

[0194] In some embodiments, the first subregion of the second clamp chain (400) contains the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 200). In some embodiments, the second subregion of the second clamp chain (400) contains the sequence

[0195] 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO: 201). In some embodiments, the second clamp chain (400) includes first and second sub-regions containing the sequence 5'-AGTCGTCGCAGCCTCACCTGATCCATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 202). See also Figure 10 In some embodiments, the 5' end of the second clamp chain (400) may be phosphorylated or non-phosphorylated.

[0196] In some embodiments, the first region (320) of the first splint chain includes a first universal linker sequence containing a universal binding sequence (or its complementary sequence) for the first surface primer, wherein the first region (320) contains the sequence 5'-TCGGTGGTCGCCGTATCATT-3' (SEQ ID NO: 193). For example, the first region (320) of the first splint chain may hybridize with a P5 surface primer or a complementary sequence of a P5 surface primer. For example, the P5 surface primer contains the sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 203; short P5), or the P5 surface primer contains the sequence 5'-AATGATACGGCGACCACCGAGATC-3' (SEQ ID NO: 194; long P5). In some embodiments, the second region (330) of the first splint chain includes a second universal linker sequence containing a universal binding sequence (or its complementary sequence) for the second surface primer, wherein the second region (330) contains the sequence 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 195). For example, the second region (330) of the first splint chain can hybridize with a P7 surface primer or a complementary sequence of a P7 surface primer. For example, the P7 surface primer contains the sequence 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 195; short P7), or the P7 surface primer contains the sequence 5'-CAAGCAGAAGACGGCATACGAGAT-3' (SEQ ID NO: 196; long P7). In some embodiments, the first splint chain (300) includes an inner region (310) containing a fourth subregion having the following sequence.

[0197] 5'-ACCCTGAAAGTACGTGCATTACATG-3' (SEQ ID NO: 197). In some embodiments, the first clamp chain (300) includes an inner region (310) containing a fifth sub-region having the sequence: 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO: 198). In some embodiments, the first clamp chain (300) includes a first region (320), an inner region (310) having fourth and fifth sub-regions, and a second region (330) having the sequence 5'-TCGGTGGTCGCCGTATCATTACCCTGAAAGTACGTGCATTACATGGATCAGGTGAG GCTGCGACGACTCAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 199). See also Figure 10In some embodiments, the 5' end of the first splint chain (300) may be phosphorylated or unphosphorylated. In some embodiments, a first subregion of the second splint chain (400) may hybridize with a fourth subregion of the first splint chain (300). In some embodiments, a second subregion of the second splint chain (400) may hybridize with a fifth subregion of the first splint chain (300).

[0198] Library-splice composite

[0199] This disclosure provides a library-sandwich complex (500) comprising: (i) a single-stranded nucleic acid library molecule (100) including a target sequence (110) with at least a first left universal adaptor sequence (120) side-mounted on one side and at least a first right universal adaptor sequence (130) side-mounted on the other side; and (ii) a double-stranded sandwich adaptor (200) including a first sandwich strand (long sandwich strand (300)) and a second sandwich strand (short sandwich strand (400)), wherein the first sandwich strand includes a first region (320), an inner region (310) and a second region (330), wherein the inner region (310) of the first sandwich strand hybridizes with the second sandwich strand (400) to form a double-stranded sandwich adaptor (200) having a double-stranded region and two side-mounted single-stranded regions. In the library-splice complex (500), a first region (320) of the first splint chain hybridizes with at least a first left universal adaptor sequence (120) of the library molecule, and a second region (330) of the first splint chain hybridizes with at least a first right universal adaptor sequence (130) of the library molecule, thereby circulating the library molecule to produce the library-splice complex (500) (see, for example, [reference needed]). Figure 1-7 ).

[0200] In the library-sandwich complex (500), the first region (320) of the first sandwich chain contains a first universal adaptor sequence that can hybridize with a first universal binding sequence at one end of the linear nucleic acid library molecule (e.g., see...). Figure 1-7In some embodiments, the first region (320) of the first splint chain includes a first universal adaptor sequence comprising a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for a first or second surface primer, a universal binding sequence for forward or reverse amplification primers, or a universal binding sequence for compacted oligonucleotides. In some embodiments, the length of the first splint chain (300) may be 50-150 nucleotides, 60-100 nucleotides, or 70-90 nucleotides. In some embodiments, the first splint chain (300) includes one or more phosphate thioester bonds at the 5' and / or 3' ends to confer exonuclease resistance. In some embodiments, the first splint chain (300) includes one or more phosphate thioester bonds at an internal location to confer endonuclease resistance. In some embodiments, the first splint chain (300) includes one or more 2'-O-methylcytosine bases at the 5' and / or 3' ends or at an internal location. In some embodiments, the 5' end of the first splint chain (300) is phosphorylated or lacks a phosphate group. In some embodiments, the 3' end of the first clamp chain (300) includes a terminal 3'OH group or a terminal 3' blocking group.

[0201] The second region (330) of the first splint chain contains a second universal adaptor sequence that can hybridize with a second universal binding sequence at the other end of the linear nucleic acid library molecule (e.g., see...). Figure 1-7 In some embodiments, the second region (330) of the first splint chain includes a second universal adaptor sequence comprising a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for the first or second surface primers, a universal binding sequence for forward or reverse amplification primers, or a universal binding sequence for compacted oligonucleotides. In some embodiments, the 5' end of the second splint chain (400) is phosphorylated or lacks a phosphate group. In some embodiments, the 3' end of the second splint chain (400) includes a terminal 3' OH group or a terminal 3' blocking group.

[0202] In the library-splice complex (500), a first region (320) of the first splint chain hybridizes with at least a first left universal connective sequence (120) of the library molecule, and a second region (330) of the first splint chain hybridizes with at least a first right universal sequence (130) of the library molecule, thereby circulating the library molecule to produce the library-splice complex (500). The library-splice complex (500) includes a first gap between the 5' end of the library molecule and the 3' end of the second splint chain. The library-splice complex (500) also includes a second gap between the 5' end of the second splint chain and the 3' end of the library molecule (e.g., see...). Figure 1-7 In some embodiments, the first and second gaps are enzymatically linked.

[0203] In the library-sandwich complex (500), a first region (320) of the first splint strand can hybridize with either the sense or antisense strand of a double-stranded nucleic acid library molecule. In the library-sandwich complex (500), a second region (330) of the first splint strand can hybridize with either the sense or antisense strand of a double-stranded nucleic acid library molecule. The double-stranded nucleic acid library molecule can be denatured to generate single-stranded sense and antisense library strands.

[0204] In the library-sandwich complex (500), the second sandwich chain (400) does not hybridize with the target sequence (110), and the internal region (310) of the first sandwich chain does not hybridize with the target sequence (110).

[0205] In the library-sandwich complex (500), the first region (320) of the first sandwich chain does not hybridize with the target sequence (110), and the second region (330) of the first sandwich chain does not hybridize with the target sequence (110).

[0206] In some embodiments, in the library-sandwich complex (500), the 5' end of the single-chain library molecule (100) is phosphorylated or lacks a phosphate group. In some embodiments, the 3' end of the single-chain library molecule includes a terminal 3'OH group or a terminal 3' blocking group.

[0207] In some embodiments, the nucleic acid library molecule (100) further comprises a second left universal adaptor sequence (140). In some embodiments, the nucleic acid library molecule (100) further comprises a second right universal adaptor sequence (150). An exemplary library molecule (100) is shown in Figure 4-7 In some embodiments, the nucleic acid library molecule (100) may further include additional left and / or right universal adaptor sequences.

[0208] In some embodiments, the nucleic acid library molecule (100) further comprises a first left index sequence (160). In some embodiments, the nucleic acid library molecule (100) further comprises a first right index sequence (170). In some embodiments, the first left index sequence (160) comprises a sample index sequence. In some embodiments, the first right index sequence (170) comprises another sample index sequence. In some embodiments, the nucleic acid library molecule (100) comprises a first left index sequence (160) and / or a first right index sequence (170). The sample index sequence can be used to distinguish target sequences obtained from different sample sources in multiplex assays. An exemplary library molecule (100) is shown in Figure 4-7 In the middle. An exemplary list of the first left index sequence (160) and the first right index sequence (170) is in Figures 23A-23FThe first left index sequence (160) may include a random sequence (e.g., NNN) or lack a random sequence. The first right index sequence (170) may include a random sequence (e.g., NNN) or lack a random sequence.

[0209] In some embodiments, the nucleic acid library molecule (100) further comprises at least one conjugating adaptor sequence located between any of the universal adaptor sequences described herein (e.g., see...). Figure 7 For example, the first left-joint connector sequence (125) may be located between the first left universal connector sequence (120) and the first left index sequence (160). The second left-joint connector sequence (165) may be located between the first left index sequence (160) and the second left universal connector sequence (140). The third connector sequence (145) may be located between the second left universal connector sequence (140) and the target sequence (110). The first right-joint connector sequence (135) may be located between the first right universal sequence (130) and the first right index sequence (170). The second right-joint connector sequence (175) may be located between the first right index sequence (170) and the second right universal connector sequence (150). The third right-joint connector sequence (155) may be located between the second right universal connector sequence (150) and the target sequence (110). In some embodiments, the nucleic acid library molecule (100) further comprises at least one and up to ten additional universal adaptor sequences located at the 5' (upstream) of the first left universal adaptor sequence (120) (e.g., see...). Figure 7 In some embodiments, the nucleic acid library molecule (100) further comprises at least one and up to ten additional universal adaptor sequences located at the 3' (downstream) of the first right universal sequence (130) (e.g., see...). Figure 7Any conjugating adaptor sequence contains any sequence and may be 3-60 nucleotides in length and / or an additional universal adaptor sequence. Any conjugating adaptor sequence and / or an additional universal adaptor sequence contains a universal or unique sequence. Any conjugating adaptor sequence and / or an additional universal adaptor sequence contains a binding sequence for amplification primers, sequencing primers, or compacted oligonucleotides. Any conjugating adaptor sequence and / or an additional universal adaptor sequence contains a binding sequence for immobilized surface primers (e.g., capture primers). Any conjugating adaptor sequence and / or an additional universal adaptor sequence contains a sample index sequence. Any conjugating adaptor sequence and / or an additional universal adaptor sequence contains a unique identification sequence. Any conjugating adaptor sequence and / or an additional universal adaptor sequence, particularly the conjugating adaptor sequence (145), contains the Tn5 transposon end sequence 5'-AGATGTGTATAAGAGACAG-3' (SEQ ID NO:211). Any conjugating adaptor sequence and / or an additional universal adaptor sequence, particularly the conjugating adaptor sequence (155), contains the Tn5 transposon end sequence 5'-CTGTCTCTTATACACATCT-3' (SEQ ID NO:212). The Tn5 transposon end sequence can be introduced into the library molecule (100) via a transposase-mediated reaction under conditions suitable for forming a transposon synaptic complex. This reaction involves contacting double-stranded input DNA (e.g., genomic DNA) with a Tn-5 type transposase and a double-stranded oligonucleotide containing a Tn transposon end sequence (SEQ ID NO:211) linked to a universal adaptor sequence or a sample index sequence. In the double-stranded oligonucleotide, the Tn transposon end sequence (SEQ ID NO:211) may be located at 5' or 3' relative to the universal adaptor sequence or the sample index sequence.

[0210] A multiplex workflow is initiated by preparing a sample-indexed library using one or two index sequences (e.g., left and / or right index sequences). Individual sample-indexed libraries can be prepared using input nucleic acids isolated from different sources, using a first left index sequence (160) and / or a first right index sequence (170). Sample-indexed libraries can be pooled together to generate a multiplex library mixture, and the pooled libraries can be amplified and / or sequenced. The sequence of the insert region, along with the first left index sequence (160) and / or the first right index sequence (170), can be used to identify the source of the input nucleic acid. In some embodiments, any number of sample-indexed libraries can be pooled together, for example, 2-10, 10-50, 50-100, 100-200, or more than 200 sample-indexed libraries can be pooled. Exemplary nucleic acid sources include naturally occurring, recombinant, or chemically synthesized sources. Exemplary nucleic acid sources include single cells, multiple cells, tissues, biological fluids, environmental samples, or whole organisms. Exemplary sources of nucleic acids include fresh, frozen, fresh-frozen, or archived sources (e.g., formalin-fixed paraffin-embedded; FFPE). Those skilled in the art will recognize that nucleic acids can be isolated from many other sources. Nucleic acid libraries can be prepared in single-stranded or double-stranded form.

[0211] In some embodiments, the nucleic acid library molecule (100) further includes: an optional first left unique identifier sequence (180). In some embodiments, the nucleic acid library molecule (100) further includes an optional first right unique identifier sequence (190). In some embodiments, the first left unique identifier sequence (180) and the first right unique identifier sequence (190) each include a sequence segment used to uniquely identify, within other populations of target molecules, each target sequence (e.g., an insert sequence) to which a unique adaptor is attached. In some embodiments, the first left unique identifier sequence (180) and / or the first right unique identifier sequence (190) can be used as a molecular marker. An exemplary library molecule (100) is shown in Figure 4-7 middle.

[0212] In some embodiments, the nucleic acid library molecule (100) comprises any one or more of the following combinations: a first left universal adaptor sequence (120); a second left universal adaptor sequence (140); a first left index sequence (160); a first left unique identifier sequence (180); a first right universal adaptor sequence (130); a second right universal adaptor sequence (150); a first right index sequence (170); and / or a first right unique identifier sequence (190). An exemplary library molecule (100) is shown in... Figure 4-7 middle.

[0213] In some embodiments, the first left universal adaptor sequence (120) and / or the second left universal adaptor sequence (140) comprise: a universal binding sequence for forward or reverse sequencing primers; a universal binding sequence for the first or second surface primers; a universal binding sequence for forward or reverse amplification primers; and / or a universal binding sequence for compacted oligonucleotides. In some embodiments, the nucleic acid library molecule (100) may further comprise additional left universal adaptor sequences.

[0214] In some embodiments, the first right universal adaptor sequence (130) and / or the second right universal adaptor sequence (150) comprise: a universal binding sequence for forward or reverse sequencing primers; a universal binding sequence for the first or second surface primers; a universal binding sequence for forward or reverse amplification primers; and / or a universal binding sequence for compacted oligonucleotides. In some embodiments, the nucleic acid library molecule (100) may further comprise additional right universal adaptor sequences.

[0215] In some embodiments, the second clamp chain (400) includes at least two sub-regions, including first and second sub-regions (e.g., see...). Figure 2 and 3 The first subregion contains a universal binding sequence for the third surface primer, and the second subregion contains a universal binding sequence for the fourth surface primer, wherein the first and second subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the second splint chain (400) further includes an optional third subregion comprising a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases (e.g., see [link to relevant documentation]). Figure 2 and 3In some embodiments, the second splint chain (400) contains only one subregion and lacks a second and third subregion, wherein the first subregion contains a sample index sequence having 5-20 bases. In some embodiments, the sample index sequence can be used to distinguish target sequences obtained from different sample sources in multiplex assays. In some embodiments, the unique identification sequence comprises a random sequence. The unique identification sequence can be designed to exhibit reduced hybridization or no hybridization with the first, second, third, and fourth surface primers. An exemplary arrangement of the subregions in the second splint chain (400) in the 5' to 3' direction includes: 5'-[second subregion]–[first subregion]–3'. Another exemplary arrangement of the subregions in the second splint chain (400) in the 5' to 3' direction includes: 5'-[third subregion]–[second subregion]–[first subregion]–3'. In some embodiments, the length of the second splint chain (400) may be 20-100 nucleotides, 30-80 nucleotides, or 40-60 nucleotides. In some embodiments, the second splint chain (400) includes one or more phosphate thioester bonds at its 5' and / or 3' ends to confer resistance to exonucleases. In some embodiments, the second splint chain (400) includes one or more phosphate thioester bonds at its internal position to confer resistance to endonucleases. In some embodiments, the second splint chain (400) includes one or more 2'-O-methylcytosine bases at its 5' and / or 3' ends or at its internal position. In some embodiments, the 5' end of the second splint chain (400) is phosphorylated or non-phosphorylated. In some embodiments, the 3' end of the second splint chain (400) includes a terminal 3'OH group or a terminal 3' blocking group.

[0216] In some embodiments, the first clamp chain (300) includes an inner region (310) containing at least two sub-regions, including a fourth and a fifth sub-region (see, for example, see...). Figure 2 and 3 The fourth subregion hybridizes with the first subregion of the second splint chain (400). The fifth subregion hybridizes with the second subregion of the second splint chain (400). The fourth and fifth subregions do not hybridize with the first and second surface primers (or at least show very little hybridization). In some embodiments, the inner region (310) of the first splint chain further includes an optional sixth subregion that hybridizes with the third subregion of the second splint chain (400) (e.g., see...). Figure 2 and 3 An exemplary arrangement of the sub-regions of the first clamp chain (300) in the 5' to 3' direction includes: 5' – [fourth sub-region] – [fifth sub-region] – 3'. Another exemplary arrangement of the sub-regions of the first clamp chain (300) in the 5' to 3' direction includes: 5' – [fourth sub-region] – [fifth sub-region] – [sixth sub-region] – 3'.

[0217] In some embodiments, an exemplary library-sandwich complex (500) comprises: (a) a single-stranded nucleic acid library molecule (100); (b) a first sandwich chain (300); and (c) a second sandwich chain (400).

[0218] In the exemplary library-sandwich complex (500), the single-stranded nucleic acid library molecule (100) comprises components arranged in a 5' to 3' order: (i) a first left universal adaptor sequence (120) having a binding sequence (120) for a first surface primer; (ii) a second left universal adaptor sequence (140) having a binding sequence for a first sequencing primer; (iii) a target sequence (110); (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer; and (v) a first right universal adaptor sequence (130) having a binding sequence (130) for a second surface primer.

[0219] In an exemplary library-sandwich composite (500), a first sandwich chain (300) comprises components arranged in a 5' to 3' order: a first region (320); an inner region (310); and a second region (330).

[0220] In the exemplary library-sandwich complex (500), the second sandwich chain (400) comprises subregions arranged in a 3' to 5' order: a first subregion having a universal binding sequence for a third surface primer; and a second subregion having a universal binding sequence for a fourth surface primer.

[0221] In the exemplary library-splice complex (500), a portion of the first splint chain (300) hybridizes with a portion of the library molecule (100), thereby circulating the library molecule to produce the library-splice complex (500), such that a first region (320) of the first splint chain hybridizes with a binding sequence (120) for a first surface primer, and a third region (330) of the first splint chain hybridizes with a binding sequence (130) for a second surface primer. Additionally, a second splint chain (400) hybridizes with an internal region (310) of the first splint chain (300). The library-splice complex (500) includes a first gap between the 5' end of the library molecule and the 3' end of the second splint chain, and a second gap between the 5' end of the second splint chain and the 3' end of the library molecule, and the first and second gaps are enzymatically ligated.

[0222] In the exemplary library-sandwich complex (500), the second sandwich chain (400) does not hybridize with the target sequence (110), and the internal region (310) of the first sandwich chain does not hybridize with the target sequence (110).

[0223] In the exemplary library-splice complex (500), the first region (320) of the first splice chain does not hybridize with the target sequence (110), and the second region (330) of the first splice chain does not hybridize with the target sequence (110).

[0224] In some embodiments, any library-stripping complex (500) described herein comprises a plurality of library-stripping complexes (500), wherein the target sequence (110) of each of the plurality of library-stripping complexes comprises the same target sequence or different target sequences.

[0225] In some embodiments, in any library-sandwich complex (500) described herein, the first subregion of the second sandwich chain (400) contains a sequence

[0226] 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 200). In some embodiments, the second subregion of the second clamp chain (400) contains the sequence

[0227] 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO: 201). In some embodiments, the second clamping chain (400) includes first and second sub-regions containing sequences

[0228] 5'-AGTCGTCGCAGCCTCACCTGATCCATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 202). See Figure 10 In some embodiments, the 5' end of the second clamp chain (400) may be phosphorylated or non-phosphorylated.

[0229] In some embodiments, the second clamp chain (400) contains only one subregion and lacks a second and third subregion, wherein the first subregion contains a sample index sequence having 5-20 bases.

[0230] In some embodiments, in any library-splice complex (500) described herein, a first region (320) of the first splint chain includes a first universal linker sequence containing a universal binding sequence (or its complementary sequence) against a first surface primer, wherein the first region (320) contains the sequence 5'-TCGGTGGTCGCCGTATCATT-3' (SEQ ID NO: 193). For example, the first region (320) of the first splint chain may hybridize with a P5 surface primer or a complementary sequence of a P5 surface primer. For example, a P5 surface primer may contain the sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 203; short P5), or a P5 surface primer may contain the sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 203; short P5), or a P5 surface primer may contain the sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 203; short P5).

[0231] 5'-AATGATACGGCGACCACCGAGATC-3' (SEQ ID NO: 194; long P5). In some embodiments, the second region (330) of the first splint chain includes a second universal linker sequence containing a universal binding sequence (or its complementary sequence) for the second surface primer, wherein the second region (330) contains the sequence

[0232] 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO:195). For example, the second region (330) of the first splint strand can hybridize with the P7 surface primer or a complementary sequence of the P7 surface primer. For example, the P7 surface primer contains the sequence

[0233] 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO:195; short P7), or the P7 surface primer contains the sequence 5'-CAAGCAGAAGACGGCATACGAGAT-3' (SEQ ID NO:196; long P7). In some embodiments, the first clamp chain (300) includes an inner region (310) containing a fourth subregion having the following sequence.

[0234] 5'-ACCCTGAAAGTACGTGCATTACATG-3' (SEQ ID NO: 197). In some embodiments, the first clamp chain (300) includes an inner region (310) containing a fifth sub-region having the sequence 5'-GATCAGGTGAGGCTGCGACGACT'3' (SEQ ID NO: 198). In some embodiments, the first clamp chain (300) includes a first region (320), an inner region (310) having a fourth and a fifth sub-region, and a second region (330) having the sequence 5'-TCGGTGGTCGCCGTATCATTACCCTGAAAGTACGTGCATTACATGGATCAGGTGAG GCTGCGACGACTCAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 199). See also Figure 10 In some embodiments, the 5' end of the first splint chain (300) may be phosphorylated or unphosphorylated. In some embodiments, a first subregion of the second splint chain (400) may hybridize with a fourth subregion of the first splint chain (300). In some embodiments, a second subregion of the second splint chain (400) may hybridize with a fifth subregion of the first splint chain (300).

[0235] In some embodiments, in any library-sandwich complex (500) described herein, a first region (320) of a first sandwich chain contains a sequence capable of binding a first left universal adaptor sequence (120) of a library molecule, wherein the first region (320) of the first sandwich chain contains the sequence 5'-ACCCTGAAAGTACGTGCATTACATG-3' (SEQ ID NO:197) or its complementary sequence.

[0236] In some embodiments, in any library-sandwich complex (500) described herein, a second region (330) of the first sandwich chain contains a sequence capable of binding a first right universal adaptor sequence (130) of the library molecule, wherein the second region (330) of the first sandwich chain contains sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO:198) or its complementary sequence.

[0237] In some embodiments, in any library-sandwich complex (500) described herein, the library molecule includes a left universal binding sequence (120) that binds to a first region (320) of a first sandwich chain, wherein the left universal binding sequence (120) comprises the sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO:203).

[0238] In some embodiments, in any library-sandwich complex (500) described herein, the library molecule includes a left universal binding sequence (120) that binds to a first region (320) of a first sandwich chain, wherein the left universal binding sequence (120) comprises sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO:200) or its complementary sequence.

[0239] In some embodiments, in any library-sandwich complex (500) described herein, the library molecule includes a left universal binding sequence for a sequencing primer (140), wherein the left universal binding sequence comprises a sequence

[0240] 5'-ACACTCTTTCCCTACACGACCGCTTCCGATCT-3' (SEQ ID NO: 204).

[0241] In some embodiments, in any library-sandwich complex (500) described herein, the library molecule includes a left universal binding sequence for a sequencing primer (140), wherein the left universal binding sequence comprises a sequence

[0242] 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 207).

[0243] In some embodiments, in any library-sandwich complex (500) described herein, the library molecule includes a left universal binding sequence for a sequencing primer (140), wherein the left universal binding sequence comprises a sequence

[0244] 5'-CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT-3' (SEQ ID NO: 208).

[0245] In some embodiments, in any library-sandwich complex (500) described herein, the library molecule includes a left universal binding sequence for a sequencing primer (150), wherein the left universal binding sequence comprises a sequence

[0246] 5'-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3' (SEQ ID NO: 205).

[0247] In some embodiments, in any library-sandwich complex (500) described herein, the library molecule includes a left universal binding sequence for a sequencing primer (150), wherein the left universal binding sequence comprises a sequence

[0248] 5'-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3' (SEQ ID NO: 209).

[0249] In some embodiments, in any library-sandwich complex (500) described herein, the library molecule includes a left universal binding sequence for a sequencing primer (150), wherein the left universal binding sequence comprises a sequence

[0250] 5'-ATGTCGGAAGGTTGTGCAGGCTACCGCTTGTCAACT-3' (SEQ ID NO: 210).

[0251] In some embodiments, in any library-sandwich complex (500) described herein, the library molecule includes a right universal binding sequence (130) of a first region that binds to a first sandwich chain (330), wherein the right universal binding sequence (130) comprises the sequence 5'-TCGTATGCCGTCTTCTGCTTG-3' (SEQ ID NO:206).

[0252] In some embodiments, in any library-sandwich complex (500) described herein, the library molecule includes a right universal binding sequence (130) that binds to a first region (330) of a first sandwich chain, wherein the right universal binding sequence (130) comprises sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO:201) or its complementary sequence.

[0253] This disclosure provides a reaction mixture comprising a plurality of any of the library-splice complexes (500) described herein. In some embodiments, the reaction mixture comprises a plurality of any of the library-splice complexes (500) described herein and a T4 polynucleotide kinase. In some embodiments, the reaction mixture comprises a plurality of any of the library-splice complexes (500) described herein and a ligase. In some embodiments, the reaction mixture comprises a plurality of any of the library-splice complexes (500) described herein, a T4 polynucleotide kinase, and a ligase. In some embodiments, the ligase comprises a T7 DNA ligase, a T3 ligase, a T4 ligase, or a Taq ligase.

[0254] Covalently closed cyclic molecules

[0255] This disclosure provides a covalently closed circular library molecule (600) comprising: a target sequence (110), at least a first left universal adaptor sequence (120), at least a first right universal adaptor sequence (130), and a second splint chain sequence (400). An exemplary covalently closed circular library molecule is shown in... Figure 8 In some embodiments, the covalently closed circular library molecule (600) further comprises a second left universal connective sequence (140). In some embodiments, the covalently closed circular molecule (600) further comprises a second right universal connective sequence (150). In some embodiments, the covalently closed circular molecule (600) further comprises additional left and / or right universal connective sequences.

[0256] In some embodiments, the covalently closed cyclic molecule (600) further comprises a first left index sequence (160) and / or a first right index sequence (170). The sample index sequences can be used to distinguish target sequences obtained from different sample sources in multiplex assays. A list of exemplary first left index sequences (160) and first right index sequences (170) is provided in [the relevant section]. Figures 23A-23F The first left index sequence (160) may include a random sequence (e.g., NNN) or lack a random sequence. The first right index sequence (170) may include a random sequence (e.g., NNN) or lack a random sequence.

[0257] A multiplex workflow is initiated by preparing a sample-indexed library using one or two index sequences (e.g., left and / or right index sequences). Individual sample-indexed libraries can be prepared using input nucleic acids isolated from different sources, using a first left index sequence (160) and / or a first right index sequence (170). Sample-indexed libraries can be pooled together to generate a multiplex library mixture, and the pooled libraries can be amplified and / or sequenced. The sequence of the insert region, along with the first left index sequence (160) and / or the first right index sequence (170), can be used to identify the source of the input nucleic acid. In some embodiments, any number of sample-indexed libraries can be pooled together, for example, 2-10, 10-50, 50-100, 100-200, or more than 200 sample-indexed libraries can be pooled. Exemplary nucleic acid sources include naturally occurring, recombinant, or chemically synthesized sources. Exemplary nucleic acid sources include single cells, multiple cells, tissues, biological fluids, environmental samples, or whole organisms. Exemplary sources of nucleic acids include fresh, frozen, fresh-frozen, or archived sources (e.g., formalin-fixed paraffin-embedded; FFPE). Those skilled in the art will recognize that nucleic acids can be isolated from many other sources. Nucleic acid libraries can be prepared in single-stranded or double-stranded form.

[0258] In some embodiments, the covalently closed circular molecule (600) further comprises an optional first left-unique identifying sequence (180) and / or an optional first right-unique identifying sequence (190). Although Figure 8 An exemplary covalently closed circular molecule (600) with a first left-hand unique identification sequence (180) is shown, but those skilled in the art will recognize, for example... Figure 6 The linear library molecule (100) shown can be cyclized using a double-stranded splint adapter (200) to generate a covalently closed circular molecule (600) having a first right unique identifier (190). In some embodiments, the first left unique identifier (180) and the first right unique identifier (190) each comprise a sequence segment used to uniquely identify, within other groups of target molecules, each target sequence (e.g., an insert sequence) to which a unique adapter is attached. In some embodiments, the first left unique identifier (180) and / or the first right unique identifier (190) can be used as a molecular marker.

[0259] In some embodiments, the covalently closed circular molecule (600) comprises any one or more of the following combinations: a first left universal adaptor sequence (120); a second left universal adaptor sequence (140); a first left index sequence (160); a first left unique identifier sequence (180); a first right universal adaptor sequence (130); a second right universal adaptor sequence (150); a first right index sequence (170); and / or a first right unique identifier sequence (190). In some embodiments, the first left index sequence (160) comprises a sample index sequence. In some embodiments, the first right index sequence (170) comprises another sample index sequence. The sample index sequence can be used to distinguish target sequences obtained from different sample sources in multiple assays. In some embodiments, the first left unique identifier sequence (180) and the first right unique identifier sequence (190) each comprise a sequence segment used to uniquely identify, within other target molecule populations, each target sequence (e.g., an insert sequence) to which a unique adaptor is attached. In some embodiments, a first left unique identifier sequence (180) and / or a first right unique identifier sequence (190) may be used as a molecular marker.

[0260] In some embodiments, in the covalently closed circular molecule (600), the first left universal adaptor sequence (120) and / or the second left universal adaptor sequence (140) comprise: a universal binding sequence for forward or reverse sequencing primers; a universal binding sequence for the first or second surface primers; a universal binding sequence for forward or reverse amplification primers; and / or a universal binding sequence for compacted oligonucleotides. In some embodiments, the covalently closed circular molecule (600) may further comprise additional left universal adaptor sequences.

[0261] In some embodiments, in the covalently closed circular molecule (600), the first right universal adaptor sequence (130) and / or the second right universal adaptor sequence (150) comprise: a universal binding sequence for forward or reverse sequencing primers; a universal binding sequence for the first or second surface primers; a universal binding sequence for forward or reverse amplification primers; and / or a universal binding sequence for compacted oligonucleotides. In some embodiments, the covalently closed circular molecule (600) may further comprise additional right universal adaptor sequences.

[0262] In some embodiments, the covalently closed circular molecule (600) further comprises at least one conjugating linker sequence located between any of the general linker sequences described herein (e.g., see [link]). Figure 7For example, the first left-joint connector sequence (125) may be located between the first left universal connector sequence (120) and the first left index sequence (160). The second left-joint connector sequence (165) may be located between the first left index sequence (160) and the second left universal connector sequence (140). The third connector sequence (145) may be located between the second left universal connector sequence (140) and the target sequence (110). The first right-joint connector sequence (135) may be located between the first right universal sequence (130) and the first right index sequence (170). The second right-joint connector sequence (175) may be located between the first right index sequence (170) and the second right universal connector sequence (150). The third right-joint connector sequence (155) may be located between the second right universal connector sequence (150) and the target sequence (110). In some embodiments, the covalently closed circular molecule (600) further comprises at least one and up to ten additional universal connective sequences located at the 5' (upstream) of the first left universal connective sequence (120) (e.g., see...). Figure 7 In some embodiments, the covalently closed circular molecule (600) further comprises at least one and up to ten additional universal adaptor sequences located at the 3' (downstream) of the first right universal sequence (130) (e.g., see...). Figure 7Any conjugating adaptor sequence and / or additional universal adaptor sequence contains any sequence and may be 3-60 nucleotides in length. Any conjugating adaptor sequence and / or additional universal adaptor sequence contains a universal or unique sequence. Any conjugating adaptor sequence and / or additional universal adaptor sequence contains a binding sequence for amplification primers, sequencing primers, or compacted oligonucleotides. Any conjugating adaptor sequence and / or additional universal adaptor sequence contains a binding sequence for immobilized surface primers (e.g., capture primers). Any conjugating adaptor sequence and / or additional universal adaptor sequence contains a sample index sequence. Any conjugating adaptor sequence and / or additional universal adaptor sequence contains a unique identification sequence. Any conjugating adaptor sequence and / or additional universal adaptor sequence, particularly the conjugating adaptor sequence (145), contains the Tn5 transposon end sequence 5'-AGATGTGTATAAGAGACAG-3' (SEQ ID NO: 211). Any conjugating adaptor sequence and / or an additional universal adaptor sequence, particularly the conjugating adaptor sequence (155), contains the Tn5 transposon end sequence 5'-CTGTCTCTTATACACATCT-3' (SEQ ID NO:212). The Tn5 transposon end sequence can be introduced into the library molecule (100) via a transposase-mediated reaction under conditions suitable for forming a transposon synaptic complex. This reaction involves contacting double-stranded input DNA (e.g., genomic DNA) with a Tn-5 type transposase and a double-stranded oligonucleotide containing a Tn transposon end sequence (SEQ ID NO:211) linked to a universal adaptor sequence or a sample index sequence. In the double-stranded oligonucleotide, the Tn transposon end sequence (SEQ ID NO:211) may be located at 5' or 3' relative to the universal adaptor sequence or the sample index sequence.

[0263] In some embodiments, the second splint chain sequence (400) of the covalently closed circular molecule comprises at least two subregions, including first and second subregions. The first subregion contains a universal binding sequence for a third surface primer, and the second subregion contains a universal binding sequence for a fourth surface primer, wherein the first and second subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the second splint chain (400) further comprises an optional third subregion, which includes a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases. In some embodiments, the second splint chain (400) comprises only one subregion and lacks the second and third subregions, wherein the first subregion contains a sample index sequence having 5-20 bases. In some embodiments, the sample index sequence can be used to distinguish target sequences obtained from different sample sources in multiplex assays. In some embodiments, the unique identification sequence comprises a random sequence. The unique identification sequence can be designed to exhibit reduced or no hybridization with the first, second, third, and fourth surface primers. An exemplary arrangement of the sub-regions in the second clamp chain (400) in the 5' to 3' direction includes: 5' - [second sub-region] - [first sub-region] - 3'. Another exemplary arrangement of the sub-regions in the second clamp chain (400) in the 5' to 3' direction includes: 5' - [third sub-region] - [second sub-region] - [first sub-region] - 3'.

[0264] In some embodiments, the second splint chain sequence (400) of the covalently closed circular library molecule (600) may hybridize with the first splint chain (300). In some embodiments, the first splint chain (300) includes an inner region (310) comprising at least two subregions, including a fourth subregion and a fifth subregion. The fourth subregion hybridizes with the first subregion of the second splint chain (400). The fifth subregion hybridizes with the second subregion of the second splint chain (400). The fourth and fifth subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the inner region (310) of the first splint chain further includes an optional sixth subregion that hybridizes with the third subregion of the second splint chain (400). An exemplary arrangement of the subregions of the first splint chain (300) in the 5' to 3' direction comprises: 5' – [fourth subregion] – [fifth subregion] – 3'. Another exemplary arrangement of the sub-regions of the first clamp chain (300) in the 5' to 3' direction includes: 5' – [fourth sub-region] – [fifth sub-region] – [sixth sub-region] – 3'.

[0265] In some embodiments, an exemplary covalently closed circular molecule (600) comprises: (i) a first left universal adaptor sequence (120) having a binding sequence for a first surface primer (120); (ii) a second left universal adaptor sequence (140) having a binding sequence for a first sequencing primer; (iii) a target sequence (110); (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer; (v) a first right universal adaptor sequence (130) having a binding sequence for a second surface primer (130); and (vi) a second splint strand sequence (400), wherein the covalently closed circular molecule (600) optionally hybridizes with the first splint strand (300).

[0266] In an exemplary covalently closed circular molecule (600), the second splint chain region (400) comprises at least two subregions, including first and second subregions. The first subregion contains a universal binding sequence for a third surface primer, and the second subregion contains a universal binding sequence for a fourth surface primer, wherein the first and second subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the second splint chain (400) further comprises an optional third subregion, which includes a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases. In some embodiments, the second splint chain (400) comprises only one subregion and lacks the second and third subregions, wherein the first subregion contains a sample index sequence having 5-20 bases. In some embodiments, the sample index sequence can be used to distinguish target sequences obtained from different sample sources in multiplex assays. In some embodiments, the unique identification sequence comprises a random sequence. The unique identification sequence can be designed to exhibit reduced or no hybridization with the first, second, third, and fourth surface primers. An exemplary arrangement of the sub-regions in the second clamp chain (400) in the 5' to 3' direction includes: 5' - [second sub-region] - [first sub-region] - 3'. Another exemplary arrangement of the sub-regions in the second clamp chain (400) in the 5' to 3' direction includes: 5' - [third sub-region] - [second sub-region] - [first sub-region] - 3'.

[0267] In some embodiments, any covalently closed cyclic molecule (600) described herein comprises a plurality of covalently closed cyclic molecules (600), wherein the target sequence (110) of each of the plurality of covalently closed cyclic molecules (600) comprises the same target sequence or different target sequences.

[0268] In some embodiments, in any covalently closed cyclic molecule (600) described herein, the first subregion of the second splint chain (400) contains the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 200). In some embodiments, the second subregion of the second splint chain (400) contains the sequence

[0269] 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO: 201). In some embodiments, the second clamping chain (400) includes first and second sub-regions containing sequences

[0270] 5'-AGTCGTCGCAGCCTCACCTGATCCATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 202). See Figure 10 In some embodiments, the 5' end of the second clamp chain (400) may be phosphorylated or non-phosphorylated.

[0271] In some embodiments, in any covalently closed circular molecule (600) described herein, a first region (320) of the first splint chain includes a first universal linker sequence containing a universal binding sequence (or its complementary sequence) for a first surface primer, wherein the first region (320) contains the sequence

[0272] 5'-TCGGTGGTCGCCGTATCATT-3' (SEQ ID NO: 193). For example, the first region (320) of the first splint chain can hybridize with a P5 surface primer or a complementary sequence of a P5 surface primer. For example, the P5 surface primer contains the sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 203; short P5), or the P5 surface primer contains the sequence 5'-AATGATACGGCGACCACCGAGATC-3' (SEQ ID NO: 194; long P5). In some embodiments, the second region (330) of the first splint chain includes a second universal linker sequence containing a universal binding sequence (or its complementary sequence) for the second surface primer, wherein the second region (330) contains the sequence 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 195). For example, the second region (330) of the first splint chain can hybridize with a P7 surface primer or a complementary sequence of a P7 surface primer. For example, the P7 surface primer contains the sequence 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO:195; short P7), or the P7 surface primer contains the sequence 5'-CAAGCAGAAGACGGCATACGAGAT-3' (SEQ ID NO:196; long P7). In some embodiments, the first clamp chain (300) includes an inner region (310) containing a fourth subregion having the following sequence.

[0273] 5'-ACCCTGAAAGTACGTGCATTACATG-3' (SEQ ID NO: 197). In some embodiments, the first clamp chain (300) includes an inner region (310) containing a fifth sub-region having the sequence 5'-GATCAGGTGAGGCTGCGACGACT'3' (SEQ ID NO: 198). In some embodiments, the first clamp chain (300) includes a first region (320), an inner region (310) having a fourth and a fifth sub-region, and a second region (330) having the sequence 5'-TCGGTGGTCGCCGTATCATTACCCTGAAAGTACGTGCATTACATGGATCAGGTGAG GCTGCGACGACTCAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 199). See also Figure 10 In some embodiments, the 5' end of the first splint chain (300) may be phosphorylated or unphosphorylated. In some embodiments, a first subregion of the second splint chain (400) may hybridize with a fourth subregion of the first splint chain (300). In some embodiments, a second subregion of the second splint chain (400) may hybridize with a fifth subregion of the first splint chain (300).

[0274] In some embodiments, in any covalently closed circular molecule (600) described herein, the first region (320) of the first splint chain contains a sequence of a first left universal linker sequence (120) that can bind to the library molecule, wherein the first region (320) of the first splint chain contains the sequence 5'-ACCCTGAAAGTACGTGCATTACATG-3' (SEQ ID NO:197) or its complementary sequence.

[0275] In some embodiments, in any covalently closed circular molecule (600) described herein, the second region (330) of the first splint chain contains a sequence of a first right universal linker sequence (130) capable of binding the library molecule, wherein the second region (330) of the first splint chain contains sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO:198) or its complementary sequence.

[0276] In some embodiments, in any covalently closed circular molecule (600) described herein, the library molecule includes a left universal binding sequence (120) comprising the sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO:203).

[0277] In some embodiments, in any covalently closed circular molecule (600) described herein, the library molecule includes a left universal binding sequence (120) that binds to a first region (320) of a first splint chain, wherein the left universal binding sequence (120) comprises sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO:200) or its complementary sequence.

[0278] In some embodiments, in any covalently closed circular molecule (600) described herein, the library molecule includes a left universal binding sequence for a sequencing primer (140), wherein the left universal binding sequence comprises a sequence

[0279] 5'-ACACTCTTTCCCTACACGACCGCTTCCGATCT-3' (SEQ ID NO: 204).

[0280] In some embodiments, in any covalently closed circular molecule (600) described herein, the library molecule includes a left universal binding sequence for a sequencing primer (140), wherein the left universal binding sequence comprises a sequence

[0281] 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 207).

[0282] In some embodiments, in any covalently closed circular molecule (600) described herein, the library molecule includes a left universal binding sequence for a sequencing primer (140), wherein the left universal binding sequence comprises a sequence

[0283] 5'-CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT-3' (SEQ ID NO: 208).

[0284] In some embodiments, in any covalently closed circular molecule (600) described herein, the library molecule includes a left universal binding sequence for a sequencing primer (150), wherein the left universal binding sequence comprises a sequence

[0285] 5'-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3' (SEQ ID NO: 205).

[0286] In some embodiments, in any covalently closed circular molecule (600) described herein, the library molecule includes a left universal binding sequence for a sequencing primer (150), wherein the left universal binding sequence comprises a sequence

[0287] 5'-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3' (SEQ ID NO: 209).

[0288] In some embodiments, in any covalently closed circular molecule (600) described herein, the library molecule includes a left universal binding sequence for a sequencing primer (150), wherein the left universal binding sequence comprises a sequence

[0289] 5'-ATGTCGGAAGGTTGTGCAGGCTACCGCTTGTCAACT-3' (SEQ ID NO: 210).

[0290] In some embodiments, in any covalently closed circular molecule (600) described herein, the library molecule includes a right universal binding sequence (130) comprising the sequence 5'-TCGTATGCCGTCTTCTGCTTG-3' (SEQ ID NO:206).

[0291] In some embodiments, in any covalently closed circular molecule (600) described herein, the library molecule includes a right universal binding sequence (130) that binds to the first region (330) of the first splint chain, wherein the right universal binding sequence (130) comprises sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO:201) or its complementary sequence.

[0292] This disclosure provides a reaction mixture comprising a plurality of any of the covalently closed circular molecules (600) described herein and at least one exonuclease. In some embodiments, the exonuclease comprises any one or any combination of two or more of exonuclease I, thermostable exonuclease I, and / or T7 exonuclease.

[0293] Reagent kit containing double-stranded splints

[0294] This disclosure provides a kit for introducing one or more novel adaptor sequences into a linear nucleic acid library molecule. In some embodiments, the kit can be used to circularize a single-stranded nucleic acid library molecule having a target sequence (110) with at least a first left universal adaptor sequence (120) on one side and at least a first right universal adaptor sequence (130) on the other side. In some embodiments, the circularized library molecule can be converted into a covalently closed circular molecule, which can undergo rolling circle amplification (RCA) to generate nucleic acid polymers. The polymers can be immobilized on a support for massively parallel sequencing.

[0295] This disclosure provides a kit comprising a double-stranded nucleic acid splint adaptor (200), comprising: (i) a first splint strand (long splint strand (300)) hybridized with (ii) a second splint strand (short splint strand (400)). The first splint strand comprises a first region (320), an inner region (310), and a second region (330). The inner region (310) of the first splint strand hybridizes with the second splint strand (400) to form a double-stranded splint adaptor (200) having a double-stranded region and two side-jointed single-stranded regions. The second splint strand (400) includes a novel adaptor sequence that can be introduced into a linear nucleic acid library molecule. An exemplary double-stranded splint adaptor is shown in Figure 1-7 The kit may include a container containing a first splint chain (300) that hybridizes with a second splint chain (400). The kit may also include a first container containing the first splint chain (300) and a second container containing the second splint chain (400).

[0296] In some embodiments, in the kit, the second clamp chain (400) comprises at least two sub-regions, including first and second sub-regions (e.g., see...). Figure 2 and 3The first subregion contains a universal binding sequence for the third surface primer, and the second subregion contains a universal binding sequence for the fourth surface primer, wherein the first and second subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the second splint chain (400) further includes an optional third subregion comprising a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases (e.g., see [link to relevant documentation]). Figure 3 In some embodiments, the second splint chain (400) contains only one subregion and lacks a second and third subregion, wherein the first subregion contains a sample index sequence having 5-20 bases. In some embodiments, the sample index sequence can be used to distinguish target sequences obtained from different sample sources in multiplex assays. In some embodiments, the unique identification sequence contains a random sequence. The unique identification sequence can be designed to exhibit reduced hybridization or no hybridization with the first, second, third, and fourth surface primers. An exemplary arrangement of the subregions in the second splint chain (400) in the 5' to 3' direction includes: 5'-[second subregion]–[first subregion]–3'. Another exemplary arrangement of the subregions in the second splint chain (400) in the 5' to 3' direction includes: 5'-[third subregion]–[second subregion]–[first subregion]–3'. Exemplary first splint chains (300) and second splint chains (400) are shown in Figure 2 and 3 In some embodiments, the second splint chain (400) may be 20-100 nucleotides long, 30-80 nucleotides long, or 40-60 nucleotides long. In some embodiments, the second splint chain (400) includes one or more phosphate thioester bonds at the 5' and / or 3' ends to confer exonuclease resistance. In some embodiments, the second splint chain (400) includes one or more phosphate thioester bonds at the internal position to confer endonuclease resistance. In some embodiments, the second splint chain (400) includes one or more 2'-O-methylcytosine bases at the 5' and / or 3' ends or at the internal position. In some embodiments, the 5' end of the second splint chain (400) is phosphorylated or non-phosphorylated. In some embodiments, the 3' end of the second splint chain (400) includes a terminal 3'OH group or a terminal 3' blocking group.

[0297] In some embodiments, in the kit, the first splint chain (300) comprises a first region (320), a second region (330), and an inner region (310). The first region (320) comprises a first universal adaptor sequence that can hybridize with a first universal binding sequence at one end of a linear nucleic acid library molecule. The second region (330) comprises a second universal adaptor sequence that can hybridize with a second universal binding sequence at the other end of a linear nucleic acid library molecule. In some embodiments, the first region (320) of the first splint chain includes a first universal adaptor sequence comprising a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for a first or second surface primer, a universal binding sequence for forward or reverse amplification primers, or a universal binding sequence for compacted oligonucleotides. In some embodiments, the second region (330) of the first splint chain includes a second universal adaptor sequence comprising a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for a first or second surface primer, a universal binding sequence for forward or reverse amplification primers, or a universal binding sequence for compacted oligonucleotides. In some embodiments, the length of the first splint chain (300) may be 50-150 nucleotides, 60-100 nucleotides, or 70-90 nucleotides. In some embodiments, the first splint chain (300) includes one or more phosphate thioester bonds at its 5' and / or 3' ends to confer exonuclease resistance. In some embodiments, the first splint chain (300) includes one or more phosphate thioester bonds at its internal position to confer endonuclease resistance. In some embodiments, the first splint chain (300) includes one or more 2'-O-methylcytosine bases at its 5' and / or 3' ends or at its internal position. In some embodiments, the 5' end of the first splint chain (300) is phosphorylated or non-phosphorylated. In some embodiments, the 3' end of the first splint chain (300) includes a terminal 3'OH group or a terminal 3' blocking group.

[0298] In some embodiments, in the kit, the first clamp chain (300) includes an inner region (310) containing at least two sub-regions, including a fourth and a fifth sub-region (e.g., Figure 2 and 3The fourth subregion hybridizes with the first subregion of the second splint chain (400). The fifth subregion hybridizes with the second subregion of the second splint chain (400). The fourth and fifth subregions do not hybridize with the first and second surface primers (or at least show very little hybridization). In some embodiments, the inner region (310) of the first splint chain further includes an optional sixth subregion that hybridizes with the third subregion of the second splint chain (400). An exemplary arrangement of the subregions of the first splint chain (300) in the 5' to 3' direction includes: 5' – [fourth subregion] – [fifth subregion] – 3'. Another exemplary arrangement of the subregions of the first splint chain (300) in the 5' to 3' direction includes: 5' – [fourth subregion] – [fifth subregion] – [sixth subregion] – 3'. An exemplary first splint chain (300) is shown in Figure 2 and 3 middle.

[0299] In some embodiments, in any of the kits described herein, the first subregion of the second splint chain (400) contains the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO:200). In some embodiments, the second subregion of the second splint chain (400) contains the sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO:201). In some embodiments, the second splint chain (400) comprises first and second subregions containing the sequence

[0300] 5'-AGTCGTCGCAGCCTCACCTGATCCATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 202). See Figure 10 In some embodiments, the 5' end of the second clamp chain (400) may be phosphorylated or non-phosphorylated.

[0301] In some embodiments, in any kit described herein, the first region (320) of the first splint chain includes a first universal adaptor sequence containing a universal binding sequence (or its complementary sequence) against the first surface primer, wherein the first region (320) contains the sequence 5'-TCGGTGGTCGCCGTATCATT-3' (SEQ ID NO: 193). For example, the first region (320) of the first splint chain may hybridize with a P5 surface primer or a complementary sequence of a P5 surface primer. For example, the P5 surface primer contains the sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 203; short P5), or the P5 surface primer contains the sequence 5'-AATGATACGGCGACCACCGAGATC-3' (SEQ ID NO: 194; long P5). In some embodiments, the second region (330) of the first splint chain includes a second universal adaptor sequence containing a universal binding sequence (or its complementary sequence) against the second surface primer, wherein the second region (330) contains the sequence 5'-TCGGTGGTCGCCGTATCATT-3' (SEQ ID NO: 194; long P5).

[0302] 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 195). For example, the second region (330) of the first splint chain can hybridize with a P7 surface primer or a complementary sequence of a P7 surface primer. For example, the P7 surface primer contains the sequence 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 195; short P7), or the P7 surface primer contains the sequence 5'-CAAGCAGAAGACGGCATACGAGAT-3' (SEQ ID NO: 196; long P7). In some embodiments, the first splint chain (300) includes an inner region (310) which contains a fourth subregion having the following sequence.

[0303] 5'-ACCCTGAAAGTACGTGCATTACATG-3' (SEQ ID NO: 197). In some embodiments, the first clamp chain (300) includes an inner region (310) containing a fifth sub-region having the sequence 5'-GATCAGGTGAGGCTGCGACGACT'3' (SEQ ID NO: 198). In some embodiments, the first clamp chain (300) includes a first region (320), an inner region (310) having a fourth and a fifth sub-region, and a second region (330) having the sequence 5'-TCGGTGGTCGCCGTATCATTACCCTGAAAGTACGTGCATTACATGGATCAGGTGAG GCTGCGACGACTCAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 199). See also Figure 10In some embodiments, the 5' end of the first splint chain (300) may be phosphorylated or unphosphorylated. In some embodiments, a first subregion of the second splint chain (400) may hybridize with a fourth subregion of the first splint chain (300). In some embodiments, a second subregion of the second splint chain (400) may hybridize with a fifth subregion of the first splint chain (300).

[0304] In some embodiments, in any of the kits described herein, the first region (320) of the first splint chain contains a sequence of a first left universal adaptor sequence (120) capable of binding the library molecule, wherein the first region (320) of the first splint chain contains the sequence 5'-ACCCTGAAAGTACGTGCATTACATG-3' (SEQ ID NO:197) or its complementary sequence.

[0305] In some embodiments, in any of the kits described herein, the second region (330) of the first splint chain contains a sequence of a first right universal adaptor sequence (130) capable of binding the library molecule, wherein the second region splint chain (330) of the first splint chain contains sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO:198) or its complementary sequence.

[0306] In some embodiments, the kit further comprises an adaptor having a left universal binding sequence (120) that binds to a first region (320) of a first splint strand for preparing a plurality of library molecules, wherein the library molecules will contain the sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO:203). The adaptor may be a single-stranded adaptor (e.g., a PCR primer), a double-stranded adaptor, a bubble adaptor, or a Y-shaped adaptor.

[0307] In some embodiments, in any kit described herein, the library molecule includes a left universal binding sequence (120) that binds to a first region (320) of a first splint chain, wherein the left universal binding sequence (120) comprises sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO:200) or its complementary sequence.

[0308] In some embodiments, the kit further comprises an adaptor having a left universal binding sequence for the sequencing primer (140) for preparing multiple library molecules, wherein the library molecules will contain the sequence

[0309] 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' (SEQ ID NO: 204). In some embodiments, the adaptor having a left universal binding sequence for the sequencing primer (140) also includes a sample index sequence (160). The adaptor may be a single-stranded adaptor (e.g., a PCR primer), a double-stranded adaptor, a bubble adaptor, or a Y-shaped adaptor.

[0310] In some embodiments, the kit further comprises an adaptor having a left universal binding sequence for the sequencing primer (140) for preparing multiple library molecules, wherein the library molecules will contain the sequence

[0311] 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 207). In some embodiments, the adaptor having a left universal binding sequence for the sequencing primer (140) also includes a sample index sequence (160). The adaptor may be a single-stranded adaptor (e.g., a PCR primer), a double-stranded adaptor, a bubble adaptor, or a Y-shaped adaptor.

[0312] In some embodiments, the kit further comprises an adaptor having a left universal binding sequence for the sequencing primer (140) for preparing multiple library molecules, wherein the library molecules will contain the sequence

[0313] 5'-CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT-3' (SEQ ID NO: 208). In some embodiments, the adaptor having a left universal binding sequence for the sequencing primer (140) also includes a sample index sequence (160). The adaptor may be a single-stranded adaptor (e.g., a PCR primer), a double-stranded adaptor, a bubble adaptor, or a Y-shaped adaptor.

[0314] In some embodiments, the kit further comprises an adaptor having a right universal binding sequence for the sequencing primer (150) for preparing multiple library molecules, wherein the library molecules will contain the sequence

[0315] 5'-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3' (SEQ ID NO: 205). In some embodiments, the adaptor having a right universal binding sequence for the sequencing primer (150) also includes a sample index sequence (170). The adaptor may be a single-stranded adaptor (e.g., a PCR primer), a double-stranded adaptor, a bubble adaptor, or a Y-shaped adaptor.

[0316] In some embodiments, the kit further comprises an adaptor having a right universal binding sequence for the sequencing primer (150) for preparing multiple library molecules, wherein the library molecules will contain the sequence

[0317] 5'-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3' (SEQ ID NO: 209). In some embodiments, the adaptor having a right universal binding sequence for the sequencing primer (150) also includes a sample index sequence (170). The adaptor may be a single-stranded adaptor (e.g., a PCR primer), a double-stranded adaptor, a bubble adaptor, or a Y-shaped adaptor.

[0318] In some embodiments, the kit further comprises an adaptor having a right universal binding sequence for the sequencing primer (150) for preparing multiple library molecules, wherein the library molecules will contain the sequence

[0319] 5'-ATGTCGGAAGGTGTGCAGGCTACCGCTTGTCAACT-3' (SEQ ID NO: 210). In some embodiments, the adaptor having a right universal binding sequence for the sequencing primer (150) also includes a sample index sequence (170). The adaptor may be a single-stranded adaptor (e.g., a PCR primer), a double-stranded adaptor, a bubble adaptor, or a Y-shaped adaptor.

[0320] In some embodiments, the kit further comprises an adaptor having a right universal binding sequence (130) that binds to a first region (330) of a first splint strand for preparing a plurality of library molecules, wherein the library molecules will contain the sequence 5'-TCGTATGCCGTCTTCTGCTTG-3' (SEQ ID NO: 206). The adaptor may be a single-stranded adaptor (e.g., a PCR primer), a double-stranded adaptor, a bubble adaptor, or a Y-shaped adaptor.

[0321] In some embodiments, in any kit described herein, the library molecule includes a right universal binding sequence (130) that binds to a first region (330) of a first splint chain, wherein the right universal binding sequence (130) comprises sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO:201) or its complementary sequence.

[0322] In some embodiments, the kit further comprises a plurality of first left indices (160) and / or a plurality of first right index sequences (170). In some embodiments, the kit may include a separate container containing a single first left index (160) or a single first right index (170). In some embodiments, the kit may include a separate container containing a pair of single first left indices (160) and a single first right index (170). In some embodiments, the kit comprises a first left index (160) and / or a plurality of first right index sequences (170) located in a multi-well plate (e.g., a 96-well plate). A list of exemplary first left index sequences (160) and first right index sequences (170) is provided in Figures 23A-23F The first left index sequence (160) may include a random sequence (e.g., NNN) or lack a random sequence. The first right index sequence (170) may include a random or random sequence (e.g., NNN) or lack a random sequence.

[0323] In some embodiments, the kit comprises a double-stranded intercalation linker (200) and further comprises T4 polynucleotide kinase. In some embodiments, the kit further comprises a ligase, wherein the ligase comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase. In some embodiments, the kit further comprises at least one endonuclease, comprising any one or any combination of two or more of exonuclease I, thermostable exonuclease I, and / or T7 exonuclease.

[0324] In some embodiments, the kit contains at least one buffer for hybridizing multiple double-stranded splint adaptors (200) and multiple nucleic acid library molecules (100). In some embodiments, the kit contains a buffer for performing multiplex enzymatic reactions in a single reaction vessel, including (i) phosphorylation of the 5' end of a first and / or second splint strand (e.g., (300) and / or (400)), (ii) ligation of a gap in a library-splice complex (500), and / or (iii) exonuclease digestion of the first splint strand (300) from a covalently closed circular molecule (600). Alternatively, the kit contains two or more separate buffers, wherein a first buffer is used for phosphorylation, a second buffer is used for ligation, and a third buffer is used for exonuclease digestion.

[0325] In some embodiments, the kit comprises one or more containers containing any of the double-stranded splint adaptors (200) or any of the first splint strands (300) and second splint strands (400) described herein. The kit may further comprise one or more containers containing T4 polynucleotide kinase, at least one ligase, and / or at least one exonuclease. The kit may contain any of these components in any combination and may be contained in a single container, or in separate containers, or any combination thereof.

[0326] The kit may include instructions for using the kit to perform a reaction to introduce one or more novel adaptor sequences into a linear nucleic acid library molecule.

[0327] Methods for forming multiple library-sandwich complexes

[0328] This disclosure provides a method for forming a plurality of library-splice complexes (500), comprising: (a) providing a plurality of double-stranded splint connectors (200), wherein each of the plurality of double-stranded splint connectors (200) includes a first splint chain (300) hybridized with a second splint chain (400), wherein the double-stranded splint connector includes a double-stranded region and two side-connected single-stranded regions, wherein the first splint chain includes a first region (320), an inner region (310), and a second region (330), and wherein the inner region (310) of the first splint chain hybridizes with the second splint chain (400). An exemplary double-stranded splint connector (200) is shown in Figure 1-7 middle.

[0329] The method for forming multiple library-sandwich complexes (500) further includes step (b): hybridizing multiple double-stranded sandwich adaptors with multiple single-stranded nucleic acid library molecules (100), wherein each library molecule includes a target sequence (110) that is top-side attached to at least a first left universal adaptor sequence (120) on one side and top-side attached to at least a first right universal adaptor sequence (130) on the other side (e.g., Figure 1-7 Hybridization is performed under conditions suitable for hybridizing the first region (320) of the first splint chain with at least the first left universal connective sequence (120) of the library molecule, and these conditions are also suitable for hybridizing the second region (330) of the first splint chain with at least the first right universal sequence (130) of the library molecule, thereby circulating the plurality of library molecules to form a plurality of library-splice complexes (500).

[0330] In some embodiments, in a method for forming multiple library-sandwich complexes (500), a first region (320) of a first sandwich chain includes a first universal adaptor sequence that can hybridize with a first universal binding sequence at one end of a linear nucleic acid library molecule. In some embodiments, the first region (320) of the first sandwich chain includes a first universal adaptor sequence comprising a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for a first or second surface primer, a universal binding sequence for forward or reverse amplification primers, or a universal binding sequence for compacted oligonucleotides. In some embodiments, the 5' end of the first sandwich chain (300) is phosphorylated or lacks a phosphate group. In some embodiments, the 3' end of the first sandwich chain (300) includes a terminal 3' OH group or a terminal 3' blocking group.

[0331] In some embodiments, in a method for forming multiple library-sandwich complexes (500), a second region (330) of the first sandwich chain includes a second universal adaptor sequence that can hybridize with a second universal binding sequence at the other end of a linear nucleic acid library molecule. In some embodiments, the second region (330) of the first sandwich chain includes a second universal adaptor sequence comprising a universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for first or second surface primers, a universal binding sequence for forward or reverse amplification primers, or a universal binding sequence for compacted oligonucleotides. In some embodiments, the 5' end of the second sandwich chain (400) is phosphorylated or lacks a phosphate group. In some embodiments, the 3' end of the second sandwich chain (400) includes a terminal 3' OH group or a terminal 3' blocking group.

[0332] In some embodiments, in a method for forming a plurality of library-splice complexes (500), a first region (320) of a first splint chain hybridizes with at least a first left universal connective sequence (120) of a library molecule, and a second region (330) of the first splint chain hybridizes with at least a first right universal sequence (130) of a library molecule, thereby circulating the library molecule to produce the library-splice complex (500). The library-splice complex (500) includes a first notch (e.g., between the 5' end of the library molecule and the 3' end of the second splint chain) Figure 1-7 The library-sandwich complex (500) also includes a second notch between the 5' end of the second sandwich chain and the 3' end of the library molecule (e.g., Figure 1-7 In some embodiments, the first and second gaps are enzymatically linked.

[0333] In some embodiments, in the method for forming multiple library-sandwich complexes (500), a first region (320) of the first sandwich strand may hybridize with the sense or antisense strand of a double-stranded nucleic acid library molecule. In the library-sandwich complex (500), a second region (330) of the first sandwich strand may hybridize with the sense or antisense strand of a double-stranded nucleic acid library molecule. The double-stranded nucleic acid library molecule may be denatured to generate single-stranded sense and antisense library strands.

[0334] In some embodiments, in the method for forming a plurality of library-sandwich complexes (500), the second sandwich chain (400) does not hybridize with the target sequence (110), and the internal region (310) of the first sandwich chain does not hybridize with the target sequence (110).

[0335] In some embodiments, in the method for forming a plurality of library-sandwich complexes (500), the first region (320) of the first sandwich chain does not hybridize with the target sequence (110), and the second region (330) of the first sandwich chain does not hybridize with the target sequence (110).

[0336] In some embodiments, in the method for forming a plurality of library-sandwich complexes (500), the 5' end of the single-chain library molecule (100) is phosphorylated or lacks a phosphate group. In some embodiments, the 3' end of the single-chain library molecule includes a terminal 3'OH group or a terminal 3' blocking group.

[0337] In some embodiments, in the method for forming a plurality of library-sandwich complexes (500), the nucleic acid library molecule (100) further comprises a second left universal adaptor sequence (140). In some embodiments, the nucleic acid library molecule (100) further comprises a second right universal adaptor sequence (150). In some embodiments, the nucleic acid library molecule (100) may further comprise additional left and / or right universal adaptor sequences.

[0338] In some embodiments, in the method for forming multiple library-sandwich complexes (500), the nucleic acid library molecule (100) further comprises a first left index sequence (160). In some embodiments, the nucleic acid library molecule (100) further comprises a first right index sequence (170). In some embodiments, the first left index sequence (160) comprises a sample index sequence. In some embodiments, the first right index sequence (170) comprises another sample index sequence. The sample index sequence can be used to distinguish target sequences obtained from different sample sources in multiplex assays. A list of exemplary first left index sequences (160) and first right index sequences (170) is provided in [the relevant section]. Figures 23A-23FThe first left index sequence (160) may include a random sequence (e.g., NNN) or lack a random sequence. The first right index sequence (170) may include a random sequence (e.g., NNN) or lack a random sequence.

[0339] A multiplex workflow is initiated by preparing a sample-indexed library using one or two index sequences (e.g., left and / or right index sequences). Individual sample-indexed libraries can be prepared using input nucleic acids isolated from different sources, using a first left index sequence (160) and / or a first right index sequence (170). Sample-indexed libraries can be pooled together to generate a multiplex library mixture, and the pooled libraries can be amplified and / or sequenced. The sequence of the insert region, along with the first left index sequence (160) and / or the first right index sequence (170), can be used to identify the source of the input nucleic acid. In some embodiments, any number of sample-indexed libraries can be pooled together, for example, 2-10, 10-50, 50-100, 100-200, or more than 200 sample-indexed libraries can be pooled. Exemplary nucleic acid sources include naturally occurring, recombinant, or chemically synthesized sources. Exemplary nucleic acid sources include single cells, multiple cells, tissues, biological fluids, environmental samples, or whole organisms. Exemplary sources of nucleic acids include fresh, frozen, fresh-frozen, or archived sources (e.g., formalin-fixed paraffin-embedded; FFPE). Those skilled in the art will recognize that nucleic acids can be isolated from many other sources. Nucleic acid libraries can be prepared in single-stranded or double-stranded form.

[0340] In some embodiments, in the method for forming a plurality of library-sandwich complexes (500), the nucleic acid library molecule (100) further comprises: a first left unique identifier sequence (180). In some embodiments, the nucleic acid library molecule (100) further comprises a first right unique identifier sequence (190). In some embodiments, the first left unique identifier sequence (180) and the first right unique identifier sequence (190) each comprise a sequence segment used to uniquely identify, within other target molecule populations, each target sequence (e.g., an insert sequence) to which a unique adaptor is attached. In some embodiments, the first left unique identifier sequence (180) and / or the first right unique identifier sequence (190) may be used as a molecular marker.

[0341] In some embodiments, in the method for forming a plurality of library-sandwich complexes (500), the nucleic acid library molecule (100) comprises any one or any combination of two or more of the following: a first left universal adaptor sequence (120); a second left universal adaptor sequence (140); a first left index sequence (160); a first left unique identifier sequence (180); a first right universal adaptor sequence (130); a second right universal adaptor sequence (150); a first right index sequence (170); and / or a first right unique identifier sequence (190).

[0342] In some embodiments, in the method for forming multiple library-sandwich complexes (500), the first left universal adaptor sequence (120) and / or the second left universal adaptor sequence (140) comprise: a universal binding sequence for forward or reverse sequencing primers; a universal binding sequence for the first or second surface primers; a universal binding sequence for forward or reverse amplification primers; and / or a universal binding sequence for compacted oligonucleotides. In some embodiments, the nucleic acid library molecule (100) may further comprise additional left universal adaptor sequences.

[0343] In some embodiments, in the method for forming multiple library-sandwich complexes (500), the first right universal adaptor sequence (130) and / or the second right universal adaptor sequence (150) comprise: a universal binding sequence for forward or reverse sequencing primers; a universal binding sequence for the first or second surface primers; a universal binding sequence for forward or reverse amplification primers; and / or a universal binding sequence for compacted oligonucleotides. In some embodiments, the nucleic acid library molecule (100) may further comprise additional right universal adaptor sequences.

[0344] In some embodiments, in the method for forming a plurality of library-sandwich complexes (500), the nucleic acid library molecule (100) further comprises at least one conjugating adaptor sequence located between any of the universal adaptor sequences described herein (e.g., see [link to relevant documentation]). Figure 7For example, the first left-joint connector sequence (125) may be located between the first left universal connector sequence (120) and the first left index sequence (160). The second left-joint connector sequence (165) may be located between the first left index sequence (160) and the second left universal connector sequence (140). The third connector sequence (145) may be located between the second left universal connector sequence (140) and the target sequence (110). The first right-joint connector sequence (135) may be located between the first right universal sequence (130) and the first right index sequence (170). The second right-joint connector sequence (175) may be located between the first right index sequence (170) and the second right universal connector sequence (150). The third right-joint connector sequence (155) may be located between the second right universal connector sequence (150) and the target sequence (110). In some embodiments, the nucleic acid library molecule (100) further comprises at least one and up to ten additional universal adaptor sequences located at the 5' (upstream) of the first left universal adaptor sequence (120) (e.g., see...). Figure 7 In some embodiments, the nucleic acid library molecule (100) further comprises at least one and up to ten additional universal adaptor sequences located at the 3' (downstream) of the first right universal sequence (130) (e.g., see...). Figure 7Any conjugating adaptor sequence and / or additional universal adaptor sequence contains any sequence and may be 3-60 nucleotides in length. Any conjugating adaptor sequence and / or additional universal adaptor sequence contains a universal or unique sequence. Any conjugating adaptor sequence and / or additional universal adaptor sequence contains a binding sequence for amplification primers, sequencing primers, or compacted oligonucleotides. Any conjugating adaptor sequence and / or additional universal adaptor sequence contains a binding sequence for immobilized surface primers (e.g., capture primers). Any conjugating adaptor sequence and / or additional universal adaptor sequence contains a sample index sequence. Any conjugating adaptor sequence and / or additional universal adaptor sequence contains a unique identification sequence. Any conjugating adaptor sequence and / or additional universal adaptor sequence, particularly the conjugating adaptor sequence (145), contains the Tn5 transposon end sequence 5'-AGATGTGTATAAGAGACAG-3' (SEQ ID NO:211). Any conjugating adaptor sequence and / or an additional universal adaptor sequence, particularly the conjugating adaptor sequence (155), contains the Tn5 transposon end sequence 5'-CTGTCTCTTATACACATCT-3' (SEQ ID NO:212). The Tn5 transposon end sequence can be introduced into the library molecule (100) via a transposase-mediated reaction under conditions suitable for forming a transposon synaptic complex. This reaction involves contacting double-stranded input DNA (e.g., genomic DNA) with a Tn-5 type transposase and a double-stranded oligonucleotide containing a Tn transposon end sequence (SEQ ID NO:211) linked to a universal adaptor sequence or a sample index sequence. In the double-stranded oligonucleotide, the Tn transposon end sequence (SEQ ID NO:211) may be located at 5' or 3' relative to the universal adaptor sequence or the sample index sequence.

[0345] In some embodiments, in the method for forming a plurality of library-sandwich composites (500), the second sandwich chain (400) comprises at least two sub-regions, including first and second sub-regions (e.g., Figure 2 and 3 The first subregion contains a universal binding sequence for the third surface primer, and the second subregion contains a universal binding sequence for the fourth surface primer, wherein the first and second subregions do not hybridize with the first and second surface primers (or at least exhibit very little hybridization). In some embodiments, the second splint chain (400) further includes a selected third subregion comprising a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases (e.g., ...). Figure 3In some embodiments, the second splint chain (400) contains only one subregion and lacks a second and third subregion, wherein the first subregion contains a sample index sequence having 5-20 bases. In some embodiments, the sample index sequence can be used to distinguish target sequences obtained from different sample sources in multiplex assays. In some embodiments, the unique identification sequence comprises a random sequence. The unique identification sequence can be designed to exhibit reduced hybridization or no hybridization with the first, second, third, and fourth surface primers. An exemplary arrangement of the subregions in the second splint chain (400) in the 5' to 3' direction includes: 5'-[second subregion]–[first subregion]–3'. Another exemplary arrangement of the subregions in the second splint chain (400) in the 5' to 3' direction includes: 5'-[third subregion]–[second subregion]–[first subregion]–3'. In some embodiments, the length of the second splint chain (400) may be 20-100 nucleotides, 30-80 nucleotides, or 40-60 nucleotides. In some embodiments, the second splint chain (400) includes one or more phosphate thioester bonds at its 5' and / or 3' ends to confer resistance to exonucleases. In some embodiments, the second splint chain (400) includes one or more phosphate thioester bonds at its internal position to confer resistance to endonucleases. In some embodiments, the second splint chain (400) includes one or more 2'-O-methylcytosine bases at its 5' and / or 3' ends or at its internal position. In some embodiments, the 5' end of the second splint chain (400) is phosphorylated or non-phosphorylated. In some embodiments, the 3' end of the second splint chain (400) includes a terminal 3'OH group or a terminal 3' blocking group.

[0346] In some embodiments, in the method for forming a plurality of library-sandwich complexes (500), the first sandwich chain (300) includes an inner region (310) comprising at least two sub-regions, including a fourth and a fifth sub-region (e.g., Figure 2 and 3 The fourth subregion hybridizes with the first subregion of the second splint chain (400). The fifth subregion hybridizes with the second subregion of the second splint chain (400). The fourth and fifth subregions do not hybridize with the first and second surface primers (or at least show very little hybridization). In some embodiments, the inner region (310) of the first splint chain further includes an optional sixth subregion that hybridizes with the third subregion of the second splint chain (400) (e.g., Figure 3An exemplary arrangement of the subregions of the first splint chain (300) in the 5' to 3' direction comprises: 5' – [fourth subregion] – [fifth subregion] – 3'. Another exemplary arrangement of the subregions of the first splint chain (300) in the 5' to 3' direction comprises: 5' – [fourth subregion] – [fifth subregion] – [sixth subregion] – 3'. In some embodiments, the length of the first splint chain (300) may be 50-150 nucleotides, 60-100 nucleotides, or 70-90 nucleotides. In some embodiments, the first splint chain (300) includes one or more phosphate thioester bonds at the 5' and / or 3' ends to confer exonuclease resistance. In some embodiments, the first splint chain (300) includes one or more phosphate thioester bonds at an internal location to confer endonuclease resistance. In some embodiments, the first splint chain (300) includes one or more 2'-O-methylcytosine bases at the 5' and / or 3' ends or at an internal location.

[0347] This disclosure provides a method for forming multiple library-sandwich complexes (500), comprising: (a) providing multiple double-stranded sandwich adapters (200), wherein each double-stranded sandwich adapter (200) includes a first sandwich chain (300) hybridizing with a second sandwich chain (400), wherein the first sandwich chain (300) includes regions arranged in a 5' to 3' order: a first region (320), an inner region (310), and a second region (330), and wherein the inner region (310) of the first sandwich chain hybridizes with the second sandwich chain (400), wherein the second sandwich chain includes regions arranged in a 5' to 3' order: (i) a second subregion having a universal binding sequence for a fourth surface primer, and (ii) a first subregion having a universal binding sequence for a third surface primer. The method for forming multiple library-sandwich complexes (500) further includes step (b): hybridizing multiple double-stranded sandwich adaptors with multiple single-stranded nucleic acid library molecules (100), wherein each library molecule contains regions arranged in a 5' to 3' order: (i) a first left universal adaptor sequence (120) having a binding sequence for a first surface primer; (ii) a second left universal adaptor sequence (140) having a binding sequence for a first sequencing primer; (iii) a target sequence (110); (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer; and (v) a first right universal adaptor sequence (130) having a binding sequence for a second surface primer (130), wherein the hybridization The hybridization is performed under conditions suitable for hybridizing the first splint strand (300) with the library molecule (100), thereby circulating the library molecule to produce a library-splice complex (500), such that a first region (320) of the first splint strand hybridizes with a binding sequence for a first surface primer (120), and a third region (330) of the first splint strand hybridizes with a binding sequence (130) for a second surface primer, wherein the library-splice complex (500) contains a first gap between the 5' end of the library molecule and the 3' end of the second splint strand (300), wherein the library-splice complex (500) contains a second gap between the 5' end of the second splint strand (300) and the 3' end of the library molecule (100), and wherein the first and second gaps are enzymatically ligated. In some embodiments, the plurality of single-stranded nucleic acid library molecules (100) further contain a first left index sequence (160) and / or a first right index sequence (170) (e.g., see...). Figure 5 A list of exemplary first left index sequences (160) and first right index sequences (170) is provided in Figures 23A-23FProvided in Table 1. In some embodiments, the first left index sequence (160) includes or lacks a short random sequence (e.g., NNN). In some embodiments, the first right index sequence (170) includes or lacks a short random sequence (e.g., NNN). In some embodiments, a plurality of single-stranded nucleic acid library molecules (100) further include a first left unique identifier sequence (180) and / or a first right unique identifier sequence (190), which are used to uniquely identify, in other populations of target molecules, each target sequence (e.g., an insert sequence) to which a unique adaptor is attached. In some embodiments, the first left unique identifier sequence (180) and / or the first right unique identifier sequence (190) can be used as a molecular marker. (See, for example, see...) Figure 6 ).

[0348] A multiplex workflow is initiated by preparing a sample-indexed library using one or two index sequences (e.g., left and / or right index sequences). Individual sample-indexed libraries can be prepared using input nucleic acids isolated from different sources, using a first left index sequence (160) and / or a first right index sequence (170). Sample-indexed libraries can be pooled together to generate a multiplex library mixture, and the pooled libraries can be amplified and / or sequenced. The sequence of the insert region, along with the first left index sequence (160) and / or the first right index sequence (170), can be used to identify the source of the input nucleic acid. In some embodiments, any number of sample-indexed libraries can be pooled together, for example, 2-10, 10-50, 50-100, 100-200, or more than 200 sample-indexed libraries can be pooled. Exemplary nucleic acid sources include naturally occurring, recombinant, or chemically synthesized sources. Exemplary nucleic acid sources include single cells, multiple cells, tissues, biological fluids, environmental samples, or whole organisms. Exemplary sources of nucleic acids include fresh, frozen, fresh-frozen, or archived sources (e.g., formalin-fixed paraffin-embedded; FFPE). Those skilled in the art will recognize that nucleic acids can be isolated from many other sources. Nucleic acid libraries can be prepared in single-stranded or double-stranded form.

[0349] In some embodiments, the plurality of single-stranded nucleic acid library molecules (100) further comprise a first left-unique identifier sequence (180) and / or a first right-unique identifier sequence (190) (e.g., see Figure 5 and 6 In some embodiments, the first left unique identifier sequence (180) and the first right unique identifier sequence (190) each comprise a sequence segment used to uniquely identify, within other target molecular populations, each target sequence (e.g., an insertion sequence) to which a unique adaptor is attached. In some embodiments, the first left unique identifier sequence (180) and / or the first right unique identifier sequence (190) can be used as a molecular marker.

[0350] In some embodiments, in any method for forming the plurality of library-splice complexes (500) described herein, a first subregion of the second splint chain (400) comprises the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 200). In some embodiments, a second subregion of the second splint chain (400) comprises the sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO: 201). In some embodiments, the second splint chain (400) comprises first and second subregions comprising the sequence 5'-AGTCGTCGCAGCCTCACCTGATCCATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 202). See also Figure 10 In some embodiments, the 5' end of the second clamp chain (400) may be phosphorylated or non-phosphorylated.

[0351] In some embodiments, in any method for forming the plurality of library-sandwich complexes (500) described herein, a first region (320) of the first sandwich chain includes a first universal linker sequence containing a binding sequence (or its complementary sequence) against a first surface primer, wherein the first region (320) contains the sequence 5'-TCGGTGGTCGCCGTATCATT-3' (SEQ ID NO: 193). For example, the first region (320) of the first sandwich chain may hybridize with a P5 surface primer or a complementary sequence of a P5 surface primer. For example, the P5 surface primer contains the sequence 5'-TCGGTGGTCGCCGTATCATT-3'.

[0352] 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO:203; short P5), or the P5 surface primer contains the sequence 5'-AATGATACGGCGACCACCGAGATC-3' (SEQ ID NO:194; long P5). In some embodiments, the second region (330) of the first splint chain includes a second universal adaptor sequence containing a universal binding sequence (or its complementary sequence) against the second surface primer, wherein the second region (330) contains the sequence 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO:195). For example, the second region (330) of the first splint chain can hybridize with the P7 surface primer or its complementary sequence. For example, the P7 surface primer contains the sequence 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO:195; short P7), or the P7 surface primer contains the sequence 5'-CAAGCAGAAGACGGCATACGAGAT-3' (SEQ ID NO:196; long P7). In some embodiments, the first clamp chain (300) includes an inner region (310) containing a fourth subregion having the following sequence.

[0353] 5'-ACCCTGAAAGTACGTGCATTACATG-3' (SEQ ID NO: 197). In some embodiments, the first clamp chain (300) includes an inner region (310) containing a fifth sub-region having the sequence 5'-GATCAGGTGAGGCTGCGACGACT'3' (SEQ ID NO: 198). In some embodiments, the first clamp chain (300) includes a first region (320), an inner region (310) having a fourth and a fifth sub-region, and a second region (330) having the sequence 5'-TCGGTGGTCGCCGTATCATTACCCTGAAAGTACGTGCATTACATGGATCAGGTGAG GCTGCGACGACTCAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 199). See also Figure 10 In some embodiments, the 5' end of the first splint chain (300) may be phosphorylated or unphosphorylated. In some embodiments, a first subregion of the second splint chain (400) may hybridize with a fourth subregion of the first splint chain (300). In some embodiments, a second subregion of the second splint chain (400) may hybridize with a fifth subregion of the first splint chain (300).

[0354] In some embodiments, in any method for forming the plurality of library-sandwich complexes (500) described herein, a first region (320) of a first sandwich chain contains a sequence capable of binding a first left universal adaptor sequence (120) of a library molecule, wherein the first region (320) of the first sandwich chain contains the sequence 5'-ACCCTGAAAGTACGTGCATTACATG-3' (SEQ ID NO: 197) or its complementary sequence.

[0355] In some embodiments, in any method for forming the plurality of library-sandwich complexes (500) described herein, a second region (330) of the first sandwich chain contains a sequence capable of binding a first right universal adaptor sequence (130) of a library molecule, wherein the second region (330) of the first sandwich chain contains sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO: 198) or its complementary sequence.

[0356] In some embodiments, in any method for forming the plurality of library-sandwich complexes (500) described herein, the library molecule includes a first left universal binding sequence (120) that binds to a first region (320) of a first sandwich chain, wherein the left universal binding sequence (120) comprises sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO:203).

[0357] In some embodiments, in any method for forming the plurality of library-sandwich complexes (500) described herein, the library molecule includes a first left universal binding sequence (120) that binds to a first region (320) of a first sandwich chain, wherein the left universal binding sequence (120) comprises sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO:200) or its complementary sequence.

[0358] In some embodiments, in any method for forming the plurality of library-sandwich complexes (500) described herein, the library molecule includes a left universal binding sequence (140) for sequencing primers, wherein the left universal binding sequence comprises sequence 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' (SEQ ID NO:204).

[0359] In some embodiments, in any method for forming the plurality of library-sandwich complexes (500) described herein, the library molecule includes a left universal binding sequence (140) for sequencing primers, wherein the left universal binding sequence comprises sequence 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO:207).

[0360] In some embodiments, in any method for forming the plurality of library-sandwich complexes (500) described herein, the library molecule includes a left universal binding sequence (140) for sequencing primers, wherein the left universal binding sequence comprises sequence 5'-CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT-3' (SEQ ID NO:208).

[0361] In some embodiments, in any method for forming the plurality of library-sandwich complexes (500) described herein, the library molecule includes a left universal binding sequence (150) for sequencing primers, wherein the left universal binding sequence comprises sequence 5'-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3' (SEQ ID NO:205).

[0362] In some embodiments, in any method for forming the plurality of library-sandwich complexes (500) described herein, the library molecule includes a left universal binding sequence (150) for sequencing primers, wherein the left universal binding sequence comprises sequence 5'-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3' (SEQ ID NO:209).

[0363] In some embodiments, in any method for forming the plurality of library-sandwich complexes (500) described herein, the library molecule includes a left universal binding sequence (150) for sequencing primers, wherein the left universal binding sequence comprises sequence 5'-ATGTCGGAAGGTGTGCAGGCTACCGCTTGTCAACT-3' (SEQ ID NO:210).

[0364] In some embodiments, in any method for forming the plurality of library-sandwich complexes (500) described herein, the library molecule includes a right universal binding sequence (130) that binds to a first region (330) of a first sandwich chain, wherein the right universal binding sequence (130) comprises a sequence

[0365] 5'-TCGTATGCCGTCTTCTGCTTG-3' (SEQ ID NO: 206).

[0366] In some embodiments, in any method for forming the plurality of library-sandwich complexes (500) described herein, the library molecule includes a right universal binding sequence (130) that binds to a first region (330) of a first sandwich chain, wherein the right universal binding sequence (130) comprises sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO:201) or its complementary sequence.

[0367] In some embodiments, any method for forming the plurality of library-sandwich complexes (500) described herein may further include at least one enzymatic reaction, including phosphorylation, ligation, and / or exonuclease reactions. The enzymatic reactions may be performed sequentially or substantially simultaneously. The enzymatic reactions may be performed in a single reaction vessel. Alternatively, a first enzymatic reaction may be performed in a first reaction vessel, followed by transfer to a second reaction vessel for a second enzymatic reaction, and then to a third reaction vessel for a third enzymatic reaction.

[0368] In some embodiments, any method for forming the plurality of library-sandwich complexes (500) described herein further includes performing separate and sequential phosphorylation and ligation reactions in separate reaction vessels. In some embodiments, the method for forming the plurality of library-sandwich complexes (500) further includes step (c1): contacting the plurality of double-stranded sandwich initiators (200) and the plurality of single-stranded nucleic acid library molecules (100) with T4 polynucleotide kinase in a first reaction vessel under conditions suitable for phosphorylating the 5' ends of the plurality of double-stranded sandwich initiators (200) and / or the plurality of single-stranded nucleic acid library molecules (100); and transferring the phosphorylation reaction to a second reaction vessel. In some embodiments, the method for forming a plurality of library-sandwich complexes (500) further includes step (d1): in a second reaction vessel, under conditions suitable for enzymatic ligation of the first and second gaps, contacting a plurality of phosphorylated double-stranded sandwich adaptors (200) and a plurality of phosphorylated single-stranded nucleic acid library molecules (100) with a ligase, thereby generating a plurality of covalently closed circular library molecules (600), each covalently closed circular library molecule hybridizing with a first sandwich strand (300). In some embodiments, the ligase comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0369] In some embodiments, any method for forming the plurality of library-sandwich complexes (500) described herein further includes performing sequential phosphorylation and ligation reactions, said reactions being carried out sequentially in the same reaction vessel. In some embodiments, the method for forming the plurality of library-sandwich complexes (500) further includes step (c2): contacting the plurality of double-stranded sandwich initiators (200) and the plurality of single-stranded nucleic acid library molecules (100) with T4 polynucleotide kinase in a first reaction vessel under conditions suitable for phosphorylating the 5' ends of the plurality of double-stranded sandwich initiators (200) and the plurality of single-stranded nucleic acid library molecules (100). In some embodiments, the method for forming a plurality of library-sandwich complexes (500) further includes step (d2): in the same first reaction vessel, under conditions suitable for enzymatic ligation of the first and second gaps, contacting a phosphorylated double-stranded sandwich adaptor (200) and a phosphorylated single-stranded nucleic acid library molecule (100) with a ligase, thereby generating a plurality of covalently closed circular library molecules (600), each covalently closed circular library molecule hybridizing with a first sandwich strand (300). In some embodiments, the ligase comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0370] In some embodiments, any method for forming the plurality of library-sandwich complexes (500) described herein further comprises performing substantially simultaneous phosphorylation and ligation reactions together in the same reaction vessel. In some embodiments, the method for forming the plurality of library-sandwich complexes (500) further comprises step (c3): under conditions suitable for phosphorylating the 5' ends of a plurality of double-stranded sandwich adaptors (200) and a plurality of single-stranded nucleic acid library molecules (100), and these conditions being suitable for enzymatic ligation of the first and second gaps, in a first reaction vessel, contacting the plurality of double-stranded sandwich adaptors (200) and a plurality of single-stranded nucleic acid library molecules (100) with (i) a T4 polynucleotide kinase and (ii) a ligase, thereby generating a plurality of covalently closed circular library molecules (600), each covalently closed circular library molecule hybridizing with a first sandwich strand (300). In some embodiments, the ligase comprises a T7 DNA ligase, a T3 ligase, a T4 ligase, or a Taq ligase.

[0371] In some embodiments, any method for forming the plurality of library-sandwich complexes (500) described herein may further include the optional step of enzymatically removing a plurality of first sandwich chains (300) from a plurality of covalently closed circular library molecules (600), comprising: contacting the plurality of covalently closed circular library molecules (600) with at least one exonuclease to remove the plurality of first sandwich chains (300) and retain the plurality of covalently closed circular library molecules (600). In some embodiments, the exonuclease reaction may be performed in the same reaction buffer used for phosphorylation and / or ligation reactions, or in different reaction buffers. In some embodiments, the exonuclease reaction may be performed in a third reaction container after phosphorylation (c1) in a first reaction container and ligation (d1) in a second reaction container. In some embodiments, the exonuclease reaction may be performed in a first reaction container after phosphorylation (c2) in a first reaction container and sequential ligation (d2) in a first reaction container. In some embodiments, the exonuclease reaction may be performed in a first reaction container after substantially simultaneous phosphorylation and ligation (c3) in a first reaction container. In some embodiments, the at least one exonuclease comprises any combination of two or more of exonuclease I, thermostable exonuclease I, and / or T7 exonuclease.

[0372] Rolling circle amplification method

[0373] This disclosure provides a method for rolling circle amplification (ROA) of a covalently closed circular library molecule (600). The ROA can be performed after phosphorylation and ligation reactions, or after ligation reactions. In some embodiments, the ROA can be performed after an exonuclease reaction, at which point the covalently closed circular library molecule (600) no longer hybridizes with the first splint strand (300). In some embodiments, the ROA can be performed on a covalently closed circular library molecule (600) that has hybridized with the first splint strand (300). In some embodiments, the covalently closed circular library molecule (600) can be distributed onto a support before the ROA is performed. In some embodiments, the covalently closed circular library molecule (600) can be ROA performed in solution and then distributed onto a support. In some embodiments, the ROA can use the retained first splint strand (300) as the amplification primer, or the first splint strand (300) can be removed (e.g., by exonuclease digestion) and replaced with soluble amplification primers.

[0374] Rolling circle amplification on support

[0375] In some embodiments, a method for rolling circle amplification of a plurality of covalently closed circular libraries lacking a first splint chain (300), wherein each of the plurality of covalently closed circular libraries (600) comprises a second splint chain region (400) including a universal binding sequence for a fourth surface primer, the method comprising (a) distributing the plurality of covalently closed circular libraries (600) onto a support on which a plurality of fourth surface primers are immobilized, under conditions suitable for hybridizing the respective covalently closed circular libraries (600) with respective immobilized fourth surface primers, thereby immobilizing the plurality of covalently closed circular libraries (600).

[0376] In some embodiments, a plurality of fourth surface primers immobilized on a support comprise the sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO: 198). Each fourth surface primer can hybridize with a covalently closed circular library molecule (600) having a second splint chain region (400) comprising a universal binding sequence for the fourth surface primer, wherein the universal binding sequence for the fourth surface primer comprises a second subregion comprising the sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO: 201).

[0377] In some embodiments, a plurality of covalently closed cyclic library molecules (600) may be distributed onto a support coated with one or more compounds to create a passivation layer on the support (e.g., Figure 11In some embodiments, the passivation layer forms a porous or semi-porous layer. In some embodiments, surface primers, multiply template molecules, and / or polymerases may be attached to the passivation layer to immobilize them to the support. In some embodiments, the support comprises a low-nonspecificity binding surface that can improve nucleic acid hybridization and amplification performance on the support. Generally, the support may comprise one or more layers of covalently or non-covalently attached low-binding chemically modified layers, such as silane layers, polymer membranes, and one or more covalently or non-covalently attached oligonucleotides that may be used to immobilize multiple nucleic acid multiply molecules to the support. In some embodiments, the support may comprise a functionalized polymer coating that is covalently bound to at least a portion of the support via chemical groups on the support, primers grafted to the functionalized polymer coating, and a water-soluble protective coating on the primers and the functionalized polymer coating. In some embodiments, the functionalized polymer coating comprises poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide (PAZAM). In some embodiments, the support comprises a surface coating having at least one layer of hydrophilic polymer coating and at least one layer of multiple oligonucleotides. The hydrophilic polymer coating may comprise polyethylene glycol (PEG). The hydrophilic polymer coating may comprise branched PEG having at least four branches. In some embodiments, the low nonspecific binding coating has a degree of hydrophilicity that can be measured by the water contact angle, wherein the water contact angle does not exceed 45 degrees. In some embodiments, the density of covalently closed cyclic library molecules (600) immobilized to or onto the support is about 10. 2 -10 6 pcs / mm 2 or about 10 6 -10 9 pcs / mm 2 or about 10 9 -10 12 pcs / mm 2 In some embodiments, a plurality of covalently closed circular library molecules (600) are fixed to the support or the coating on the support at predetermined sites on the support (or the coating on the support); or fixed to random sites on the support (or the coating on the support).

[0378] In some embodiments, the distribution in step (a) can be performed in the presence of a high-efficiency hybridization buffer comprising: (i) a first polar aprotic solvent having a dielectric constant not greater than 40 and a polarity index of 4-9; (ii) a second polar aprotic solvent having a dielectric constant not greater than 115 and present in the hybridization buffer formulation in an amount that effectively denatures double-stranded nucleic acids; (iii) a pH buffer system that maintains the pH of the hybridization buffer formulation in the range of about 4-8; and (iv) a crowding agent in an amount sufficient to enhance or promote molecular crowding. In some embodiments, the high-efficiency hybridization buffer comprises: (i) a first polar aprotic solvent comprising acetonitrile at 25-50% of the hybridization buffer volume; (ii) a second polar aprotic solvent comprising formamide at 5-10% of the hybridization buffer volume; (iii) a pH buffer system comprising 2-(N-morpholino)ethanesulfonic acid (MES) at a pH of 5-6.5; and (iv) a crowding agent comprising polyethylene glycol (PEG) at 5-35% of the hybridization buffer volume. In some embodiments, the high-efficiency hybridization buffer further comprises betaine.

[0379] In some embodiments, the method of performing rolling circle amplification further includes step (b): under conditions suitable for using a plurality of fourth surface primers as immobilized amplification primers and using a plurality of covalently closed circular library molecules (600) as template molecules, and performing rolling circle amplification on a support, contacting the plurality of immobilized covalently closed circular library molecules (600) with a plurality of chain displacement polymerases and a plurality of nucleotides, thereby generating a plurality of nucleic acid polymer molecules immobilized to the fourth surface primers. In some embodiments, the plurality of nucleotides include any combination of two or more of dATP, dGTP, dCTP, dTTP, and / or dUTP. In some embodiments, each immobilized polymer is covalently bound to a respective fourth surface primer. In some embodiments, each covalently closed circular library molecule (600) in the plurality of covalently closed circular library molecules includes a second splint chain region (400), which also includes a universal binding sequence for the fourth surface primer, such that the rolling circle amplification reaction generates polymer molecules having multiple copies of universal binding sequences for the third and fourth surface primers. In some embodiments, the method includes: distributing a covalently closed circular library molecule (600) onto a support comprising a plurality of fixed third and fourth surface primers; performing a rolling circle amplification reaction under conditions suitable for hybridizing at least one second splint region (400) of the polyp molecule with the fixed fourth surface primer to generate a polyp molecule, thereby immobilizing at least a portion of the polyp molecule onto the support. In some embodiments, the immobilized polyp can be subjected to a sequencing reaction.

[0380] In some embodiments, a plurality of fourth surface primers immobilized on a support comprise the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 200) or its complementary sequence. A single fourth surface primer can hybridize with a portion of a multiply molecule having a second splint chain region (400) comprising a universal binding sequence (or its complementary sequence) for the fourth surface primer, wherein the universal binding sequence for the fourth surface primer comprises a first subregion comprising the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 200) or its complementary sequence.

[0381] In-solution rolling circle amplification was performed using soluble amplification primers.

[0382] In some embodiments, a method for performing rolling circle amplification on a plurality of covalently closed circular library molecules lacking a first splint chain (300), wherein each of the plurality of covalently closed circular library molecules (600) comprises a first (120) or a second (140) left universal adaptor sequence having a universal binding sequence for a forward amplification primer, and wherein each of the plurality of covalently closed circular library molecules (600) comprises a second splint chain region (400) including a universal binding sequence for a fourth surface primer, the method comprising: (a) in solution The method involves (a) hybridizing multiple soluble forward amplification primers with a first or second left universal adaptor sequence, the first or second left universal adaptor sequence containing a universal binding sequence for the forward amplification primers; and (b) performing a first rolling circle amplification reaction by contacting the multiple covalently closed circular library molecules (600) with multiple strand displacement polymerases and multiple nucleotides under conditions suitable for using multiple forward amplification primers and using multiple covalently closed circular library molecules (600) as template molecules, thereby generating multiple nucleic acid polymolecules that still hybridize with the covalently closed circular library molecules (600). In some embodiments, the method for performing the rolling circle amplification reaction further includes step (c): distributing the multiple polymolecules onto a support on which the multiple fourth surface primers are immobilized under conditions suitable for hybridizing at least a portion of the polymolecules with multiple fixed fourth surface primers, thereby immobilizing the multiple polymolecules. The multiple fixed polymolecules still hybridize with the covalently closed circular library molecules (600). In some embodiments, the method for performing rolling circle amplification further includes step (d): under conditions suitable for using a plurality of covalently closed circular library molecules (600) as template molecules to perform a second rolling circle amplification reaction on a support, contacting a plurality of immobilized multiply molecules with a plurality of strand displacement polymerases and a plurality of nucleotides, thereby extending a plurality of immobilized nucleic acid multiply molecules. In some embodiments, the first and / or second rolling circle amplification reactions can be performed with a plurality of nucleotides comprising any combination of two or more of dATP, dGTP, dCTP, dTTP, and / or dUTP. In some embodiments, each immobilized multiply hybridizes with a respective fourth surface primer. In some embodiments, each covalently closed circular library molecule (600) in the plurality of covalently closed circular library molecules includes a second splint chain region (400), which also includes a universal binding sequence for the fourth surface primer, such that the first rolling circle amplification reaction in solution generates multiply molecules having multiple copies of the universal binding sequences for the third and fourth surface primers.In some embodiments, the method includes distributing the polyp molecules onto a support comprising a plurality of fixed third and fourth surface primers, and incubating the polyp molecules under conditions suitable for hybridizing at least one second splint chain region (400) of the polyp molecules with the fixed third and fourth surface primers, thereby immobilizing at least a portion of the polyp molecules onto the support. In some embodiments, the immobilized polyp can be subjected to a sequencing reaction.

[0383] In some embodiments, the plurality of polyp molecules from step (c) may be distributed onto a support comprising a plurality of fourth surface primers immobilized thereon, the fourth surface primers comprising the sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO: 198). Each fourth surface primer may hybridize with a portion of a polyp molecule having a universal binding sequence for the fourth surface primer, wherein the universal binding sequence for the fourth surface primer comprises the sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO: 201 or its complementary sequence).

[0384] In some embodiments, the plurality of polyp molecules from step (c) may be distributed onto a support comprising a plurality of fourth surface primers immobilized thereon, the fourth surface primers comprising the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO:200 or its complementary sequence). Each fourth surface primer may hybridize with a portion of a polyp molecule having a universal binding sequence (or its complementary sequence) for the fourth surface primer, wherein the universal binding sequence of the fourth surface primer comprises the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO:200) or its complementary sequence.

[0385] In some embodiments, the plurality of polymolecules from step (c) can be distributed onto a support coated with one or more compounds to create a passivation layer on the support (e.g., Figure 11In some embodiments, the passivation layer forms a porous or semi-porous layer. In some embodiments, surface primers, multiply template molecules, and / or ...

Claims

1. A library-splint complex (500), comprising: (i) a single-stranded nucleic acid library molecule (100) comprising a sequence of interest (110) flanked on one side by at least a first left universal adaptor sequence (120) and on another side by at least a first right universal adaptor sequence (130); and (ii) a double-stranded splint adaptor (200), comprising a first splint strand (long splint strand (300)) and a second splint strand (short splint strand (400)), wherein the double-stranded splint adaptor (200) comprises a double-stranded region and two flanking single-stranded regions, wherein the first splint strand comprises a first region (320), an internal region (310) and a second region (330); wherein the internal region (310) of the first splint chain hybridizes with the second splint chain (400), wherein the first region (320) of the first splint chain hybridizes with at least the first left universal adapter sequence (120) of the library molecule, and wherein the second region (330) of the first splint chain hybridizes with at least the first right universal sequence (130) of the library molecule, thereby circularizing the library molecule to produce a library-splint complex (500).

2. The library-splint complex (500) according to claim 1, wherein the nucleic acid library molecule (100) further comprises: a second left universal adapter sequence (140).

3. The library-splint complex (500) according to claim 1, wherein the nucleic acid library molecule (100) further comprises: a second right universal adapter sequence (150).

4. The library-splint complex (500) according to claim 1, wherein the nucleic acid library molecule (100) further comprises: a first left index sequence (160).

5. The library-splint complex (500) according to claim 1, wherein the nucleic acid library molecule (100) further comprises: a first right index sequence (170).

6. The library-splint complex (500) according to claim 1, wherein the nucleic acid library molecule (100) further comprises: a first left unique identification sequence (180).

7. The library-splint complex (500) according to claim 1, wherein the nucleic acid library molecule (100) further comprises: a first unique identification sequence (190).

8. The library-splint complex (500) according to claim 1, wherein the nucleic acid library molecule (100) further comprises any one of the following or any combination of two or more thereof: (i) a second left universal adapter sequence (140); (ii) a second right universal adaptor sequence (150); (iii) a first left index sequence (160); (iv) a first right index sequence (170); (v) a first left unique identification sequence (180); and / or (vi) First right unique identification sequence (190).

9. The library-splint complex (500) of claim 1, wherein the first left universal adapter sequence (120) and / or the second left universal adapter sequence (140) comprises: (i) universal binding sequence for forward sequencing primer; (ii) universal binding sequence for reverse sequencing primer; (iii) a universal binding sequence for the first surface primer; (iv) a universal binding sequence for a second surface primer; (v) universal binding sequence for forward amplification primer; (vi) a universal binding sequence for a reverse amplification primer; and / or (vii) Universal binding sequences for compacted oligonucleotides.

10. The library-splint complex (500) of claim 1, wherein the first right universal adapter sequence (130) and / or the second right universal adapter sequence (150) comprises: (i) universal binding sequence for forward sequencing primer; (ii) universal binding sequence for reverse sequencing primer; (iii) a universal binding sequence for the first surface primer; (iv) a universal binding sequence for a second surface primer; (v) universal binding sequence for forward amplification primer; (vi) a universal binding sequence for a reverse amplification primer; and / or (vii) Universal binding sequences for compacted oligonucleotides.

11. A library-splint complex (500) according to claim 9 or 10, wherein the second splint chain (400) comprises at least two sub-regions: a first sub-region comprising a universal binding sequence for a third surface primer; and a second sub-region comprising a universal binding sequence for a fourth surface primer, wherein the first sub-region and the second sub-region do not hybridize with the first surface primer and the second surface primer (or at least exhibit very little hybridization).

12. The library-splint complex (500) according to claim 11, wherein the second splint chain (400) further comprises an optional third sub-region, wherein the optional third sub-region comprises a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases.

13. The library-splint complex (500) according to claim 9 or 10, wherein the first splint strand (300) comprises an internal region (310) comprising at least two sub-regions: a fourth sub-region comprising a universal binding sequence for a third surface primer, and the fourth sub-region hybridizes with the first sub-region of the second splint strand (400); and a fifth sub-region comprising a universal binding sequence for a fourth surface primer, and said fifth sub-region hybridizing with said second sub-region of said second splint strand (400); The fourth sub-region and the fifth sub-region do not hybridize to the first surface primer and the second surface primer (or at least show very little hybridization).

14. The library-splint complex (500) according to claim 13, wherein the first splint chain (300) includes an internal region (310), the internal region further comprising a sixth sub-region, the sixth sub-region comprising a sample index sequence having 5-20 bases and / or a unique identification sequence having 2-10 or more bases (e.g., NN), wherein the sixth sub-region hybridizes with the third sub-region of the second splint chain (400).

15. A library-splint complex (500), comprising: a) a single-stranded nucleic acid library molecule (100), comprising components arranged in 5' to 3' order: (i) a first left universal adapter sequence (120), which has a binding sequence for a first surface primer (120); (ii) a second left universal adapter sequence (140), which has a binding sequence for a first sequencing primer; (iii) a target sequence (110); (iv) a second right universal adapter sequence (150), which has a binding sequence for a second sequencing primer; and (v) a first right universal adapter sequence (130), which has a binding sequence for a second surface primer (130); b) a first splint chain (300) comprising components arranged in 5' to 3' order: a first zone (320); an inner zone (310); and a second zone (330); and c) a second splint strand (400) comprising sub-regions arranged in 3' to 5' order: a first sub-region having a universal binding sequence for a third surface primer; and a second sub-region having a universal binding sequence for a fourth surface primer; wherein the first splint strand (300) hybridizes with a portion of the library molecule (100), thereby looping the library molecule to produce a library-splint complex (500), such that the first region (320) of the first splint strand hybridizes with the binding sequence (120) for the first surface primer, and the third region (330) of the first splint strand hybridizes with the binding sequence (130) for the second surface primer, wherein the second splint strand (400) hybridizes to the internal region (310) of the first splint strand (300), wherein the library-splint complex (500) comprises a first gap between the 5' end of the library molecule and the 3' end of the second splint strand, wherein the library-splint complex (500) comprises a second gap between the 5' end of the second splint strand and the 3' end of the library molecule, and wherein the first gap and the second gap are enzymatically ligatable.

16. The library-splint complex (500) according to any one of the preceding claims, further comprising a plurality of library-splint complexes (500), wherein the target sequence (110) of each library-splint complex in the plurality of library-splint complexes comprises the same target sequence or different target sequences.

17. A reaction mixture comprising a plurality of library-splint complexes (500) according to claim 16 and T4 polynucleotide kinase.

18. A reaction mixture comprising a plurality of library-splint complexes (500) according to claim 16 and a ligase.

19. A reaction mixture comprising a plurality of library-splint complexes (500) according to claim 16, T4 polynucleotide kinase and a ligase.

20. The reaction mixture of claim 18 or 19, wherein the ligase comprises T7 DNA ligase, T3 ligase, T4 ligase or Taq ligase.

21. A covalently closed circular library molecule (600), comprising: a target sequence (110), at least a first left universal adapter sequence (120), at least a first right universal adapter sequence (130) and a second splint strand sequence (400).

22. The covalently closed circular library molecule (600) of claim 21, further comprising: a second left universal adaptor sequence (140).

23. The covalently closed circular library molecule (600) of claim 21, further comprising: a second right universal adaptor sequence (150).

24. The covalently closed circular library molecule (600) of claim 21, further comprising: a first left index sequence (160).

25. The covalently closed circular library molecule (600) of claim 21, further comprising: a first right index sequence (170).

26. The covalently closed circular library molecule (600) of claim 21, further comprising: a first left unique recognition sequence (180).

27. The covalently closed circular library molecule (600) of claim 21, further comprising: a first right unique recognition sequence (190).

28. The covalently closed circular library molecule (600) according to claim 21, further comprising any one or any combination of two or more of the following: (i) a second left universal adapter sequence (140); (ii) a second right universal adaptor sequence (150); (iii) a first left index sequence (160); (iv) a first right index sequence (170); (v) a first left unique identification sequence (180); and / or (vi) First right unique identification sequence (190).

29. The covalently closed circular library molecule (600) according to claim 21, wherein the first left universal adapter sequence (120) and / or the second left universal adapter sequence (140) comprises: (i) universal binding sequence for forward sequencing primer; (ii) universal binding sequence for reverse sequencing primer; (iii) a universal binding sequence for the first surface primer; (iv) a universal binding sequence for a second surface primer; (v) universal binding sequence for forward amplification primer; (vi) a universal binding sequence for a reverse amplification primer; and / or (vii) Universal binding sequences for compacted oligonucleotides.

30. The covalently closed circular library molecule (600) of claim 21, wherein the first right universal adapter sequence (130) and / or the second right universal adapter sequence (150) comprises: (i) universal binding sequence for forward sequencing primer; (ii) universal binding sequence for reverse sequencing primer; (iii) a universal binding sequence for the first surface primer; (iv) a universal binding sequence for a second surface primer; (v) universal binding sequence for forward amplification primer; (vi) a universal binding sequence for a reverse amplification primer; and / or (vii) Universal binding sequences for compacted oligonucleotides.

31. A covalently closed circular library molecule (600) according to any one of claims 21-30, which is hybridized with a first splint chain (long splint chain (300)), wherein the first splint chain comprises a first region (320), an internal region (310) and a second region (330), wherein the second splint chain sequence (400) of the covalently closed circular library molecule is hybridized with the internal region (310) of the first splint chain, wherein the first region (320) of the first splint chain is hybridized with at least the first left universal adapter sequence (120) of the library molecule, and wherein the second region (330) of the first splint chain is hybridized with at least the first right universal sequence (130) of the library molecule.

32. A covalently closed circular library molecule (600) according to claim 31, wherein the second splint chain (400) comprises at least two sub-regions: a first sub-region comprising a universal binding sequence for a third surface primer; and a second sub-region comprising a universal binding sequence for a fourth surface primer, wherein the first sub-region and the second sub-region do not hybridize with the first surface primer and the second surface primer (or at least exhibit very little hybridization).

33. A covalently closed circular library molecule (600) according to claim 32, wherein the second splint chain (400) further comprises an optional third sub-region, wherein the optional third sub-region comprises a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases.

34. The covalently closed circular library molecule (600) of claim 31, wherein the first splint strand (300) comprises an internal region (310), the internal region comprising at least two subregions: a fourth subregion comprising a universal binding sequence for a third surface primer, and the fourth subregion hybridizes with the first subregion of the second splint strand (400); and a fifth sub-region comprising a universal binding sequence for a fourth surface primer, and said fifth sub-region hybridizing with said second sub-region of said second splint strand (400); The fourth sub-region and the fifth sub-region do not hybridize to the first surface primer and the second surface primer (or at least show very little hybridization).

35. A covalently closed circular library molecule (600) according to claim 34, wherein the first splint chain (300) includes an internal region (310), the internal region further comprising a sixth sub-region, the sixth sub-region comprising a sample index sequence having 5-20 bases and / or a unique identification sequence having 2-10 or more bases (e.g., NN), wherein the sixth sub-region hybridizes with the third sub-region of the second splint chain (400).

36. A single-stranded covalently closed circular molecule (600), comprising: (i) a first left universal adapter sequence (120), which has a binding sequence (120) for a first surface primer; (ii) a second left universal adapter sequence (140), which has a binding sequence for a first sequencing primer; (iii) a target sequence (110); (iv) a second right universal adapter sequence (150), which has a binding sequence for a second sequencing primer; (v) a first right universal adapter sequence (130), which has a binding sequence (130) for a second surface primer; and (vi) a second splint chain (400), wherein the covalently closed circular molecule (600) is optionally hybridized with the first splint chain (300).

37. The covalently closed circular library molecule (600) according to any one of claims 21-36, further comprising a plurality of covalently closed circular library molecules (600), wherein the target sequence (110) of each covalently closed circular library molecule (600) in the plurality of covalently closed circular library molecules comprises the same target sequence or different target sequences.

38. A reaction mixture comprising a plurality of covalently closed circular library molecules (600) according to claim 36, wherein each covalently closed circular library molecule (600) is hybridized to a first splint strand (300).

39. The reaction mixture of claim 38, comprising the plurality of covalently closed circular library molecules (600) and at least one exonuclease.

40. The reaction mixture of claim 38, wherein the exonuclease comprises Exonuclease I, Thermolabile Exonuclease I, or T7 Exonuclease.

41. A kit comprising: A double-stranded splint adapter (200), wherein the double-stranded splint adapter comprises (i) a first cleat chain (long cleat chain (300)), and (ii) a second splint chain (short splint chain (400)), wherein the first splint chain (300) can hybridize with the second splint chain (400) to form a double-stranded region and two flanking single-stranded regions, wherein the first splint chain (300) comprises a first region (320), an internal region (310) and a second region (330), and wherein the internal region (310) of the first splint chain can hybridize with the second splint chain (400).

42. A kit according to claim 41, wherein the first splint chain (300) and the second splint chain (400) hybridize with each other to form a double-stranded splint linker (200) having a double-stranded region and two flanking single-stranded regions, and wherein the internal region (310) of the first splint chain can hybridize with the second splint chain (400).

43. A kit according to claim 41 or 42, which is used to circularize a single-stranded nucleic acid library molecule (100) having a target sequence (110), wherein the target sequence is flanked on one side by at least a first left universal adapter sequence (120) and on the other side by at least a first right universal adapter sequence (130).

44. A kit according to claim 43, wherein the first region (320) of the first splint chain can hybridize with at least the first left universal adapter sequence (120) of the library molecule (100), and wherein the second region (330) of the first splint chain can hybridize with at least the first right universal sequence (130) of the library molecule.

45. The kit according to claim 43, wherein at least the first left universal adaptor sequence (120) of the library molecule (100) comprises: (i) universal binding sequence for forward sequencing primer; (ii) universal binding sequence for reverse sequencing primer; (iii) a universal binding sequence for the first surface primer; (iv) a universal binding sequence for a second surface primer; (v) universal binding sequence for forward amplification primer; (vi) a universal binding sequence for a reverse amplification primer; and / or (vii) Universal binding sequences for compacted oligonucleotides.

46. ​​The kit of claim 43, wherein at least the first right universal adaptor sequence (130) of the library molecule (100) comprises: (i) universal binding sequence for forward sequencing primer; (ii) universal binding sequence for reverse sequencing primer; (iii) a universal binding sequence for the first surface primer; (iv) a universal binding sequence for a second surface primer; (v) universal binding sequence for forward amplification primer; (vi) a universal binding sequence for a reverse amplification primer; and / or (vii) Universal binding sequences for compacted oligonucleotides.

47. A kit according to claim 43, wherein the second splint chain (400) comprises at least two sub-regions: a first sub-region comprising a universal binding sequence for a third surface primer; and a second sub-region comprising a universal binding sequence for a fourth surface primer, wherein the first sub-region and the second sub-region do not hybridize with the first surface primer and the second surface primer (or at least exhibit very little hybridization).

48. A kit according to claim 47, wherein the second splint chain (400) further comprises an optional third sub-region, wherein the optional third sub-region comprises a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases.

49. The kit according to claim 43, wherein the first splint strand (300) comprises an internal region (310) comprising at least two subregions: a fourth subregion comprising a universal binding sequence for a third surface primer, and the fourth subregion hybridizes with the first subregion of the second splint strand (400); and a fifth sub-region comprising a universal binding sequence for a fourth surface primer, and said fifth sub-region hybridizing with said second sub-region of said second splint strand (400); The fourth sub-region and the fifth sub-region do not hybridize to the first surface primer and the second surface primer (or at least show very little hybridization).

50. A kit according to claim 49, wherein the first splint chain (300) includes an internal region (310), the internal region further comprising a sixth sub-region, the sixth sub-region comprising a sample index sequence having 5-20 bases and / or a unique identification sequence having 2-10 or more bases (e.g., NN), wherein the sixth sub-region hybridizes with the third sub-region of the second splint chain (400).

51. The kit of any one of claims 41-50, further comprising T4 polynucleotide kinase.

52. The kit of any one of claims 41-50, further comprising a ligase.

53. The kit of any one of claims 41-50, further comprising T4 polynucleotide kinase and ligase.

54. The kit of claim 52 or 53, wherein the ligase comprises T7 DNA ligase, T3 ligase, T4 ligase or Taq ligase.

55. A method for forming a plurality of library-splint complexes (500), comprising: a) providing a plurality of double-stranded splint adaptors, wherein each double-stranded splint adaptor (200) comprises a first splint strand (300) hybridized to a second splint strand (400), wherein the double-stranded splint adaptor comprises a double-stranded region and two flanking single-stranded regions, wherein the first splint strand comprises a first region (320), an internal region (310) and a second region (330), and wherein the internal region (310) of the first splint strand hybridizes to the second splint strand (400); as well as b) hybridizing the plurality of double-stranded splint adaptors with a plurality of single-stranded nucleic acid library molecules (100), wherein each library molecule comprises a target sequence (110) flanked on one side by at least a first left universal adaptor sequence (120) and on the other side by at least a first right universal adaptor sequence (130), wherein the hybridization is performed under conditions suitable for hybridizing the first region (320) of the first splint chain with at least the first left universal adaptor sequence (120) of the library molecule, and the conditions are suitable for hybridizing the second region (330) of the first splint chain with at least the first right universal sequence (130) of the library molecule, thereby looping the plurality of library molecules to form a plurality of library-splint complexes (500).

56. A method according to claim 55, wherein each library splint complex (500) in the plurality of library-splint complexes comprises a first gap between the 5' end of the library molecule and the 3' end of the second splint chain, and wherein each library splint complex (500) in the plurality of library-splint complexes comprises a second gap between the 5' end of the second splint chain and the 3' end of the library molecule.

57. The method of claim 55, wherein each nucleic acid library molecule (100) in the plurality of nucleic acid library molecules further comprises: a second left universal adaptor sequence (140).

58. The method of claim 55, wherein each nucleic acid library molecule (100) in the plurality of nucleic acid library molecules further comprises: a second right universal adaptor sequence (150).

59. The method of claim 55, wherein each nucleic acid library molecule (100) of the plurality of nucleic acid library molecules further comprises: a first left index sequence (160).

60. The method of claim 55, wherein each nucleic acid library molecule (100) of the plurality of nucleic acid library molecules further comprises: a first right index sequence (170).

61. The method according to claim 55, wherein each nucleic acid library molecule (100) in the plurality of nucleic acid library molecules further comprises: a first left unique identification sequence (180).

62. The method of claim 55, wherein each nucleic acid library molecule (100) in the plurality of nucleic acid library molecules further comprises: a first unique identification sequence (190).

63. The method according to claim 55, wherein each nucleic acid library molecule (100) in the plurality of nucleic acid library molecules further comprises any one or any combination of two or more of the following: (i) a second left universal adaptor sequence (140); (ii) a second right universal adaptor sequence (150); (iii) a first left index sequence (160); (iv) a first right index sequence (170); (v) a first left unique identification sequence (180); and / or (vi) First right unique identification sequence (190).

64. The method of claim 55 or 63, wherein the first left universal adapter sequence and / or the second left universal adapter sequence comprises: (i) universal binding sequence for forward sequencing primer; (ii) universal binding sequence for reverse sequencing primer; (iii) a universal binding sequence for the first surface primer; (iv) a universal binding sequence for a second surface primer; (v) universal binding sequence for forward amplification primer; (vi) a universal binding sequence for a reverse amplification primer; and / or (vii) Universal binding sequences for compacted oligonucleotides.

65. The method of claim 55 or 63, wherein the first right universal adapter sequence and / or the second right universal adapter sequence comprises: (i) universal binding sequence for forward sequencing primer; (ii) universal binding sequence for reverse sequencing primer; (iii) a universal binding sequence for the first surface primer; (iv) a universal binding sequence for a second surface primer; (v) universal binding sequence for forward amplification primer; (vi) a universal binding sequence for a reverse amplification primer; and / or (vii) Universal binding sequences for compacted oligonucleotides.

66. A method according to claim 64 or 65, wherein the second splint chain (400) comprises at least two sub-regions: a first sub-region comprising a universal binding sequence for a third surface primer; and a second sub-region comprising a universal binding sequence for a fourth surface primer, wherein the first sub-region and the second sub-region do not hybridize with the first surface primer and the second surface primer (or at least exhibit very little hybridization).

67. The method according to claim 66, wherein the second splint chain (400) further comprises an optional third sub-region, wherein the optional third sub-region comprises a sample index sequence having 5-20 bases and / or a unique identification sequence (e.g., NN) having 2-10 or more bases.

68. The method of claim 64 or 65, wherein the first splint strand (300) comprises an inner region (310) comprising at least two subregions: a fourth subregion comprising a universal binding sequence for a third surface primer, and the fourth subregion hybridizes with the first subregion of the second splint strand (400); and a fifth sub-region comprising a universal binding sequence for a fourth surface primer, and said fifth sub-region hybridizing with said second sub-region of said second splint strand (400); The fourth sub-region and the fifth sub-region do not hybridize to the first surface primer and the second surface primer (or at least show very little hybridization).

69. A method according to claim 68, wherein the first splint chain (300) includes an internal region (310), the internal region further comprising a sixth sub-region, the sixth sub-region comprising a sample index sequence having 5-20 bases and / or a unique identification sequence having 2-10 or more bases (e.g., NN), wherein the sixth sub-region hybridizes with the third sub-region of the second splint chain (400).

70. A method for forming a plurality of library-splint complexes (500), comprising: a) providing a plurality of double-stranded splint adapters (200), wherein each double-stranded splint adapter (200) comprises a first splint strand (300) hybridized to a second splint strand (400), wherein the first splint strand (300) comprises regions arranged in a 5' to 3' order: a first region (320), an internal region (310), and a second region (330), and wherein the internal region (310) of the first splint strand hybridizes to the second splint strand (400), wherein the second splint strand comprises regions arranged in a 5' to 3' order: (i) a second sub-region having a universal binding sequence for a fourth surface primer; and (ii) a first sub-region having a universal binding sequence for a third surface primer; as well as b) hybridizing the plurality of double-stranded splint adapters to a plurality of single-stranded nucleic acid library molecules (100), wherein each library molecule comprises regions arranged in 5' to 3' order: (i) a first left universal adapter sequence (120) having a binding sequence for a first surface primer (120); (ii) a second left universal adapter sequence (140) having a binding sequence for a first sequencing primer; (iii) a target sequence (110); (iv) a second right universal adapter sequence (150) having a binding sequence for a second sequencing primer; and (v) a first right universal adapter sequence (130) having a binding sequence for a second surface primer (130), wherein the hybridization is performed under conditions suitable for hybridizing a portion of the first splint chain (300) with a portion of the library molecule (100), thereby circularizing the library molecule to produce a library-splint complex (500), such that the first region (320) of the first splint chain hybridizes with the binding sequence (120) for the first surface primer, and the third region (330) of the first splint chain hybridizes with the binding sequence (130) for the second surface primer, wherein the library-splint complex (500) comprises a first gap between the 5' end of the library molecule and the 3' end of the second splint chain (300), wherein the library-splint complex (500) comprises a second gap between the 5' end of the second splint chain (300) and the 3' end of the library molecule (100), and wherein the first gap and the second gap are enzymatically ligatable.

71. The method of claim 70, wherein the plurality of single-stranded nucleic acid library molecules (100) further comprises a first left index sequence (160) and / or a first right index sequence (170).

72. The method of claim 70, wherein the plurality of single-stranded nucleic acid library molecules (100) further comprises a first left unique identification sequence (180) and / or a first right unique identification sequence (190).

73. The method of any one of claims 55-72, further comprising:The plurality of double-stranded splint adaptors (200) and the plurality of single-stranded nucleic acid library molecules (100) are contacted with T4 polynucleotide kinase under conditions suitable for phosphorylating the 5' ends of the plurality of double-stranded splint adaptors (200) and / or the plurality of single-stranded nucleic acid library molecules (100).

74. The method of any one of claims 55-72, further comprising: The multiple double-stranded splint adaptors (200) and the multiple single-stranded nucleic acid library molecules (100) are contacted with a ligase under conditions suitable for enzymatically ligating the first gap and the second gap, thereby generating multiple covalently closed circular library molecules (600) each hybridized to the first splint chain (300).

75. The method of any one of claims 55-72, further comprising performing the following sequential steps: a) contacting the plurality of double-stranded splint adaptors (200) and the plurality of single-stranded nucleic acid library molecules (100) with T4 polynucleotide kinase under conditions suitable for phosphorylating the 5′ ends of the plurality of double-stranded splint adaptors (200) and the plurality of single-stranded nucleic acid library molecules (100); and b) contacting the phosphorylated double-stranded splint adaptor (200) and the phosphorylated single-stranded nucleic acid library molecule (100) with a ligase under conditions suitable for enzymatically ligating the first gap and the second gap, thereby generating a plurality of covalently closed circular library molecules (600) each hybridized to the first splint strand (300).

76. The method according to any one of claims 55-72, further comprising performing the following substantially simultaneous steps: contacting the multiple double-stranded splint adaptors (200) and the multiple single-stranded nucleic acid library molecules (100) with (i) T4 polynucleotide kinase and (ii) ligase under conditions suitable for phosphorylating the 5' ends of the multiple double-stranded splint adaptors (200) and the multiple single-stranded nucleic acid library molecules (100), and the conditions are suitable for enzymatically connecting the first gap and the second gap, thereby producing a plurality of covalently closed circular library molecules (600) each hybridized to the first splint chain (300).

77. The method of claim 74, further comprising: The plurality of covalently closed circular library molecules (600) are contacted with at least one exonuclease to remove the plurality of first splint strands (300) and retain the plurality of covalently closed circular library molecules (600).

78. The method of claim 77, wherein the at least one exonuclease comprises Exonuclease I, Thermolabile Exonuclease I and / or T7 Exonuclease.

79. The method of claim 77, wherein each covalently closed circular library molecule (600) of the plurality of covalently closed circular library molecules comprises a second splint strand region (400) comprising a universal binding sequence for a third surface primer, and wherein the method further comprises: The retained plurality of covalently closed circular library molecules (600) are distributed onto a support having a plurality of third surface primers immobilized thereon under conditions suitable for hybridizing each covalently closed circular library molecule (600) to each immobilized third surface primer, thereby immobilizing the plurality of covalently closed circular library molecules (600).

80. The method of claim 79, further comprising: The plurality of immobilized covalently closed circular library molecules (600) are contacted with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction on the support using a plurality of third surface primers as immobilized amplification primers and using the plurality of covalently closed circular library molecules (600) as template molecules, thereby producing a plurality of immobilized nucleic acid concatemer molecules.

81. The method of claim 80, wherein the plurality of nucleotides comprises dATP, dGTP, dCTP, dTTP and / or dUTP.

82. The method of claim 77, wherein the first left universal adapter sequence (120) or the second left universal adapter sequence (140) of each library molecule in the plurality of library molecules comprises a universal binding sequence for a forward amplification primer, and wherein the method further comprises: a) hybridizing a plurality of soluble forward amplification primers to the first left universal adapter sequence or the second left universal adapter sequence comprising the universal binding sequence for a forward amplification primer; as well as b) performing a rolling circle amplification reaction, thereby generating a plurality of nucleic acid concatemer molecules.

83. The method of claim 77, wherein the first right universal adapter sequence (130) or the second right universal adapter sequence (150) of each library molecule in the plurality of library molecules comprises a universal binding sequence for a forward amplification primer, and wherein the method further comprises: a) hybridizing a plurality of soluble forward amplification primers to the first right universal adapter sequence or the second right universal adapter sequence comprising the universal binding sequence for a forward amplification primer; as well as b) performing a rolling circle amplification reaction, thereby generating a plurality of nucleic acid concatemer molecules each hybridizing to a covalently closed circular library molecule (600).

84. The method of claim 82 or 83, wherein each concatemer molecule of the plurality of concatemer molecules comprises a second splint strand region (400) having a universal binding sequence for a third surface primer, wherein each concatemer molecule is hybridized to a covalently closed circular library molecule (600), and wherein the method further comprises: The plurality of concatemer molecules are distributed onto a support having a plurality of third surface primers immobilized thereon under conditions suitable for hybridizing at least a portion of the concatemers to at least a portion of the plurality of immobilized third surface primers, thereby immobilizing the plurality of concatemer molecules.

85. The method of claim 84, further comprising: The plurality of immobilized concatemer molecules (which are hybridized to the covalently closed circular library molecules (600)) are contacted with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction on the support using the plurality of covalently closed circular library molecules (600) as template molecules, thereby extending the plurality of immobilized nucleic acid concatemer molecules.

86. The method of claim 85, wherein the plurality of nucleotides comprises dATP, dGTP, dCTP, dTTP and / or dUTP.

87. The method of any one of claims 74-76, wherein each covalently closed circular library molecule (600) of the plurality of covalently closed circular library molecules is hybridized to a first splint strand (300), and wherein the method further comprises: The plurality of covalently closed circular library molecules (600) are contacted with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction using the first splint strand (300) as an amplification primer, thereby generating a plurality of concatemer molecules.

88. The method of claim 87, wherein each concatemer molecule of the plurality of concatemer molecules comprises a second splint strand region (400) comprising a universal binding sequence for a third surface primer, and wherein the method further comprises: The multiple concatamer molecules hybridized to the covalently closed circular library molecules (600) are distributed onto a support having multiple third surface primers fixed thereon under conditions suitable for hybridizing at least a portion of the concatamer with at least a portion of the multiple fixed third surface primers, thereby fixing the multiple concatamer molecules hybridized to the covalently closed circular library molecules (600).

89. The method of claim 88, further comprising: The plurality of immobilized concatemer molecules are contacted with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction on the support using the plurality of covalently closed circular library molecules (600) as template molecules, thereby extending the plurality of immobilized nucleic acid concatemer molecules.

90. The method of claim 89, wherein the plurality of nucleotides comprises dATP, dGTP, dCTP, dTTP and / or dUTP.

91. The method of any one of claims 80, 85 or 89, wherein the support further comprises a plurality of the fourth surface primers immobilized on the support.

92. The method of claim 91, wherein the plurality of immobilized nucleic acid concatemer molecules comprises at least two second splint strand regions (400) each having a universal binding sequence for the third surface primer and the fourth surface primer, and wherein the method further comprises: The plurality of immobilized nucleic acid concatemer molecules are incubated under conditions suitable for hybridizing at least one second splint strand region (400) of at least one concatemer molecule to the immobilized fourth surface primer, thereby immobilizing at least a portion of the immobilized concatemer molecules to the support.

93. The method of any one of claims 80, 85, 89 or 92, further comprising: Sequencing a plurality of fixed concatemers, the method comprising: a) contacting a plurality of immobilized concatemer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble sequencing primers, wherein the contacting is performed under conditions suitable for forming a plurality of composite polymerases each comprising a sequencing polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises concatemer molecules hybridized to the soluble sequencing primers; b) contacting the plurality of composite sequencing polymerases with a plurality of nucleotides under conditions suitable for binding at least one nucleotide to the composite sequencing polymerase, wherein the plurality of nucleotides comprises at least one nucleotide analog labeled with a fluorophore and having a removable chain terminating moiety at the 3' position of the sugar; c) incorporating at least one nucleotide into the 3' end of the hybridized sequencing primer, thereby generating a plurality of nascent extended sequencing primers; and d) detecting the incorporated nucleotide and identifying the nucleobase of the incorporated nucleotide.

94. The method of any one of claims 80, 85, 89 or 92, further comprising: Sequencing a plurality of fixed concatemers, the method comprising: a) contacting the plurality of immobilized concatemer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble sequencing primers, wherein the contacting is performed under conditions suitable for forming a plurality of first composite polymerases each comprising a sequencing polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises concatemer molecules hybridized to the soluble sequencing primers; b) contacting the plurality of composite sequencing polymerases with a plurality of detectably labeled multivalent molecules under conditions suitable for combining the complementary nucleotide units of the multivalent molecules with at least two of the plurality of first composite polymerases to form a plurality of multivalent-complex polymerases, thereby forming a plurality of multivalent-complex polymerases, and wherein the conditions inhibit incorporation of the complementary nucleotide units into sequencing primers of the plurality of multivalent-complex polymerases, wherein each multivalent molecule of the plurality of multivalent molecules comprises a core attached to a plurality of nucleotide arms, and each nucleotide arm is attached to a nucleotide unit; c) detecting the plurality of multivalent-complex polymerases; and d) identifying the nucleobase of the complementary nucleotide unit bound to the plurality of first complex polymerases in the plurality of multivalent-complex polymerases, thereby determining the sequence of the nucleic acid template.

95. The method of claim 94, further comprising: e) dissociating the plurality of multivalent-complex polymerases and removing the plurality of first sequencing polymerases and their bound multivalent molecules, and retaining a plurality of nucleic acid duplexes; f) contacting the plurality of retained nucleic acid duplexes of step (e) with a plurality of second sequencing polymerases, wherein the contacting is performed under conditions suitable for binding the plurality of second sequencing polymerases to the plurality of retained nucleic acid duplexes, thereby forming a plurality of second composite polymerases each comprising a second sequencing polymerase bound to the retained nucleic acid duplexes; g) contacting the plurality of second composite polymerases with a plurality of nucleotides, wherein the contacting is carried out under conditions suitable for binding complementary nucleotides from the plurality of nucleotides to at least two of the second composite polymerases of step (f), thereby forming a plurality of nucleotide-composite polymerases, and the conditions are suitable for promoting the incorporation of the bound complementary nucleotides into the sequencing primers of the nucleotide-composite polymerases.

96. The method of claim 95, wherein the plurality of nucleotides comprises at least one nucleotide analog labeled with a fluorophore and having a removable chain terminating moiety at the 3' position of the sugar.

97. The method of claim 95, further comprising: h) detecting the complementary nucleotide incorporated into the sequencing primer of the nucleotide-complex polymerase.

98. The method of claim 95, further comprising: h) detecting the complementary nucleotide incorporated into the sequencing primer of the nucleotide-complex polymerase; as well as i) recognizing the nucleobase of the complementary nucleotide incorporated into the sequencing primer of the nucleotide-complex polymerase.

99. A method of forming at least one affinity complex, comprising: a) combining a first universal nucleic acid primer, a first DNA polymerase, and a first multivalent molecule with a first portion of any of the concatemer molecules according to any one of claims 80, 85, 89 or 92, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule is bound to the first DNA polymerase; and b) combining a second universal nucleic acid primer, a second DNA polymerase, and the first multivalent molecule with a second portion of the same concatameric template molecule to form a second binding complex, wherein the second nucleotide unit of the first multivalent molecule binds to the second DNA polymerase, wherein the first binding complex and the second binding complex of the same multivalent molecule form an affinity complex, wherein the first multivalent molecule comprises a core attached to a plurality of nucleotide arms and each nucleotide arm is attached to a nucleotide unit, and wherein the concatameric molecule comprises two or more tandem repeats of a target sequence (110) and a universal primer binding site that binds the first universal nucleic acid primer and the second universal nucleic acid primer.

100. A method for sequencing by forming at least one affinity complex, comprising: a) combining a first universal nucleic acid primer, a first DNA polymerase, and a first multivalent molecule with a first portion of any of the concatemer molecules according to any one of claims 80, 85, 89 or 92, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule is bound to the first DNA polymerase; b) combining a second universal nucleic acid primer, a second DNA polymerase, and the first multivalent molecule with a second portion of the same concatemer template molecule, thereby forming a second binding complex, wherein the second nucleotide unit of the first multivalent molecule binds to the second DNA polymerase, wherein the first binding complex and the second binding complex comprising the same multivalent molecule form an affinity complex, wherein the first multivalent molecule comprises a core attached to a plurality of nucleotide arms and each nucleotide arm is attached to a nucleotide unit, wherein the concatemer molecule comprises two or more tandem repeats of a sequence of interest (110) and a universal primer binding site that binds the first universal nucleic acid primer and the second universal nucleic acid primer, and wherein the contacting is performed under conditions suitable for inhibiting polymerase-catalyzed incorporation of the bound first nucleotide unit and the second nucleotide unit in the first binding complex and the second binding complex; c) detecting the first binding complex and the second binding complex on the same concatemeric template molecule, and d) identifying the first nucleotide unit in the first binding complex, thereby determining the sequence of the first portion of the concatemer template molecule, and identifying the second nucleotide unit in the second binding complex, thereby determining the sequence of the second portion of the concatemer template molecule.

101. A method for preparing a multiplex mixture of target sequences isolated from a plurality of sample sources, comprising: a) providing two or more populations of single-stranded nucleic acid library molecules (100), each population of library molecules (100) being contained in a separate compartment, wherein the nucleic acid library molecules in a given population comprise (i) a first left universal adaptor sequence (120) having a binding sequence for a first surface primer, (ii) a second left universal adaptor sequence (140) having a binding sequence for the first sequencing primer; (iii) isolating a target sequence (110) from a sample source, (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer; (v) a first right universal adaptor sequence (130) having a binding sequence for a second surface primer, and (vii) a first left index sequence (160) and / or a first right index sequence (170), wherein the left index sequence (160) and / or the right index sequence (170), alone or in combination, identifies the sample source from which the target sequence (110) has been isolated; b) providing a plurality of double-stranded splint adapters (200), wherein each double-stranded splint adapter (200) comprises a first splint strand (300) hybridized to a second splint strand (400), wherein the first splint strand (300) comprises regions arranged in 5' to 3' order: a first region (320), an internal region (310) and a second region (330), and wherein the internal region (310) of the first splint strand hybridizes to the second splint strand (400), wherein the second splint strand comprises regions arranged in 5' to 3' order: (i) a second sub-region having a universal binding sequence for a fourth surface primer; and (ii) a first sub-region having a universal binding sequence for a third surface primer; c) contacting a population of single-stranded nucleic acid library molecules (100) with a plurality of double-stranded splint adaptors (200) in the separate compartments, wherein the contact is performed under conditions suitable for hybridizing a portion of the first splint chain (300) with a portion of the library molecule (100), thereby circularizing the library molecules to produce a population of library-splint complexes (500), such that the first region (320) of each first splint chain hybridizes with the binding sequence (120) of each library molecule (100) for the first surface primer, and the first region (320) of each first splint chain hybridizes with the binding sequence (120) of the first surface primer of each library molecule (100). The third region (330) hybridizes with the binding sequence (130) for the second surface primer of the respective library molecule (100), wherein each of the library-splint complexes (500) comprises a first gap between the 5' end of the library molecule and the 3' end of the second splint strand (300), wherein each of the library-splint complexes (500) comprises a second gap between the 5' end of the second splint strand (300) and the 3' end of the library molecule (100), and wherein the first gap and the second gap are enzymatically ligatable; d) contacting the population of library-splint complexes (500) with a ligase in said separate compartments under conditions suitable for enzymatically ligating said first gap and said second gap, thereby generating two or more populations of covalently closed circular library molecules (600) each hybridized to said first splint strand (300); as well as e) pooling together the two or more populations of covalently closed circular library molecules (600) from the separate compartments to generate a multiplex mixture of covalently closed circular library molecules (600) comprising the multiplex mixture of sequences of interest isolated from a plurality of sample sources.

102. The method of claim 101, wherein each covalently closed circular library molecule (600) in the multiplex mixture of step (e) comprises a second splint strand region (400) comprising a universal binding sequence for a third surface primer, and wherein the method further comprises: a) dispensing said multiplex mixture of covalently closed circular library molecules (600) onto a support having a plurality of third surface primers immobilized on said support, under conditions suitable for hybridizing each covalently closed circular library molecule (600) to each immobilized third surface primer, thereby immobilizing a plurality of covalently closed circular library molecules (600); as well as b) contacting the multiple mixture of immobilized covalently closed circular library molecules (600) with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction on the support using a plurality of third surface primers as immobilized amplification primers and using the plurality of covalently closed circular library molecules (600) as template molecules, thereby producing a plurality of immobilized nucleic acid concatemer molecules, wherein the plurality of nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

103. The method of claim 101, further comprising: Perform rolling circle amplification reactions by: a) contacting the two or more populations of covalently closed circular library molecules (600) hybridized to the first splint strands (300) of step (d) or (e) with at least one exonuclease under conditions suitable for removing the plurality of first splint strands (300) and retaining a population of covalently closed circular library molecules (600); and b) contacting the two or more populations of retained covalently closed circular library molecules (600) with a plurality of soluble amplification primers, a plurality of strand displacement polymerases, and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction, thereby producing a plurality of nucleic acid concatemer molecules, wherein the plurality of nucleotides comprises dATP, dGTP, dCTP, dTTP and / or dUTP.

104. The method of claim 103, further comprising: c) dispensing the plurality of concatemer molecules onto a support having a plurality of third surface primers immobilized thereon, under conditions suitable for hybridizing at least a portion of the concatemers to at least a portion of the plurality of immobilized third surface primers, thereby immobilizing the plurality of concatemer molecules; as well as d) contacting the immobilized multiple concatemer molecules (which are hybridized to the covalently closed circular library molecules (600)) with multiple strand displacement polymerases and multiple nucleotides under conditions suitable for performing a rolling circle amplification reaction on the support using the multiple covalently closed circular library molecules (600) as template molecules, thereby extending the multiple immobilized nucleic acid concatemer molecules, wherein the multiple nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

105. The method of claim 101, further comprising: A rolling circle amplification reaction is performed by contacting the two or more populations of covalently closed circular library molecules (600) each hybridized to the first splint strand (300) of step (d) or (e) with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction, thereby producing a plurality of concatemer molecules, wherein the plurality of nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

106. The method of claim 105, further comprising: a) dispensing the plurality of concatemer molecules hybridized to the covalently closed circular library molecules (600) onto a support having a plurality of third surface primers immobilized thereon, under conditions suitable for hybridizing at least a portion of the concatemers to at least a portion of the plurality of immobilized third surface primers, thereby immobilizing the plurality of concatemer molecules hybridized to the covalently closed circular library molecules (600); as well as b) contacting the plurality of immobilized concatemer molecules with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction on the support using the plurality of covalently closed circular library molecules (600) as template molecules, thereby extending the plurality of immobilized nucleic acid concatemer molecules, wherein the plurality of nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

107. The method of any one of claims 102, 104 or 106, further comprising: The insertion region (110) and the first left index sequence (160) and / or the first right index sequence (170) of the multiple fixed nucleic acid concatemer molecules are sequenced, wherein the sequence of the insertion region (110) and the first left index sequence (160) and / or the first right index sequence (170) can be used to identify the sample source of the target sequence.

108. The method of claim 107, wherein the sequencing reaction comprises: a) combining the plurality of immobilized nucleic acid concatemer molecules with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled nucleotide analogs each comprising a 2' or 3' chain terminating moiety under conditions suitable for incorporating the detectably labeled nucleotide analog into the 3' end of the sequencing primer; b) detecting the bound detectably labeled nucleotide analog; and c) recognizing the nucleobase of said detectably labeled nucleotide analog.

109. The method according to claim 107, wherein the sequencing reaction adopts a two-stage sequencing reaction, wherein the first stage comprises: a) combining the plurality of immobilized nucleic acid concatemer molecules with a plurality of sequencing primers, a plurality of first sequencing polymerases, and a plurality of detectably labeled multivalent molecules (e.g., to form a plurality of multivalent-complex polymerases) under conditions suitable for binding of each concatemer molecule to the sequencing primer, the first sequencing polymerase, and the detectably labeled multivalent molecule; b) detecting the bound detectably labeled multivalent molecule; as well as c) recognizing a nucleobase of said detectably labeled multivalent molecule.

110. The method of claim 109, wherein the detectably labeled multivalent molecule binds to the plurality of immobilized nucleic acid concatemer molecules to form at least one affinity complex according to the method of claim 99 or 100.

111. The method of claim 109, further comprising performing a second stage, the second stage comprising: d) removing a plurality of first sequencing polymerases and a plurality of bound multivalent molecules from the plurality of immobilized nucleic acid concatemer molecules, and retaining the immobilized concatemer molecules (nucleic acid duplexes) each hybridized to a sequencing primer; as well as e) contacting the retained immobilized concatamer molecules and the hybridized sequencing primer with a plurality of second polymerases and a plurality of nucleotides under conditions suitable for incorporating the nucleotides into the 3' end of the sequencing primer.

112. A method for preparing a multiplex mixture of target sequences isolated from a plurality of sample sources, comprising: a) providing two or more populations of single-stranded nucleic acid library molecules (100), each population of library molecules (100), each population of single-stranded nucleic acid library molecules being contained in a separate compartment, wherein the nucleic acid library molecules in a given population comprise (i) a first left universal adaptor sequence (120) having a binding sequence for a first surface primer, (ii) a second left universal adaptor sequence (140) having a binding sequence for the first sequencing primer; (iii) isolating a target sequence (110) from a sample source, (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer; (v) a first right universal adaptor sequence (130) having a binding sequence for a second surface primer, and (vi) a first left-indexed sequence (160) and / or a first right-indexed sequence (170), wherein the left-indexed sequence (160) and / or the right-indexed sequence (170) individually or in combination identify the sample source from which the target sequence (110) was isolated; b) pooling the two or more populations of single-stranded nucleic acid library molecules (100) into the same compartment; c) adding a plurality of double-stranded splint adapters (200) to the compartment of step (b), wherein each double-stranded splint adapter (200) comprises a first splint strand (300) hybridized to a second splint strand (400), wherein the first splint strand (300) comprises regions arranged in 5' to 3' order: a first region (320), an internal region (310), and a second region (330), and wherein the internal region (310) of the first splint strand hybridizes to the second splint strand (400), wherein the second splint strand comprises regions arranged in 5' to 3' order: (i) a second sub-region having a universal binding sequence for a fourth surface primer; and (ii) a first sub-region having a universal binding sequence for a third surface primer; d) incubating the population of single-stranded nucleic acid library molecules (100) and the plurality of double-stranded splint adaptors (200) in the same compartment of step (c) under conditions suitable for hybridizing a portion of the first splint strand (300) with a portion of the library molecule (100), thereby circularizing the library molecules to produce a population of library-splint complexes (500), such that the first region (320) of each first splint strand hybridizes with the binding sequence (120) of each library molecule (100) for the first surface primer, and the third region (320) of each first splint strand hybridizes with the binding sequence (120) of the first surface primer of each library molecule (100). region (330) hybridizing with the binding sequence (130) for the second surface primer of the respective library molecule (100), wherein each of the library-splint complexes (500) comprises a first gap between the 5' end of the library molecule and the 3' end of the second splint strand (300), wherein each of the library-splint complexes (500) comprises a second gap between the 5' end of the second splint strand (300) and the 3' end of the library molecule (100), and wherein the first gap and the second gap are enzymatically ligatable; and e) contacting the population of library-splint complexes (500) in the compartment of step (d) with a ligase under conditions suitable for enzymatically ligating the first gap and the second gap, thereby producing a population of covalently closed circular library molecules (600) each hybridized to the first splint chain (300), thereby producing a multiple mixture of covalently closed circular library molecules (600), which includes a multiple mixture of target sequences isolated from multiple sample sources.

113. The method of claim 112, wherein each covalently closed circular library molecule (600) in the multiplex mixture of step (e) comprises a second splint strand region (400) comprising a universal binding sequence for a third surface primer, and wherein the method further comprises: a) dispensing a plurality of covalently closed circular library molecules (600) onto a support having a plurality of third surface primers immobilized thereon, under conditions suitable for hybridizing each covalently closed circular library molecule (600) to each immobilized third surface primer, thereby immobilizing the plurality of covalently closed circular library molecules (600); as well as b) contacting the plurality of immobilized covalently closed circular library molecules (600) with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction on the support using a plurality of third surface primers as immobilized amplification primers and using the plurality of covalently closed circular library molecules (600) as template molecules, thereby producing a plurality of immobilized nucleic acid concatemer molecules, wherein the plurality of nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

114. The method of claim 112, further comprising: Perform rolling circle amplification reactions by: a) contacting the population of covalently closed circular library molecules (600) hybridized to the first splint strands (300) of step (d) or (e) with at least one exonuclease under conditions suitable for removing the plurality of first splint strands (300) and retaining the population of covalently closed circular library molecules (600); b) contacting the retained population of covalently closed circular library molecules (600) with a plurality of soluble amplification primers, a plurality of strand displacement polymerases, and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction, thereby generating a plurality of nucleic acid concatemer molecules, wherein the plurality of nucleotides comprises dATP, dGTP, dCTP, dTTP, and / or dUTP.

115. The method of claim 114, further comprising: c) dispensing the plurality of concatemer molecules onto a support having a plurality of third surface primers immobilized thereon, under conditions suitable for hybridizing at least a portion of the concatemers to at least a portion of the plurality of immobilized third surface primers, thereby immobilizing the plurality of concatemer molecules; as well as d) contacting the immobilized multiple concatemer molecules (which are hybridized to the covalently closed circular library molecules (600)) with multiple strand displacement polymerases and multiple nucleotides under conditions suitable for performing a rolling circle amplification reaction on the support using the multiple covalently closed circular library molecules (600) as template molecules, thereby extending the multiple immobilized nucleic acid concatemer molecules, wherein the multiple nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

116. The method of claim 112, further comprising: A rolling circle amplification reaction is performed by contacting a population of the covalently closed circular library molecules (600) each hybridized to the first splint strand (300) of step (d) or (e) with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for a rolling circle amplification reaction, thereby producing a plurality of concatemer molecules, wherein the plurality of nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

117. The method of claim 116, further comprising: c) distributing the plurality of concatemer molecules hybridized to the covalently closed circular library molecules (600) onto a support having a plurality of third surface primers immobilized thereon, under conditions suitable for hybridizing at least a portion of the concatemers to at least a portion of the plurality of immobilized third surface primers, thereby immobilizing the plurality of concatemer molecules hybridized to the covalently closed circular library molecules (600); as well as d) contacting the plurality of immobilized concatemer molecules with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction on the support using the plurality of covalently closed circular library molecules (600) as template molecules, thereby extending the plurality of immobilized nucleic acid concatemer molecules, wherein the plurality of nucleotides include dATP, dGTP, dCTP, dTTP and / or dUTP.

118. The method of any one of claims 113, 115 or 117, further comprising: The insertion region (110) and the first left index sequence (160) and / or the first right index sequence (170) of the multiple fixed nucleic acid concatemer molecules are sequenced, wherein the sequence of the insertion region (110) and the first left index sequence (160) and / or the first right index sequence (170) can be used to identify the sample source of the target sequence.

119. The method of claim 118, wherein the sequencing reaction comprises: a) combining the plurality of immobilized nucleic acid concatemer molecules with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled nucleotide analogs each comprising a 2' or 3' chain terminating moiety under conditions suitable for incorporating the detectably labeled nucleotide analogs into the 3' end of the sequencing primers; b) detecting the bound detectably labeled nucleotide analog; and c) recognizing the nucleobase of said detectably labeled nucleotide analogue.

120. The method according to claim 118, wherein the sequencing reaction adopts a two-stage sequencing reaction, wherein the first stage comprises: a) combining the plurality of immobilized nucleic acid concatemer molecules with a plurality of sequencing primers, a plurality of first sequencing polymerases, and a plurality of detectably labeled multivalent molecules (e.g., to form a plurality of multivalent-complex polymerases) under conditions suitable for binding of each concatemer molecule to the sequencing primer, the first sequencing polymerase, and the detectably labeled multivalent molecule; b) detecting the bound detectably labeled multivalent molecule; as well as c) recognizing a nucleobase of said detectably labeled multivalent molecule.

121. The method of claim 120, wherein the detectably labeled multivalent molecule binds to the plurality of immobilized nucleic acid concatemer molecules to form at least one affinity complex according to the method of claim 99 or 100.

122. The method of claim 120, further comprising performing a second stage, the second stage comprising: d) removing a plurality of first sequencing polymerases and a plurality of bound multivalent molecules from the plurality of immobilized nucleic acid concatemer molecules, and retaining the immobilized concatemer molecules (nucleic acid duplexes) each hybridized to a sequencing primer; as well as e) contacting the retained immobilized concatamer molecules and the hybridized sequencing primer with a plurality of second polymerases and a plurality of nucleotides under conditions suitable for incorporating the nucleotides into the 3' end of the sequencing primer.

123. A method for appending additional universal adaptor sequencing to a nucleic acid library molecule, comprising: a) providing a plurality of nucleic acid library molecules (100) each comprising the following sequences arranged in 5' to 3' order: (i) a first left universal adaptor sequence (120), (ii) a second left universal adaptor sequence (140), (iii) a target sequence (110), (iv) a second right universal adaptor sequence (150), and (v) a first right universal adaptor sequence (130); b) hybridizing each library molecule of step (a) with a first tailed primer and performing a first primer extension reaction (or a first PCR), wherein the first tailed primer comprises a 5' region carrying a third left universal adapter sequence and a 3' region complementary to at least a portion of the first left universal adapter sequence (120) of the library molecule (100), wherein the first primer extension reaction (or the first PCR) produces a plurality of first modified library molecules each having the third left universal adapter sequence appended at one end, wherein the third left universal adapter sequence of the first tailed primer comprises Universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for the first or second surface primer, Universal binding sequences for forward or reverse amplification primers, and / or a universal binding sequence for compacted oligonucleotides; and c) hybridizing each first modified library molecule of step (a) with a second tailed primer and performing a second primer extension reaction (or a second PCR), wherein the second tailed primer comprises a 5' region carrying a third right universal adapter sequence and a 3' region complementary to at least a portion of the first right universal adapter sequence (130) of the first modified library molecule, wherein the second primer extension reaction (or a second PCR) produces a plurality of second modified library molecules each having the third right universal adapter sequence appended at one end, wherein the third right universal adapter sequence of the second tailed primer comprises Universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for the first or second surface primer, Universal binding sequences for forward or reverse amplification primers, and / or Universal binding sequences for compacted oligonucleotides.

124. The method of claim 123, wherein each of the nucleic acid library molecules comprises the sequence arranged in 5' to 3' order: (i) a first left universal adaptor sequence (120) having a binding sequence for a first surface primer, (ii) a second left universal adaptor sequence (140) having a binding sequence for the first sequencing primer, (iii) a target sequence (110), (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer, and (v) A first right universal adaptor sequence (130) having a binding sequence for a second surface primer.

125. The method of claim 123, further comprising: d) hybridizing each second modified library molecule of step (c) with a third tailed primer and performing a third primer extension reaction (or third PCR), wherein the third tailed primer comprises a 5' region carrying a fourth left universal adapter sequence and a 3' region complementary to at least a portion of the third left universal adapter sequence of the second modified library molecule, wherein the third primer extension reaction (or third PCR) produces a plurality of third modified library molecules each having the fourth left universal adapter sequence appended at one end, wherein the fourth left universal adapter sequence of the third tailed primer comprises Universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for the first or second surface primer, Universal binding sequences for forward or reverse amplification primers, and / or a universal binding sequence for compacted oligonucleotides; and e) hybridizing each third modified library molecule of step (d) with a fourth tailed primer and performing a fourth primer extension reaction (or fourth PCR), wherein the fourth tailed primer comprises a 5' region carrying a fourth right universal adaptor sequence and a 3' region complementary to at least a portion of the third right universal adaptor sequence of the third modified library molecule, wherein the fourth primer extension reaction (or fourth PCR) produces a plurality of fourth modified library molecules each having the fourth right universal adaptor sequence appended at one end, wherein the fourth right universal adaptor sequence of the fourth tailed primer comprises Universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for the first or second surface primer, Universal binding sequences for forward or reverse amplification primers, and / or Universal binding sequences for compacted oligonucleotides.

126. The method of claim 125, further comprising: f) hybridizing each fourth modified library molecule of step (e) with a fifth tailed primer and performing a fifth primer extension reaction (or fifth PCR), wherein the fifth tailed primer comprises a 5' region carrying a fifth left universal adapter sequence and a 3' region complementary to at least a portion of the fourth left universal adapter sequence of the fourth modified library molecule, wherein the fifth primer extension reaction (or fifth PCR) produces a plurality of fifth modified library molecules each having the fifth left universal adapter sequence appended at one end, wherein the fifth left universal adapter sequence of the fifth tailed primer comprises Universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for the first or second surface primer, Universal binding sequences for forward or reverse amplification primers, and / or a universal binding sequence for compacted oligonucleotides; and g) hybridizing each fifth modified library molecule of step (f) with a sixth tailed primer and performing a sixth primer extension reaction (or sixth PCR), wherein the sixth tailed primer comprises a 5' region carrying a sixth right universal adaptor sequence and a 3' region complementary to at least a portion of the fourth right universal adaptor sequence of the fifth modified library molecule, wherein the sixth primer extension reaction (or sixth PCR) produces a plurality of sixth modified library molecules each having the sixth right universal adaptor sequence appended at one end, wherein the sixth right universal adaptor sequence of the sixth tailed primer comprises Universal binding sequence for forward or reverse sequencing primers, a universal binding sequence for the first or second surface primer, Universal binding sequences for forward or reverse amplification primers, and / or Universal binding sequences for compacted oligonucleotides.

127. The method of any one of claims 123-126, wherein the first tailed primer, the third tailed primer and / or the fifth tailed primer further comprises a left index sequence.

128. The method of any one of claims 123-126, wherein the first tailed primer, the third tailed primer and / or the fifth tailed primer further comprises a left unique identification sequence.

129. The method of any one of claims 123-126, wherein the second tailed primer, the fourth tailed primer and / or the sixth tailed primer further comprises a right index sequence.

130. The method of any one of claims 123-126, wherein the second tailed primer, the fourth tailed primer and / or the sixth tailed primer further comprises a right unique identification sequence.

131. The method of claim 123, wherein the additional third left universal adaptor sequence of step (b) can bind to the first region (320) of the first splint strand.

132. The method of claim 123, wherein the additional third right universal adaptor sequence of step (c) can bind to the second region (330) of the first splint strand.

133. The method of claim 125, wherein the additional fourth left universal adaptor sequence of step (d) can bind to the first region (320) of the first splint strand.

134. The method of claim 125, wherein the additional fourth right universal adaptor sequence of step (e) can bind to the second region (330) of the first splint strand.

135. The method of claim 126, wherein the additional fifth left universal adapter sequence of step (f) can bind to the first region (320) of the first splint strand.

136. The method of claim 126, wherein the additional fifth right universal adaptor sequence of step (g) can bind to the second region (330) of the first splint strand.

137. A method for forming a plurality of library-splint complexes (500), comprising: a) providing a plurality of double-stranded splint adapters (200), wherein each double-stranded splint adapter (200) comprises a first splint strand (300) hybridized to a second splint strand (400), wherein the first splint strand (300) comprises regions arranged in 5' to 3' order: a first region (320), an internal region (310) and a second region (330), and wherein the internal region (310) of the first splint strand hybridizes to the second splint strand (400), wherein the second splint strand comprises regions arranged in 5' to 3' order: (i) a second sub-region having a universal binding sequence for a first surface primer; and (ii) a first sub-region having a universal binding sequence for a second surface primer; as well as b) hybridizing the plurality of double-stranded splint adapters with a plurality of single-stranded nucleic acid library molecules (100), wherein each library molecule comprises regions arranged in 5' to 3' order: (i) a first left universal adapter sequence (120) having a binding sequence for a third surface primer; (ii) a second left universal adapter sequence (140) having a binding sequence for a first sequencing primer; (iii) a target sequence (110); (iv) a second right universal adapter sequence (150) having a binding sequence for a second sequencing primer; (v) a first right universal adapter sequence (130) having a binding sequence for a fourth surface primer, wherein the hybridization is performed under conditions suitable for hybridizing a portion of the first splint chain (300) with a portion of the library molecule (100), thereby circularizing the library molecule to produce a library-splint complex (500), such that the first region (320) of the first splint chain hybridizes with the binding sequence (120) for the third surface primer, and the third region (330) of the first splint chain hybridizes with the binding sequence (130) for the fourth surface primer, wherein the library-splint complex (500) comprises a first gap between the 5' end of the library molecule and the 3' end of the second splint chain (400), wherein the library-splint complex (500) comprises a second gap between the 5' end of the second splint chain (400) and the 3' end of the library molecule (100), and wherein the first gap and the second gap are enzymatically ligatable.

138. The method of claim 137, wherein the plurality of single-stranded nucleic acid library molecules (100) further comprises a first left index sequence (160) and / or a first right index sequence (170).

139. The method of claim 137, wherein the plurality of single-stranded nucleic acid library molecules (100) further comprises a first left unique identification sequence (180) and / or a first right unique identification sequence (190).

140. The method of claim 137, further comprising: The multiple double-stranded splint adaptors (200) and the multiple single-stranded nucleic acid library molecules (100) are contacted with a ligase under conditions suitable for enzymatically ligating the first gap and the second gap, thereby generating multiple covalently closed circular library molecules (600) each hybridized to the first splint chain (300).

141. The method of claim 140, further comprising: The plurality of covalently closed circular library molecules (600) are contacted with at least one exonuclease to remove the plurality of first splint strands (300) and retain the plurality of covalently closed circular library molecules (600).

142. The method of claim 141, wherein each covalently closed circular library molecule (600) of the plurality of covalently closed circular library molecules comprises a second splint strand region (400) comprising the universal binding sequence for the second surface primer, and wherein the method further comprises: The retained plurality of covalently closed circular library molecules (600) are distributed onto a support having a plurality of the second surface primers immobilized thereon under conditions suitable for hybridizing each covalently closed circular library molecule (600) to each immobilized second surface primer, thereby immobilizing the plurality of covalently closed circular library molecules (600).

143. The method of claim 142, further comprising: The plurality of immobilized covalently closed circular library molecules (600) are contacted with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction on the support using the plurality of second surface primers as immobilized amplification primers and using the plurality of covalently closed circular library molecules (600) as template molecules, thereby producing a plurality of immobilized nucleic acid concatemer molecules.

144. The method of claim 143, wherein the plurality of nucleotides comprises dATP, dGTP, dCTP, dTTP and / or dUTP.

145. The method of claim 142, wherein the plurality of immobilized second surface capture primers on the support are located at predetermined or random positions on the support.

146. A method according to claim 142, wherein the multiple fixed second surface capture primers on the support are fluidically connected to each other to allow a solution of a reagent to flow onto the support, so that the multiple fixed second surface primers can react with the reagent substantially simultaneously in a large-scale parallel manner, optionally wherein the solution of the reagent comprises an enzyme, a nucleotide and a divalent cation.

147. The method of claim 143, wherein the density of the plurality of immobilized nucleic acid concatemer molecules on the support is 10 4 Up to 10 8 Pieces / mm 2 .

148. The method of claim 142, further comprising: The plurality of fixed concatemers are sequenced, wherein the sequencing comprises: a) contacting a plurality of immobilized concatemer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble sequencing primers, wherein the contacting is performed under conditions suitable for forming a plurality of composite polymerases each comprising a sequencing polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises concatemer molecules hybridized to the soluble sequencing primers; b) contacting the plurality of composite sequencing polymerases with a plurality of nucleotides under conditions suitable for binding at least one nucleotide to the composite sequencing polymerase, wherein the plurality of nucleotides comprises at least one nucleotide analog labeled with a fluorophore and having a removable chain terminating moiety at the 3' position of the sugar; c) incorporating at least one nucleotide into the 3' end of the hybridized sequencing primer, thereby generating a plurality of nascent extended sequencing primers; and d) detecting the incorporated nucleotide and identifying the nucleobase of the incorporated nucleotide.

149. A method according to claim 148, wherein the plurality of nucleotides comprises a removable chain-terminating portion at the 3' sugar group, wherein the removable chain-terminating portion comprises an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azido group, an azido group, an O-azidomethyl group, an amine group, an amide group, a keto group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group or a silyl group, and wherein the removable chain-terminating portion can be cleaved with a chemical compound to produce an extendable 3' OH portion on the sugar group.

150. The method of claim 148, wherein the plurality of nucleotides comprises a type of nucleotide selected from the group consisting of dATP, dGTP, dCTP, dTTP, and dUTP.

151. The method of claim 148, wherein the plurality of nucleotides comprises a mixture of any combination of two or more types of nucleotides selected from the group consisting of dATP, dGTP, dCTP, dTTP and / or dUTP.

152. The method of claim 142, further comprising: The plurality of fixed concatemers are sequenced, wherein the sequencing comprises: a) contacting a plurality of immobilized concatemer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble universal sequencing primers, wherein the contacting is performed under conditions suitable for forming a plurality of first composite polymerases each comprising a sequencing polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises concatemer molecules hybridized to the soluble sequencing primers; b) contacting a plurality of composite sequencing polymerases with a plurality of detectably labeled multivalent molecules under conditions suitable for combining complementary nucleotide units of the multivalent molecules with at least two of the plurality of first composite polymerases to form a plurality of multivalent-complex polymerases, thereby forming a plurality of multivalent-complex polymerases, and wherein the conditions inhibit incorporation of the complementary nucleotide units into sequencing primers of the plurality of multivalent-complex polymerases, wherein each multivalent molecule of the plurality of multivalent molecules comprises a core attached to a plurality of nucleotide arms, and each nucleotide arm is attached to a nucleotide unit; and c) detecting the plurality of multivalent-complex polymerases.

153. The method of claim 152, further comprising: d) dissociating the plurality of multivalent-complex polymerases and removing the plurality of first sequencing polymerases and their bound multivalent molecules, and retaining a plurality of nucleic acid duplexes; e) contacting the plurality of retained nucleic acid duplexes of step d) with a plurality of second sequencing polymerases, wherein the contacting is performed under conditions suitable for binding the plurality of second sequencing polymerases to the plurality of retained nucleic acid duplexes, thereby forming a plurality of second composite polymerases each comprising a second sequencing polymerase bound to the retained nucleic acid duplexes; f) contacting the plurality of second composite polymerases with a plurality of nucleotides, the plurality of nucleotides comprising at least one nucleotide analog having a removable chain terminating portion at the sugar 3' position, wherein the contacting is performed under conditions suitable for binding complementary nucleotides from the plurality of nucleotides to at least two of the second composite polymerases of step e), thereby forming a plurality of nucleotide-composite polymerases, and the conditions are suitable for promoting incorporation of the bound complementary nucleotides into a sequencing primer of the nucleotide-composite polymerase.

154. The method of claim 153, further comprising: g) detecting the complementary nucleotide incorporated into the sequencing primer of the nucleotide-complex polymerase.

155. The method of claim 153, further comprising: g) detecting the complementary nucleotide incorporated into the sequencing primer of the nucleotide-complex polymerase; as well as h) recognizing the nucleobase of the complementary nucleotide incorporated into the sequencing primer of the nucleotide-complex polymerase.

156. A method for sequencing by forming at least one affinity complex, comprising: a) combining a first universal sequencing primer, a first sequencing polymerase, and a first detectably labeled multivalent molecule with a first portion of the concatemer molecule of claim 16, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule is bound to the first sequencing polymerase; b) combining a second universal sequencing primer, a second sequencing polymerase, and the first detectably labeled multivalent molecule with a second portion of the same concatemer molecule, thereby forming a second binding complex, wherein the second nucleotide unit of the first multivalent molecule binds to the second sequencing polymerase, wherein the first binding complex and the second binding complex comprising the same multivalent molecule form an affinity complex, wherein the first detectably labeled multivalent molecule comprises a core attached to a plurality of nucleotide arms, and each nucleotide arm is attached to a nucleotide unit, wherein the concatemer molecule comprises two or more tandem repeats of a sequence of interest (110) and a universal primer binding site that binds the first universal sequencing primer and the second universal sequencing primer, and wherein the contacting is performed under conditions suitable for inhibiting polymerase-catalyzed incorporation of the bound first nucleotide unit and the second nucleotide unit in the first binding complex and the second binding complex; c) detecting the first binding complex and the second binding complex on the same concatemer molecule, and d) identifying the first nucleotide unit in the first binding complex, thereby determining the sequence of the first portion of the concatemer template molecule, and identifying the second nucleotide unit in the second binding complex, thereby determining the sequence of the second portion of the concatemer template molecule.

157. The method of claim 152, wherein the plurality of nucleotide arms attached to the core of the respective multivalent molecules have the same type of nucleotide units, and wherein the type of nucleotide units is selected from the group consisting of dATP, dGTP, dCTP, dTTP, and dUTP.

158. The method of claim 152, wherein the plurality of multivalent molecules comprises a mixture of any combination of two or more types of multivalent molecules, each type having a nucleotide unit selected from the group consisting of: dATP, dGTP, dCTP, dTTP and / or dUTP.

159. A method according to claim 153, wherein the plurality of nucleotides comprises a removable chain-terminating portion at the 3' sugar group, wherein the removable chain-terminating portion comprises an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azido group, an azido group, an O-azidomethyl group, an amine group, an amide group, a keto group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group or a silyl group, and wherein the removable chain-terminating portion can be cleaved with a chemical compound to produce an extendable 3' OH portion on the sugar group.

160. The method of claim 153, wherein the plurality of nucleotides comprises a type of nucleotide selected from the group consisting of dATP, dGTP, dCTP, dTTP, and dUTP.

161. The method of claim 153, wherein the plurality of nucleotides comprises a mixture of any combination of two or more types of nucleotides selected from the group consisting of dATP, dGTP, dCTP, dTTP and / or dUTP.

162. The method of claim 142, wherein the support comprises a glass or plastic substrate.

163. The method of claim 142, wherein the support is passivated with at least one hydrophilic polymer coating having a water contact angle of no greater than 45 degrees.

164. The method of claim 142, wherein the at least one hydrophilic polymer coating comprises molecules selected from the group consisting of polyethylene glycol (PEG), poly(vinyl alcohol) (PVA), poly(vinyl pyridine), poly(vinyl pyrrolidone) (PVP), poly(acrylic acid) (PAA), polyacrylamide, poly(N-isopropylacrylamide) (PNIPAM), poly(methyl methacrylate) (PMA), poly(2-hydroxyethyl methacrylate) (PHEMA), poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA), polyglutamic acid (PGA), polylysine, polyglucoside, streptavidin, and dextran.

Images