Application of eudesmol and plant essential oil containing eudesmol in preparation of medicine for resisting porcine epidemic diarrhea virus

Abstract

The invention provides application of eucalyptol and plant essential oil containing the eucalyptol in preparation of a medicine for resisting porcine epidemic diarrhea virus. Experiments prove that the eucalyptol and the plant essential oil containing the eucalyptol both have a remarkable effect of resisting the porcine epidemic diarrhea virus. Experiments prove that six piglets in a PEDV infection group are finally dead, the survival rate of the piglets can be improved by an eucalyptol treatment group, clinical symptoms and pathological injuries are remarkably relieved, and results show that the eucalyptol has a good effect in the aspect of resisting PEDV, and has potential in the aspect of developing new anti-PEDV drugs due to the cost benefit of the eucalyptol.

Description

Technical Field

[0001] The invention relates to use of eucalyptol in preparing a drug for resisting porcine epidemic diarrhea virus, and belongs to the field of veterinary drugs. Background Art

[0002] Porcine Epidemic Diarrhea (PED) is an intestinal disease caused by Porcine Epidemic Diarrhea Virus (PEDV), which often occurs in piglets. PEDV was discovered in the UK in 1970 and China in 1980. Common symptoms of the virus include diarrhea, anorexia, vomiting, etc., which can reduce the immunity of piglets and eventually lead to the death of piglets, with a mortality rate of up to 100%. Since 2010, PEDV has broken out on a large scale around the world, causing significant economic losses to the global pig industry. In China, Guangdong Province has become the main transmission hub of PEDV, and PEDV can be detected in different organs of piglets, with the highest content in intestinal tissues. At present, vaccines are mostly used in the market to prevent PEDV infection, but due to the genetic diversity and variability of the virus, there is currently no specific drug for the treatment of PEDV. In a study, piglet diarrhea samples were collected in eight regions of China (2011-2021), and PEDV was found to be the main pathogen, with a positive rate of more than 40%. These studies show that PEDV is still widely spread in Chinese pig herds, causing considerable losses to the pig industry. Therefore, prevention and control of this disease is of vital importance. The most promising and effective strategy to protect piglets from PEDV infection is to obtain sufficient maternal antibodies from colostrum and milk. Due to the continuous mutation of PEDV, there may be differences between vaccine strains and epidemic strains, resulting in the inability of vaccines to provide adequate protection against different PEDV variants. Therefore, it is necessary to find new strategies to make up for the shortcomings of vaccines while continuing to develop vaccines based on PEDV epidemic strains. Researchers have widely attached importance to the research on anti-PEDV drugs, and have screened a variety of drugs or natural products with anti-PEDV activity. The drugs reported to have anti-PEDV effects are mainly natural products of plant origin in the initial stage of PEDV infection.

[0003] Eucalyptol (1,3,3-trimethyl-1,2-oxabicyclo[2.2.2]octane), is a naturally derived compound found in essential oils of various plant sources, including eucalyptus, rosemary, and camphor. Eucalyptol is commonly used in food, fragrances, and cosmetics for its pleasant flavor and aroma. In addition, it has been used historically in traditional medicine in different cultures, such as China, India, and Australian Aboriginal medicine, to treat a variety of ailments, including respiratory and digestive problems, fever, and pain. In Germany, Soledum TMEnteric-coated capsules, each containing 100 mg or 200 mg of eucalyptol (CNL-1976), have been registered as an authorized drug for several years for the treatment of inflammatory respiratory diseases such as the common cold, bronchitis, sinusitis, bronchial asthma and chronic obstructive pulmonary disease. Eucalyptol has received widespread attention for its range of biological properties, such as anti-inflammatory, antioxidant, mucolytic / secretory, bronchodilatory and antimicrobial effects. Previous studies have shown that eucalyptol is effective against influenza A (H1N1) and inactivates free influenza A viruses in vitro by disrupting the envelope structure. In addition, a study confirmed its efficacy. Eucalyptol has been widely used in clinical studies of patients with many acute and chronic respiratory diseases, including sinusitis, bronchitis, COPD and asthma. It is worth noting that a recent study found that eucalyptol was shown to be an ACE2 inhibitor in vitro, which is one of the receptors that cause SARS-CoV-2. Furthermore, recent studies have highlighted the neuroprotective, analgesic, and pro-apoptotic properties of eucalyptol, emphasizing its potential beneficial roles in a wide range of diseases including Alzheimer's disease, neuropathic pain, and cancer.

[0004] Eucalyptus globulus comes from the genus Eucalyptus of the Myrtaceae family. It is native to Australia and is now mainly produced in the Mediterranean coast, North America and China. Eucalyptus is a eucalyptus variety that has received the most attention from botanists and chemists. Its main components are eucalyptol, linalene, camphor, anise terpenes, etc. It has the effects of treating respiratory diseases, gastrointestinal diseases, antibacterial, wound healing, pain relief, oral health, immunomodulation, and cancer. Studies have shown that eucalyptus essential oil can reduce the patient's fever 24 hours after inoculation with the SARS-COV-2 virus. The main speculation is that eucalyptus essential oil can increase phagocyte activity and has immunomodulatory and anti-inflammatory properties. At the same time, eucalyptus essential oil can also relieve muscle soreness or pain caused by nerves. 87.6% of the subjects believed that eucalyptus essential oil is effective for muscle soreness. Eucalyptus, the main component of eucalyptus, has an inhibitory effect on COVID-19.

[0005] There is no literature report on the use of eucalyptol or plant essential oils containing eucalyptol for the prevention of porcine epidemic diarrhea virus. Summary of the invention

[0006] In view of the wide range of beneficial effects of eucalyptol in a variety of diseases, there is increasing interest in exploring its mechanism of action and potential therapeutic applications, including respiratory, neurological, gastrointestinal and neoplastic diseases. The object of the present invention is to confirm the potential of eucalyptol for anti-PEDV effects in vivo and in vitro. It was found that eucalyptol inhibited the replication of PEDV in vitro and acted on the attachment, internalization and replication stages of the PEDV life cycle. Subsequently, at safe concentrations, eucalyptol was found to inhibit PEDV infection in vivo. These findings lay the foundation for the development of cheap and efficient anti-PEDV drugs.

[0007] The invention provides use of eucalyptol in preparing a medicine for resisting porcine epidemic diarrhea virus.

[0008] The present invention also provides the use of the plant essential oil containing eucalyptol in preparing a medicine for resisting porcine epidemic diarrhea virus.

[0009] The medicine is a medicine for preventing and treating severe enteropathogenic diarrhea caused by porcine epidemic diarrhea virus.

[0010] Wherein, the drug inhibits viral attachment, internalization or replication.

[0011] Among them, the plant essential oils are eucalyptus essential oil, artemisia annua essential oil, wormwood essential oil, eucalyptus essential oil, magnolia essential oil, melaleuca alternifolia essential oil, melaleuca alternifolia essential oil, myrtle essential oil, sage essential oil, tea tree essential oil, rosemary essential oil, white cardamom essential oil, and mountain osmanthus essential oil.

[0012] Wherein, the amount of eucalyptol contained in the eucalyptus essential oil is not less than 60% w / w.

[0013] Wherein, the pig is a piglet.

[0014] Wherein, the dosage of eucalyptol is 6.25-100 mg / kg; the dosage of eucalyptus essential oil is 10.31-167.92 mg / kg.

[0015] The drug is prepared from eucalyptol as an active ingredient and pharmaceutically acceptable excipients or auxiliary ingredients into a commonly used pharmaceutical preparation. Preferably, the preparation is a powder, granules or decoction.

[0016] Experiments have confirmed the antiviral effects of eucalyptol on PEDV in vitro and in vivo. In in vitro experiments, eucalyptol inhibited the replication of PEDV in a dose-dependent manner. By exploring its effects on the life cycle of PEDV, it was found that eucalyptol was able to inhibit the attachment, internalization and replication of the virus. In in vivo experiments, all six piglets in the PEDV-infected group eventually died, while the eucalyptol-treated group was able to increase the survival rate of piglets, and clinical symptoms and pathological lesions were significantly alleviated. The results showed that eucalyptol has a good effect against PEDV, and due to its cost-effectiveness, it has potential in the development of new drugs against PEDV.

[0017] The present invention also provides a eucalyptus essential oil for preparing a drug for preventing and treating PEDV infection. Through cell activity tests, it can be known that for normal cells and at drug concentrations without any toxicity, the essential oil promotes cell growth and makes the cell layer structure compact. When the drug concentration is 0.08-0.63μg / mL (the original drug dose is 2.40μg / mL-19.2μg / mL), the normal Vero and Marc-145 cell morphology does not change significantly; the antiviral test is carried out by indirect immunofluorescence, and the results show that compared with the blank group, eucalyptus essential oil has a significant antiviral effect, indicating that eucalyptus essential oil can effectively inhibit the proliferation of PEDV in various ways. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The effect of eucalyptol on the activity of Vero cells;

[0019] Figure 2 The effect of eucalyptol on the activity of Marc-145 cells;

[0020] Figure 3 This is the effect of eucalyptol on the resistance of Vero cells to PEDV virus. Figure 3 (2) IFA visualization results, Note: Compared with 0 μg / mL, * P<0.05, ** P<0.01, *** P < 0.001, **** P<0.0001. Figure 3 (3) is the expression result of PEDV N protein, compared with the blank group, #### P<0.0001; compared with the model group, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;

[0021] Figure 4 The effect of eucalyptol on different stages of PEDV life cycle. Note: Compared with the blank group, * P<0.05, ** P<0.01,*** P < 0.001, **** P < 0.0001;

[0022] Figure 5 is the standard curve of copy number and CT value;

[0023] Figure 6 Changes in the number of red blood cells in mice after oral administration of eucalyptol 14 days later;

[0024] Figure 7 Changes in the number of white blood cells in mice after oral administration of eucalyptol 14 days later;

[0025] Figure 8 Changes in platelet count in mice after oral administration of eucalyptol 14 days later;

[0026] Fig. 9 :Effects of different doses of eucalyptol on diarrhea and body weight of piglets infected with PEDV;

[0027] Fig.10 :Effects of different doses of eucalyptol on the survival rate of piglets during PEDV infection;

[0028] Fig.11 :Effects of different doses of eucalyptol on the degree of diarrhea in piglets infected with PEDV. The diarrhea scores are as follows: normal, 0; soft stool, 1; loose stool, 2; watery stool, 3;

[0029] Fig.12 :Effect of eucalyptol on the levels of inflammatory cytokines in intestinal tissues of PEDV-infected piglets. The levels of IL-1β, IL-8 and IL-6 in the mock group, PEDV-infected group, eucalyptol low-dose group 6.25 mg / kg, medium-dose group 25 mg / kg, and high-dose group 100 mg / kg were measured by Elisa. Each data point represents the results of three independent experiments (mean ± SD). Significant differences compared with the PEDV infection group are indicated by *(p<0.05), **(p<0.01), *(p<0.001) and ****(p<0.0001);

[0030] Fig.13 (a) Immunohistochemical expression of IFN-α level in intestinal tissue of each group of pigs; (b) Immunohistochemical expression of IL-6 level in intestinal tissue of each group of pigs; (c) Immunohistochemical results of intestinal tissue of each group of pigs (100×); Note: Compared with the blank group, #### P<0.0001; compared with the PEDV infection group, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;

[0031] Fig.14The effect of eucalyptus essential oil on the activity of Vero cells;

[0032] Fig.15 The effect of eucalyptus essential oil on the activity of Marc-145 cells;

[0033] Fig.16 The effect of eucalyptus essential oil on the resistance of Vero cells to PEDV virus;

[0034] Fig.17 The effect of eucalyptus essential oil on the resistance of MARC-145 cells to PEDV virus;

[0035] Fig.18 Changes in the number of red blood cells in mice after oral administration of eucalyptus essential oil for 14 days;

[0036] Fig.19 Changes in the number of white blood cells in mice after oral administration of eucalyptus essential oil for 14 days;

[0037] Fig. 20 Changes in platelet count in mice after 14 days of oral administration of eucalyptus essential oil;

[0038] Fig.21 Effects of different doses of eucalyptus essential oil on diarrhea in piglets infected with PEDV. d1-d9: Piglets in the eucalyptus essential oil 10mg / kg, 50mg / kg, and 120mg / kg groups were gavaged with different doses of eucalyptus essential oil and the same dose of PEDV;

[0039] Fig. 22 Effects of different doses of eucalyptus essential oil on the survival rate of piglets during PEDV infection;

[0040] Fig.23 Effects of different doses of eucalyptus essential oil on the degree of diarrhea in piglets infected with PEDV. The diarrhea scores are as follows: normal, 0; soft stool, 1; watery stool, 3;

[0041] Fig.24 (A) Immunohistochemistry results of intestinal tissue of each group of pigs (100×); (B) Expression level of IFN-α by immunohistochemistry of intestinal tissue of each group of pigs; (C) Expression level of IL-6 by immunohistochemistry of intestinal tissue of each group of pigs; Note: Compared with the blank group, ####P<0.0001; compared with the PEDV infection group, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;

[0042] Fig.25:Effect of eucalyptus essential oil on the levels of inflammatory cytokines in the intestinal tissue of PEDV-infected piglets. Each data point represents the results of three independent experiments (mean ± SD). Significant differences compared with the PEDV infection group are indicated by *(p < 0.05), **(p < 0.01), *(p < 0.001) and ****(p < 0.0001). Significant differences compared with Mock are indicated by # (p<0.05), ## (p<0.01), ### (p<0.001) and #### (p<0.0001);

[0043] Fig.26 The significant differences in the anal swab viral load of the challenged piglets after oral administration of eucalyptus essential oil compared with the PEDV infection group are indicated by *(p<0.05), **(p<0.01), *(p<0.001) and ****(p<0.0001);

[0044] Fig. 27 The viral loads in the jejunum and ileum of the challenged piglets after oral administration of eucalyptus essential oil were significantly different from those in the PEDV infection group, as indicated by *(p<0.05), **(p<0.01), *(p<0.001) and ****(p<0.0001). DETAILED DESCRIPTION

[0045] Test Example 1 In vitro test, efficacy test and safety test of eucalyptol of the present invention

[0046] 1. Methods

[0047] 1.1 Reagents

[0048] Eucalyptol was purchased from Shanghai Yuanye Biotechnology Co., Ltd., product number W12835.

[0049] 1.2 Cell lines and viruses

[0050] Vero cells (a type of African green monkey kidney epithelial cells) were preserved in this laboratory. High-glucose DMEM cell culture medium was purchased from Hyclone, USA. CO2 incubators and biosafety cabinets were purchased from Thermo, USA. Fetal bovine serum was purchased from PAN-Biotech, Germany. Enhanced CCK-8 kit (CT0001, Shandong Sikejie Biotechnology Co., Ltd.). The PEDV strain used in the present invention is CH / HBTS / 2017 (GenBank accession number: MH581489.1). Vero cells and Marc-145 cells were cultured in a 37°C, 5% CO2 incubator using high-glucose DMEM medium containing 10% fetal bovine serum and 1% double antibody. Cells were digested and passaged with 0.25% trypsin during cell passage.

[0051] 1.3 Cytotoxicity

[0052] The Vero cells and Marc-145 cells in the cell flask were digested and the digested cell suspension was transferred to a 96-well plate with 1×10 cells per well. 4 When the cell density was 80% to 90%, eucalyptol was dissolved with ethanol solution, and then gradiently diluted with DMEM basal medium to a concentration of 1.68, 3.36, 6.72, 13.44, 26.88, 53.76, 107.52 μg / mL, and an appropriate amount of eucalyptol dilution was added to a 96-well plate, and an equal amount of DMEM was added to the cell control group and the blank control group. After 48 hours, 10 μL of CCK-8 solution was added to each well and cultured for 1 hour, and then the OD value of each well was detected at 450 nm and the cell viability was calculated.

[0053] Cell survival rate = (OD value of drug administration group - OD value of blank group) / (OD value of normal group - OD value of blank group);

[0054] The OD value of the drug administration group represents the OD450 value of cells incubated with eucalyptol and CCK-8 solution, the OD value of the blank group represents the OD450 value of the well without cells, and the normal group refers to the OD450 value of cells incubated without eucalyptol but with CCK-8 solution.

[0055] 1.4 Viral infection

[0056] Vero cells were inoculated into 24-well cell culture plates, and when the cells grew to about 80-90% confluence in the culture plates, 0.36, 6.72, 13.44 μg / mL eucalyptol solutions and DMEM were incubated for 24 h, washed three times with PBS solution, 0.01 MOI of PEDV virus was added, and 10 μg / mL trypsin solution was used to culture at 37°C for 6 h. Then, real-time reverse transcription PCR (RT-Q-PCR) and immunofluorescence assay (IFA) were used for determination.

[0057] 1.5 Effect of eucalyptol on the life cycle of PEDV

[0058] 1.5.1 Adhesion test

[0059] The Vero cells in the cell flask were digested and the digested cell suspension was transferred to a 96-well plate with 1×10 cells per well. 4 When the cell density was 80% to 90%, the cells were treated with 13.44 μg / mL eucalyptol culture medium at 37°C for 1 hour and pretreated at 4°C for 0.5 hour. The cells were rinsed with PBS solution and inoculated with PEDV virus (0.01 MOI) at 4°C for 15 minutes, 30 minutes, and 60 minutes, respectively. The cell culture medium was discarded, the cells were rinsed with PBS, and the cell lysate was collected, and its relative content was determined by real-time RT-Q-PCR.

[0060] 1.5.2 Internalization experiment

[0061] The Vero cells in the cell flask were digested and the digested cell suspension was transferred to a 96-well plate with 1×10 cells per well. 4 When the cell density was 80% to 90%, the cells were infected with PEDV (0.01 MOI) for 1 h at 4°C, washed 3 times with PBS buffer, and the unadsorbed virus was discarded. One group was added with blank culture medium, and the other group was added with 13.44 μg / mL eucalyptol culture medium, incubated at 37°C for 30 min, 1 h, and 2 h, respectively, the cell culture medium was discarded, the cells were washed with PBS, the cell lysate was collected, and its relative content was determined by real-time RT-Q-PCR.

[0062] 1.5.3 Replication Experiment

[0063] The Vero cells in the cell flask were digested and the digested cell suspension was transferred to a 96-well plate with 1×10 cells per well. 4 When the cell density was 80% to 90%, they were infected with 13.44 μg / mL eucalyptol culture medium and PEDV (0.01 MOI) at 37°C for 1 h, the cell culture medium was removed, and then one group was added with blank culture medium and one group was added with 13.44 μg / mL eucalyptol culture medium, and they were incubated at 37°C for 2 h, 4 h, and 6 h, respectively. The cells were washed with PBS, the cell lysate was collected, and the relative content was determined by real-time RT-Q-PCR.

[0064] 1.5.4 Release Experiment

[0065] The Vero cells in the cell flask were digested and the digested cell suspension was transferred to a 96-well plate with 1×10 cells per well. 4When the cell density was 80% to 90%, the virus was infected with PEDV (0.01MOI) at 37°C for 1 h to ensure virus adsorption and penetration, the cell supernatant was removed, and the cells were rinsed three times with PBS. After 10 h of infection, one group was added with blank culture medium, and the other group was added with 13.44 μg / mL eucalyptol culture medium. The cells were treated at 37°C for 0.5 h, 1 h, and 2 h, and the cell supernatant was taken for real-time RT-Q-PCR to determine the virus copy number.

[0066] 1.6 Immunofluorescence assay

[0067] PEDV-infected cells were washed three times with PBS solution, fixed with methanol:acetone (4:1) solution at 4°C for 30 minutes, and washed three times with PBS solution (5 minutes each time). The primary antibody was added to the sample and incubated overnight at 4°C, the primary antibody was removed, and washed three times with PBS solution (5 minutes each time). Then the secondary antibody was added, the sample was incubated at 37°C in the dark for one hour, and then washed three times with PBS solution (5 minutes each time). DAPI nuclear staining solution was used for 5-8 minutes, washed three times with PBS solution (5 minutes each time), and then observed and photographed using a fluorescent inverted microscope.

[0068] 1.7 Virus titer

[0069] Real-time fluorescence quantitative PCR was used to detect the virus titer. When the cells grew to 80% confluence, the cells were washed three times with PBS buffer solution, and DMEM infection solution containing 10μg / mL trypsin was prepared. The virus was added to the Vero cells, gently shaken, cultured for 1.5 hours, and 7.5μg / mL maintenance solution was added to continue culturing in a carbon dioxide incubator. When the cell pathological changes were 80%, the venom was harvested, and the virus titer was determined by real-time fluorescence quantitative PCR after freezing and thawing three times.

[0070] 1.8 Animal experiments

[0071] 54 BALB / c mice are purchased from Shaanxi University of Chinese Medicine Animal Experiment Center, are randomly divided into 6 groups (9 mice / group), and are kept in 6 separate rooms.At the 0th day, the mice in the 1st group are administered 0.4mL DMEM through the stomach and as a control.The mice in the 2nd-6th group are gavaged with the 0.4mL DMEM containing 10,50,250,500 and 2500mg / kg eucalyptol.In acute toxicity studies, observe and record mouse death in the time of 14 days.

[0072] Thirty healthy 7-day-old crossbred (Duroc × Landrace × Large White) piglets (half male and half female) were purchased from a PEDV-negative pig farm, with an initial body weight of 2.17 ± 0.25 kg. The experimental basal diet (liquid milk additive) was used, and the piglets were housed in clean pens to strictly control cross-infection. The low-dose group of eucalyptol was 6.25 mg / kg, the medium-dose group was 25 mg / kg, and the high-dose group was 100 mg / kg. According to 10×TCID 50 Virus dose: PEDV virus was orally administered to piglets in the Mock group, and the same volume of cell culture medium was orally administered to piglets in the Mock group. The five groups of animals were reared in different areas to avoid cross infection; the piglets were artificially breastfed for 3 hours / time. After the virus attack, the clinical symptoms of the animals were observed and recorded every day, including survival rate, weight change, diarrhea and vomiting. After the death of the piglets, the pathological changes of various organs were observed by autopsy, and the intestines were collected and fixed in 4% paraformaldehyde, and Elisa detection and immunohistochemistry were performed to observe the pathological histological changes.

[0073] 1.9 Immunohistochemical analysis

[0074] After incubation at 4°C overnight, the porcine intestinal tissue was sliced ​​and compared with specific primary antibodies for IFN-α and IL-6. The slices were washed with phosphate-buffered saline, and then poly-HRP anti-rabbit IgG secondary antibody was added. After rinsing with phosphate-buffered saline, the slices were treated with diaminobenzidine (DAB). Hematoxylin was used for counterstaining and observed under light microscopy. Image analysis software Image-Pro Plus 6 was used to calculate the average integrated positive area from 3 randomly selected areas.

[0075] 1.10RT-Q-PCR

[0076] Total RNA was extracted from Vero cells according to the instructions of Trizol, and then used Prime Script TM cDNA was synthesized using the RT kit and gDNA Eraser. A standard curve was generated using serial dilutions of the plasmid containing the PEDV N gene, and the mRNA expression of β-actin was used as a relative reference for each experiment. The reaction conditions of the fluorescent quantitative PCR instrument were: 94°C for 3 minutes, 94°C for 10 seconds, 60°C for 30 seconds, and 40 cycles. Specific primers are shown in Table 1

[0077] Table 1 Specific primers

[0078] Primer Sequences(5'-3')

[0079] β-actin Forward AATCGTGCGTGACATTAAGGAGAAG

[0080] β-actin Reverse GCTCGTTGCCAATGGTGATGAC

[0081] PEDV Forward ACATCGTGCCAGTTGACCAATAC

[0082] PEDV Reverse AGCAATGTTGAGTTGACCGTCTTC

[0083] 1.11 Data Analysis

[0084] All results were subjected to t-test and one-way analysis of variance (ANOVA) using statistical software GraphPad Prism 9.5.0 to determine the significant differences between multiple groups. The data are presented as the mean ± standard deviation of one group in three independent experiments.

[0085] 2. Results

[0086] 2.1 Cytotoxicity (see Figure 1 , Figure 2 )

[0087] Table 1 Effect of eucalyptol on the activity of Vero and Marc-145 cells ( n=3)

[0088]

[0089] The test results are as follows Figure 1 , Figure 2 As shown, as the concentration increases to a certain concentration, it will affect cell activity. The optimal drug concentration under guaranteed cell activity was screened by microscopic observation and CCK-8 determination. When the drug concentration was 13.44μg / mL, the cell morphology of normal Vero cells and Marc-145 cells did not change significantly, and after 24h, it promoted cell growth and the cell layer structure was tight; when the drug concentration was 26.88μg / mL, the cell morphology of Vero cells and Marc-145 cells would all fall off, break or die within 24h. Therefore, the appropriate concentration of drug treatment for Vero cells and Marc-145 cells is 13.44μg / mL / mL.

[0090] 2.2 Antiviral activity of eucalyptol against PEDV

[0091] In order to verify the antiviral activity of eucalyptol against PEDV, Vero cells were incubated with eucalyptol for 24 hours at concentrations of 3.36, 6.72, and 13.44 μg / mL, respectively. Vero cells were infected with PEDV (0.01 MOI) for 6 hours and examined by IFA. The results showed that after 24 hours of adding eucalyptol culture medium, Vero cells were observed under an optical microscope and it was found that both the normal cell control group and the drug group promoted cell growth and the cell layer structure was denser. After 6 hours of infection with the PEDV virus, both the blank group and the drug group showed cell fusion, shedding, and increased cell layer vacuoles. Figure 3 The results showed that the degree of lesions in the blank group was significantly higher than that in the drug group, indicating that eucalyptol has a significant anti-PEDV virus effect. FITC refers to the green fluorescence image displayed by the combination of cells and viruses, DAPI is the cell nucleus image, and the Merge image is the combination of FITC and DAPI images. IFA visualization result analysis, using image j to normalize FITC analysis, shows that eucalyptol can effectively inhibit PEDV and is dose-dependent.

[0092] In order to verify the antiviral activity of eucalyptol against PEDV, RT-Q-PCR was used to detect the expression of PEDV N protein. It was found that the expression of PEDV N protein in the model group was significantly higher than that in the blank group (p<0.001), and the expression of PEDV N protein in the high, medium and low groups was significantly lower than that in the model group (p<0.001). This shows that eucalyptol can effectively inhibit the replication of PEDV, and its inhibitory effect on PEDV increases with the increase of dose.

[0093] Table 2 IFA visualization results analysis ( n=3)

[0094]

[0095] Table 3 Effect of eucalyptol on the expression of PEDV N protein ( n=3)

[0096]

[0097] 2.3 Effects of eucalyptol on different stages of the PEDV life cycle

[0098] In order to understand the exact stage of eucalyptol's inhibitory effect on PEDV, the effect of eucalyptol on different infection stages of PEDV was evaluated. At different stages of the PEDV life cycle, cells were infected with PEDV at 0.01 MOI, Vero cells were treated with 13.44 μg / mL eucalyptol culture medium, and cell lysates were collected to determine the expression of PEDV N mRNA. Figure 4As shown, the attachment of the virus to Vero cells showed that eucalyptol could affect the attachment of PEDV as the treatment time increased (p<0.05). When evaluating the effect of eucalyptol on PEDV internalization, as the treatment time increased, it was shown that eucalyptol could effectively inhibit virus internalization (p<0.001). Then, the effect of eucalyptol on PEDV replication was detected after adding eucalyptol during the viral replication stage. Compared with the blank group, the level of PEDV N mRNA treated with eucalyptol was significantly different. In addition, the virus release test showed that there were no significant results in the number of viral particle copies between the blank group and the drug group, indicating that eucalyptol had no effect on the release of PEDV virus. In summary, eucalyptol mainly inhibits PEDV infection by affecting the internalization and replication of the virus.

[0099] Table 4 Effect of eucalyptol on the adhesion stage of PEDV ( n=3)

[0100]

[0101]

[0102] Table 5 Effect of eucalyptol on the internalization stage of PEDV ( n=3)

[0103]

[0104] Table 6 Effect of eucalyptol on PEDV replication stage ( n=3)

[0105]

[0106] Table 7 Effect of eucalyptol on the release phase of PEDV ( n=3)

[0107]

[0108] 2.4 Virus titer

[0109] The copy number of viral particles of the virus solution was measured by RT-Q-PCR, and the plasmid was serially diluted and assayed, as Figure 5 As shown, its standard curve is Y = -3.3152X + 37.964, R 2 =0.9992, the CT value of the virus stock solution is 26.3608, and its copy number is measured to be 10 3.5 .

[0110] Table 8 Establishment of standard curve

[0111]

[0112] 2.5 Eucalyptol in mice (see Figure 6 , Figure 7 , Figure 8 )

[0113] To determine the safe oral dose of eucalyptol, we performed an acute toxicity study. Mice were orally administered eucalyptol at doses of 0, 10, 50, 250, 500, or 2500 mg / kg. No mortality was observed in any of the treatment groups over a 14-day period ( Figure 6 However, oral administration of 2500 mg kg -1 After the administration of eucalyptol, the body weight of mice decreased in the first 4 days, while the other treatment groups were not affected. On day 14, the body weight of mice in different treatment groups was not significantly different from that of control mice. Therefore, the oral dose was selected as 500 mg / kg. After body surface area conversion, the oral dose for piglets was set at 6.25 mg / kg for the low-dose group of eucalyptol, 25 mg / kg for the medium-dose group, and 100 mg / kg for the high-dose group to study whether eucalyptol can protect piglets from PEDV infection.

[0114] In order to clarify the effect of eucalyptol on the number of red blood cells, white blood cells and platelets in mice, mice were gavaged with 0, 10, 50, 250, 500 or 2500 mg / kg eucalyptol, and the changes in the number of red blood cells, white blood cells and platelets in mice were recorded within 14 days. Figure 6 As shown in (A), within 14 days of administration, compared with the healthy control group (CTRL) mice, the number of red blood cells in the eucalyptol-treated mice (10 mg / kg, 50 mg / kg, 250 mg / kg, 500 mg / kg) was within the normal range (6.5-11.5 x 10 6 μL). Figure 6 As shown in (B), compared with the healthy control group mice (CTRL), the total white blood cell count of mice in each eucalyptol administration group (10 mg / kg, 50 mg / kg, 250 mg / kg, 500 mg / kg, 2500 mg / kg) was within the normal range (1.05-10.6×10 3 μL). Figure 6 As shown in (C), compared with the healthy control group mice (CTRL), the platelet counts of the mice in the eucalyptol-treated groups (10 mg / kg, 50 mg / kg, 250 mg / kg, and 500 mg / kg) were within the normal range (400-2 300 x 10 3 The above results show that eucalyptol concentrations within the range of 0-2500 mg / kg will not affect the number of red blood cells and white blood cells in mice, and within the range of 0-500 mg / kg will not affect the number of platelets in mice.

[0115] Table 9 Effect of eucalyptol on the number of blood cells in mice after 14 days of oral administration ( n=6)

[0116]

[0117] 2.6 Eucalyptol inhibits PEDV (see Fig. 9 )

[0118] Table 10: Statistics of weight changes of piglets in different groups during PEDV infection ( n=6)

[0119]

[0120] Table 11: Statistics of survival rate of piglets in different groups during PEDV infection

[0121]

[0122] Table 12: Statistical table of diarrhea severity scores of piglets in different groups during PEDV infection ( n=6)

[0123]

[0124] 2.7 Effect of eucalyptol on the levels of inflammatory cytokines in the intestinal tissue of PEDV-infected piglets (see Fig.12 )

[0125] Table 13: Statistical table of inflammatory cytokine levels in intestinal tissues of piglets infected with PEDV in different groups ( n=6)

[0126]

[0127] 2.8 Effect of eucalyptol on the expression of related factors in the intestinal tissue of PEDV-infected pigs

[0128] IFN-α is a proinflammatory cytokine and a broad-spectrum antiviral agent. It does not directly kill or inhibit viruses, but mainly inhibits viral replication by causing cells to produce antiviral proteins through the action of cell surface receptors. IL-6 is an important member of the cytokine network and plays an important role in inflammation. The expression of IFN-α and IL-6 proteins in pig intestinal tissue was observed and detected by immunohistochemistry. The results showed that compared with the blank group, the expression levels of IFN-α and IL-6 in pig intestinal tissue after PEDV infection were significantly increased (P<0.0001). Compared with the PEDV-infected group, the use of different doses of eucalyptol significantly reduced the expression of IFN-α and IL-6, respectively (p<0.05 and p<0.01). Among them, the IFN-α and IL-6 secretion levels of the high-dose eucalyptol group (100 mg / kg) decreased significantly (P<0.0001). Fig.13 (a), (b), (c).

[0129] Table 14 Statistical table of IFN-α and IL-6 expression levels in different groups of piglets infected with PEDV ( n=3)

[0130]

[0131]

[0132] 2. Discussion and Conclusion

[0133] The present invention first determines the cytotoxicity of eucalyptol in PEDV susceptible cells Vero and Marc-145, and finds that eucalyptol is non-toxic to cells at a concentration of 13.44 μg / mL. The inhibitory effect of eucalyptol on PEDV was further detected by IFA and RT-Q-PCR technology, and it was found that eucalyptol can effectively reduce the expression of PEDV N in cells. In order to further explore the specific stage of eucalyptol's inhibition of PEDV, an experiment of the virus replication cycle was designed, and it was found that eucalyptol can effectively inhibit the internalization and replication stages of PEDV.

[0134] In addition, through acute toxicity experiments and subchronic toxicity assessments, it was found that when different doses of eucalyptol were orally administered to mice, no mouse deaths were found within 14 days, and the white blood cells, red blood cells and platelets of the mice were not affected. Although the platelet (PLT) level was reduced in the high-dose (2500 mg / kg) group, it may be that the administration of eucalyptol reduced blood viscosity. Therefore, the oral dose was selected as 500 mg / kg. After body surface area conversion, the oral dose of piglets was set at 6.25 mg / kg for the low-dose group, 25 mg / kg for the medium-dose group, and 100 mg / kg for the high-dose group to explore whether eucalyptol can protect piglets from PEDV attack. In this experiment, healthy piglets with negative PEDV test were selected as experimental animals. Piglets in the PEDV-treated group and the eucalyptol group were orally administered with 10×TCID 50 The PEDV-treated piglets were treated with the virus solution of 100 μg / mL, and the Mock group was orally administered with the same volume of DMEM. The piglets in the PEDV-treated group gradually developed mild diarrhea, severe diarrhea, and dehydration and death over time; the feces gradually changed from solid to watery and loose feces, accompanied by depression. The diarrhea of ​​the suckling piglets in the eucalyptol group was improved to varying degrees. At 8 dpi, the survival rates of suckling piglets in the PEDV-treated group and the low, medium, and high eucalyptol groups were 0% (0 / 6), 16.7% (1 / 6), 16.7% (1 / 6), and 33.3% (2 / 6), respectively. RNA was extracted from the intestinal tissues of suckling piglets in each group, and the levels of inflammatory cytokines IL-1β, IL-8, and IL-6 in the intestinal tissues were measured by ELISA. It was found that the eucalyptol group could significantly reduce the increase of inflammatory factors caused by PEDV infection. Immunohistochemistry results showed that eucalyptol could reduce the protein expression of IFN-α and IL-6. These results demonstrate the anti-inflammatory effect of eucalyptol in PEDV-infected pigs. Through clinical symptom observation, pathological observation, etc., it was found that eucalyptol has a certain therapeutic effect on PEDV-infected piglets.

[0135] PEDV is a major problem for pig farms due to its widespread presence in the pig industry. PEDV invades the intestinal epithelial cells of pigs and causes enteritis in pigs of all ages, often with fatal risks for newborn piglets. Although vaccines are available, their safety and efficacy are limited, and large-scale infections still occur. Therefore, effective antiviral drugs are urgently needed to address this threat. Experiments have shown that eucalyptol can inhibit PEDV infection both in vitro and in vivo, may help control PED in pig farms, and is a potential broad-spectrum antiviral drug.

[0136] Test Example 2 In vitro test, efficacy test and safety test of eucalyptus essential oil of the present invention

[0137] 1. Cell activity test

[0138] Vero cells (a type of African green monkey kidney epithelial cells) were preserved in this laboratory. High-glucose DMEM cell culture medium was purchased from Hyclone, USA. CO2 incubator and biological safety cabinet were purchased from Thermo, USA. Fetal bovine serum was purchased from PAN-Biotech, Germany. Enhanced CCK-8 kit (CT0001, Shandong Si Ke Jie Biotechnology Co., Ltd.) was used.

[0139] The PEDV strain used in the present invention is CH / HBTS / 2017 (GenBank accession number: MH581489.1). Vero cells and Marc-145 cells were cultured in a high-glucose DMEM medium containing 10% fetal bovine serum and 1% double antibody in a 37°C, 5% CO2 incubator. When the cells were passaged, they were digested and passaged with 0.25% trypsin.

[0140] Eucalyptus essential oil was extracted by steam distillation and purchased from Ningbo Aromatic Wharf Biotechnology Co., Ltd.

[0141] The Vero F cells and Marc-145 cells in the cell flask were digested and the digested cell suspension was transferred to a 96-well plate with 1×10 cells per well. 4 When the cell density was 80% to 90%, eucalyptus essential oil was dissolved in ethanol, and then gradiently diluted with DMEM basal medium to a concentration of 2.4, 4.8, 9.6, 19.2, 38.4, 76.8, 153.6 μg / mL, and an appropriate amount of essential oil dilution was added to a 96-well plate, and an equal amount of DMEM was added to the cell control group and the blank control group. After 48 hours, 10 μL of CCK-8 solution was added to each well and cultured for 1 hour, and then the OD value of each well was detected at 450 nm and the cell viability was calculated.

[0142] Cell survival rate = (OD value of drug administration group - OD value of blank group) / (OD value of normal group - OD value of blank group);

[0143] The test results are as follows Fig.14 , Fig.15 As shown, as the concentration increases to a certain concentration, it will affect cell activity. The optimal drug concentration under guaranteed cell activity was screened by microscopic observation and CCK-8 determination. When the drug concentration was 19.2μg / mL, the cell morphology of normal Vero cells and Marc-145 cells did not change significantly, and after 24h, it promoted cell growth and the cell layer structure was tight; when the drug concentration was 38.4μg / mL, the cell morphology of Vero cells and Marc-145 cells would all fall off, break or die within 24h. Therefore, the appropriate concentration of drug treatment for Vero cells and Marc-145 cells is 19.2μg / mL.

[0144] Table 15 Effect of eucalyptus essential oil on the activity of Vero and Marc-145 cells ( n=3)

[0145]

[0146] 2. Effect of Eucalyptus Essential Oil on Anti-Porcine Epidemic Diarrhea Virus

[0147] Anti PEDV / NP (M100048, Beijing Subenyuanhe Technology Co., Ltd.); FITC goat anti-mouse IgG (H+L) (BA1101, Wuhan Boster Bioengineering Co., Ltd.); DAPI solution (NO.C0065, Beijing Solebow Technology Co., Ltd.).

[0148] Vero F cells were inoculated in a 24-well cell culture plate. 500 μL of 19.2 μg / mL eucalyptus essential oil solution was evenly added to each well, and 0.01 MOI of PEDV virus was added 24 hours later. The samples were collected after incubation at 37°C for 6 hours.

[0149] PEDV-infected cells were washed three times with PBS solution, fixed with methanol:acetone (4:1) solution at 4°C for 30 minutes, and washed three times with PBS solution (5 minutes each time). The primary antibody was added to the sample and incubated overnight at 4°C, the primary antibody was removed, and washed three times with PBS solution (5 minutes each time). The secondary antibody was then added, the sample was incubated at 37°C in the dark for one hour, and then washed three times with PBS solution (5 minutes each time). DAPI nuclear staining solution was used for 5-8 minutes, washed three times with PBS solution (5 minutes each time), and then observed and photographed using a fluorescent inverted microscope.

[0150] Vero cell test results Fig.16 As shown in the figure, after adding the oil-containing culture medium for 24 hours, the Vero cells were observed under an optical microscope and it was found that both the normal cell control group and the drug group promoted cell growth and the cell layer structure was more compact. After 6 hours of infection with the PEDV virus, both the blank group and the drug group showed cell fusion, shedding, and increased cell layer vacuoles. Fig.16 The results showed that the degree of lesions in the blank group was significantly higher than that in the drug group, indicating that eucalyptus essential oil has a significant anti-PEDV virus effect. FITC refers to the green fluorescence image displayed by the combination of cells and viruses, DAPI is the cell nucleus image, and the Merge image is the combination of FITC and DAPI images.

[0151] Marc-145 cell test results Fig.17 As shown, the degree of lesions in the blank group was significantly higher than that in the drug group, indicating that eucalyptus essential oil has a significant anti-PEDV virus effect.

[0152] 3. In vivo experiments

[0153] The toxicity and anti-PEDV activity of eucalyptus essential oil in vivo were measured as described above. Thirty-six BALB / c mice were purchased from Shaanxi University of Chinese Medicine and randomly divided into 6 groups (6 mice / group). They were housed in a separate room. On day 0, the first group of mice were gavaged with 0.4 mL DMEM as a control group. Groups 2-6 of mice were gavaged with 0.4 mL DMEM containing 10, 50, 250, 500 and 2500 mg / kg of eucalyptus essential oil. In the acute toxicity study, the death of mice within 14 days was observed and recorded. For the subchronic toxicity assessment, the body weight of each mouse was measured every day after the administration of eucalyptus essential oil, and the mice were autopsied 14 days after inoculation. Blood samples from all mice were collected for blood cell testing.

[0154] In the PEDV protection test, 30 4-day-old crossbred conventional newborn piglets were divided into 5 groups and raised in 5 separate rooms. The colloidal gold rapid test kit was used to confirm that the 30 newborn piglets were negative for PEDV, TGEV and porcine rotavirus. Eucalyptus essential oil low-dose group 10mg / kg, medium-dose group 50mg / kg, high-dose group 120mg / kg, according to 10×TCID 50 Virus dose PEDV virus was orally administered to piglets, and the same volume of cell culture medium was orally administered to piglets in the DMEM group. The piglets that died in the PEDV group were recorded, and autopsies and samples were taken immediately. The body temperature and weight of the piglets were recorded 12 h before inoculation and every 12 h until death. As described above, all piglets were evaluated daily for clinical signs of lethargy and diarrhea. All piglets died after PEDV infection, and the piglet intestinal tissues were collected and examined by histopathology and immunohistochemistry staining.

[0155] 4. Immunohistochemical Analysis

[0156] After incubation at 4°C overnight, the porcine intestinal tissue was sliced ​​and compared with specific primary antibodies for IFN-α and IL-6. The slices were washed with phosphate-buffered saline, and then poly-HRP anti-rabbit IgG secondary antibody was added. After rinsing with phosphate-buffered saline, the slices were treated with diaminobenzidine (DAB). Hematoxylin was used for counterstaining and observed under light microscopy. Image analysis software Image-Pro Plus 6 was used to calculate the average integrated positive area from 3 randomly selected areas.

[0157] 5. Results

[0158] 5.1 Acute toxicity test of eucalyptus essential oil on mice

[0159] This experiment first used an acute toxicity test on mice to determine the safe drug concentration for subsequent piglet experiments by measuring the effects of eucalyptus essential oil on mouse survival rate, body weight, food intake, red blood cell count, white blood cell count, platelet count and other indicators. Mice were orally administered eucalyptus essential oil at doses of 0, 10, 50, 250, 500 or 2500 mg / kg. No mice were found dead within 14 days, and the weight of mice gradually decreased after oral administration of 2500 mg / kg, while the number of red blood cells (6.5-11.5x106μL), white blood cells (1.05-10.6×103μL) and platelets (400-2 300x103μL) were all within the normal range. Therefore, an oral dose of 500 mg / kg was selected. After conversion to body surface area, the oral dose for piglets was set at 10 mg / kg for the low-dose group of eucalyptus essential oil, 50 mg / kg for the medium-dose group, and 120 mg / kg for the high-dose group, to study whether eucalyptus essential oil can protect piglets from PEDV infection.

[0160] Table 16 Effect of eucalyptus essential oil on the number of blood cells in mice after 14 days of intragastric administration ( n=6)

[0161]

[0162] 5.5 Effect of eucalyptus essential oil on diarrhea in piglets infected with PEDV

[0163] In order to further clarify the anti-PEDV infection effect of eucalyptus essential oil in vivo. This experiment was conducted on 4-day-old piglets. Before the infection, the body temperature, weight, mental state, fecal status, etc. of all piglets were normal. Three days after the infection, the weight of the piglets in the PEDV infection group continued to decline, while the weight of the essential oil administration group and the blank group gradually increased, indicating that PEDV infection can affect the weight of piglets, and the essential oil group can significantly alleviate this symptom (see Fig.21 ).

[0164] Table 17 Statistics of weight changes of piglets in different groups during PEDV infection ( n=6)

[0165]

[0166]

[0167] 5.6 Effect of eucalyptus essential oil on the survival rate of piglets challenged with poison

[0168] In order to further clarify the anti-PEDV infection effect of eucalyptus essential oil in vivo. This study investigated the mortality rate of piglets and found that 1 piglet died in the PEDV infection group 3 days after the virus attack, and the survival rate of this group of piglets was 83%. The survival rates of the eucalyptus essential oil group and the DMEM group were both 100%. 8 days after the virus attack, all piglets in the PEDV infection group died (0 / 6), 3 piglets in the eucalyptus essential oil group died, and the survival rate of this group was 50% (3 / 6), and the survival rate of the DMEM group was 100% (6 / 6). This shows that eucalyptus essential oil can effectively improve the survival rate of piglets (see Fig. 22 ).

[0169] Table 18: Statistics of survival rate of piglets in different groups during PEDV infection

[0170]

[0171] 5.7 Effect of eucalyptus essential oil on fecal characteristics of piglets challenged with drug

[0172] In order to clarify the effect of eucalyptus essential oil on the fecal characteristics of piglets challenged with poison, this experiment recorded the changes in fecal characteristics of piglets in each experimental group, and scored and recorded them according to the fecal characteristics scoring standard. Fig.23 As shown in the figure, 7 days after the virus attack, the piglets in the PEDV infection group had severe jet-like watery diarrhea after eating, until death, while only a few groups in the eucalyptus essential oil group had watery diarrhea. The fecal trait score of the piglets in the eucalyptus essential oil group was higher than that in the DMEM group, but lower than that in the PEDV infection group.

[0173] Table 19: Statistical table of diarrhea severity scores of piglets in different groups during PEDV infection ( n=6)

[0174]

[0175] 5.8 Effect of eucalyptus essential oil on intestinal histopathology of PEDV-infected piglets

[0176] In order to clarify the effect of eucalyptus essential oil on the intestine of piglets challenged with virus, this experiment used immunohistochemistry to analyze the intestine of piglets in each experimental group. The results showed that compared with the Mock group, the expression levels of IFN-α and IL-6 in the intestinal tissue of pigs after PEDV infection were significantly increased (P<0.0001). Compared with the PEDV-infected group, the use of different doses of eucalyptus essential oil significantly reduced the expression of IFN-α and IL-6, respectively (p<0.05 and p<0.01), among which the IFN-α and IL-6 secretion levels of the high-dose eucalyptus essential oil group (120 mg / kg) decreased significantly (P<0.0001), such as Fig.24 (A), (B), (C).

[0177] Table 20 Statistical table of IFN-α and IL-6 expression levels in different groups of piglets infected with PEDV ( n=3)

[0178]

[0179] 5.9 Effect of eucalyptus essential oil on the levels of inflammatory cytokines in the intestinal tissue of piglets infected with PEDV

[0180] In order to clarify the effect of eucalyptus essential oil on the level of inflammatory cytokines in the intestinal tissue of piglets, this study used Elisa kits to measure the levels of IL-1β, IL-8 and IL-6 in the mock group, PEDV infection group, eucalyptus essential oil 10mg / kg, eucalyptus essential oil 50mg / kg and eucalyptus essential oil 120mg / kg. Fig.25 As shown in the results, after PEDV infection, the levels of IL-1β, IL-8 and IL-6 increased significantly, and after adding essential oil, the levels of IL-1β, IL-8 and IL-6 decreased significantly (P<0.01, P<0.0001 and P<0.001). This indicates that eucalyptus essential oil can significantly reduce the inflammatory response caused by PEDV infection.

[0181] Table 21: Statistical table of inflammatory cytokine levels in intestinal tissues of piglets infected with PEDV in different groups ( n=6)

[0182]

[0183] 5.10 Effect of eucalyptus essential oil on fecal viral load in PEDV-infected piglets

[0184] In order to clarify the effect of eucalyptus essential oil on the excretion of virus-challenged piglets, this experiment used the qRT-PCR method to detect the copy number of PEDV N in the fecal samples collected. Fig.26 As shown, the number of viral copies in the feces of the PEDV-infected control group was 10 8.27 , 10 8.13 and 10 7.77 The viral copy numbers in the high-dose essential oil group were 10 copies / mL. 4.57 , 10 5.37 and 10 4.13 The eucalyptus essential oil group could significantly reduce the viral load in the anal swabs of piglets in the PEDV infection group.

[0185] Table 22 Viral load of anal swabs in challenged piglets after oral administration of eucalyptus essential oil

[0186]

[0187]

[0188] 5.11 Effect of eucalyptus essential oil on intestinal viral load in virus-challenged piglets.

[0189] In order to clarify the effect of eucalyptus essential oil on intestinal detoxification of piglets challenged with virus, this experiment used the qRT-PCR method to detect the copy number of PEDV N in the collected jejunum and ileum samples. Fig. 27 As shown, 8 days after the virus attack, the viral copy numbers in the jejunum and ileum of the PEDV-infected control group were 10 8.50 and 10 8.50 The viral copy numbers in the high-dose essential oil group were 10 copies / mL. 4.37 and 10 3.80 The eucalyptus essential oil group could significantly reduce the viral load in the jejunum and ileum of the PEDV infection group.

[0190] Table 23 Viral load in the jejunum and ileum of challenged piglets after oral administration of eucalyptus essential oil

[0191]

[0192] 6. Discussion

[0193] The present invention shows that eucalyptus essential oil can significantly inhibit the infection of PEDV through cell activity and IFA tests. In addition, through acute toxicity experiments and subchronic toxicity assessments, it was found that different doses of eucalyptus essential oil were orally administered to mice. Within 14 days, no mouse death was observed in each dose group, and the red blood cells (RBC) and white blood cells (WBC) in the mice were not affected. However, the platelet (PLT) level in the blood of the high-dose (2500 mg / kg) treatment group was reduced, indicating that high-dose eucalyptus essential oil administration may reduce blood viscosity. Therefore, the oral dose was selected as 500 mg / kg. After body surface area conversion, the oral dose of piglets was set at 10 mg / kg for the low-dose group, 50 mg / kg for the medium-dose group, and 120 mg / kg for the high-dose group to explore whether eucalyptus essential oil can protect piglets from PEDV attack. In this experiment, healthy piglets with negative PEDV test were selected as experimental animals. Piglets in the PEDV treatment group and the eucalyptus essential oil group were orally administered with 10×TCID 50The piglets in the PEDV-treated group gradually developed mild diarrhea, severe diarrhea, and dehydration over time; the feces gradually changed from solid to watery feces, accompanied by depression. The diarrhea of ​​the suckling piglets in the eucalyptus essential oil group improved to varying degrees. The suckling piglets in the mock group showed a gradual increase in weight. At 8 dpi, the survival rates of PEDV-infected piglets in the PEDV-treated group and the eucalyptus essential oil low, medium, and high groups were 0% (0 / 6), 33.3% (2 / 6), 50.0% (3 / 6), and 50.0% (3 / 6), respectively. Through immunohistochemical reaction, the essential oil group could significantly reduce the expression of IFN-α and IL-6, which was significant (p<0.001). RNA was extracted from the intestinal tissue of each group of suckling piglets, and the levels of inflammatory cytokines IL-1β, IL-8 and IL-6 in the intestinal tissue were measured by ELISA. It was found that eucalyptus can significantly reduce the increase of inflammatory factors caused by PEDV infection. The viral load in the feces, jejunum and ileum of the infected piglets was detected by RT-Q-PCR technology. The eucalyptus essential oil group can significantly reduce the viral load in the feces, jejunum and ileum of the PEDV infection group, and as time goes on, eucalyptus essential oil can significantly alleviate PEDV infection. Through clinical symptom observation, pathological observation, etc., it was found that the eucalyptus essential oil drug used in the present invention has a certain therapeutic effect on pathogenic piglets caused by PEDV.

[0194] In summary, eucalyptus essential oil showed strong anti-PEDV activity both in vitro and in vivo. This is the first study on its anti-PEDV activity, which provides an effective strategy for the development of cheap and efficient anti-PEDV drugs.

Claims

1. Use of eucalyptol in the preparation of drugs against porcine epidemic diarrhea virus.

2. Use of plant essential oil containing eucalyptol in the preparation of drugs against porcine epidemic diarrhea virus.

3. The use according to claim 1 or 2, characterized in that: The medicine is a medicine for preventing and treating severe enteropathogenic diarrhea caused by porcine epidemic diarrhea virus.

4. The use according to claim 1 or 2, characterized in that: The drug inhibits viral attachment, internalization or replication.

5. The use according to claim 2, characterized in that: The plant essential oils are eucalyptus essential oil, artemisia annua essential oil, wormwood essential oil, eucalyptus essential oil, magnolia essential oil, melaleuca alternifolia essential oil, melaleuca alternifolia essential oil, myrtle essential oil, sage essential oil, tea tree essential oil, rosemary essential oil, white cardamom essential oil, and mountain osmanthus essential oil.

6. The use according to claim 5, characterized in that: The amount of eucalyptus oil contained in the eucalyptus essential oil is not less than 60% w / w.

7. The use according to any one of claims 1 to 6, characterized in that: The pigs are piglets.

8. The use according to claim 7, characterized in that: The dosage of the eucalyptol is 6.25-100 mg / kg; the dosage of the eucalyptus essential oil is 10.31-167.92 mg / kg.

9. The use according to any one of claims 1 to 8, characterized in that: The medicine is prepared from eucalyptol as an active ingredient and pharmaceutically acceptable excipients or auxiliary ingredients into a commonly used pharmaceutical preparation.

10. The use according to claim 9, characterized in that: The preparation is powder, granule or decoction.

Images