Traditional Chinese medicine compound composition for preventing and controlling myopia and application of traditional Chinese medicine compound composition

Abstract

The invention discloses a traditional Chinese medicine compound composition for preventing and controlling myopia and application thereof, and belongs to the technical field of medicines. The compound composition is prepared from the following raw material medicines in parts by weight: 1 to 180 parts of fructus lycii, 1.5 to 180 parts of rhizoma dioscoreae, 0.5 to 72 parts of radix astragali seu hedysari and 1 to 120 parts of peony seed oil. The Chinese wolfberry, the Chinese yam, the astragalus membranaceus and the peony seed oil are combined according to a specific proportion to form the compound composition capable of remarkably preventing and treating myopia, and the compound composition is verified by a guinea pig deprivation myopia model experiment to be capable of remarkably inhibiting expression of MMP-2 and HIF-1alpha in sclera and remarkably preventing and treating myopia. The expression of TIMP-2, COL1 alpha 1 and TGF-beta 1 is promoted, so that the reduction of sclera thickness is inhibited; the expression of ET-1 and HIF-1alpha in the choroid can be obviously inhibited, so that the blood flow volume in the choroid is increased; according to the traditional Chinese medicine compound composition, the development process of myopia can be obviously delayed by inhibiting the thickness of sclera from being thinned and increasing the blood flow volume in choroid, and the myopia can be effectively prevented and treated.

Description

Technical Field

[0001] The present invention relates to the field of pharmaceutical technology, and in particular to a Chinese medicine compound composition for myopia prevention and control and application thereof. Background Art

[0002] With the rapid development of social information networks and the increase in learning tasks, the time and intensity of young people's eye use have increased significantly, and the pressure on their eyes has also increased, which has led to a significant increase in the incidence of myopia among young people. The occurrence and evolution of myopia is the result of the combined effects of multiple factors such as genetic factors, environmental conditions and lifestyle. Its mechanism ranges from the adjustment theory, retinal defocus, inflammatory response, dopamine mechanism, choroidal blood flow and thickness to scleral hypoxia remodeling, etc., and scholars at home and abroad have conducted extensive research. Myopia is manifested as good near vision and blurred vision at a distance, which not only requires squinting to see objects, but also easily leads to eye fatigue. Mild and moderate myopia needs to be corrected by glasses, which brings inconvenience to life and work; and high myopia greater than 600 degrees may also be accompanied by pathological changes in the fundus, such as retinal detachment, macular degeneration, scleral staphyloma, etc., with the risk of severe visual impairment or blindness, which seriously affects the physical health and quality of life of young people. At present, the main methods for preventing and treating myopia are wearing glasses and laser surgery. However, wearing glasses is only a temporary solution, and laser surgery still has potential unknown side effects on the eyes.

[0003] Modern medical research has confirmed that the thinning of the sclera and the reduction of choroidal (ChBF) blood flow are the main factors leading to myopia. The thinning of the sclera at the posterior pole of the eye will promote the expression of MMP-2 (remodeling protein) in the sclera, and inhibit the expression of TIMP-2 (inhibitor of membrane remodeling protein) in the sclera, thereby aggravating the degree of myopia; the reduction of choroidal blood flow will cause scleral ischemia and hypoxia, induce scleral extracellular matrix (ECM) remodeling, cause axial extension of the eye axis, and lead to myopia. The choroid is located between the retina and the sclera. It is a highly vascularized tissue. About 73% of the blood in the eyeball is concentrated in the choroidal blood vessels, which is an important source of oxygen and nutrition for the retina and sclera. In addition, the choroid also has multiple functions such as absorbing light, regulating body temperature and intraocular pressure, and secreting various growth factors to regulate scleral remodeling.

[0004] In the prior art (such as: CN103977211A, a drug for treating and preventing myopia; CN109045049A, use of salidroside and its derivatives in the preparation of inhibitor drugs for ophthalmic fibrosis extracellular matrix protein abnormality diseases; CN112136887A, a dairy product that helps prevent juvenile myopia and a preparation method thereof; CN116211984A, a Chinese medicine composition eye ointment for preventing and treating myopia in children and adolescents and a preparation method thereof), although drugs or related products with preventive and therapeutic effects on myopia are disclosed, the preventive and therapeutic effects on myopia are general, and the effects on the sclera and choroid are also unknown. Therefore, it is urgent to develop a drug with better preventive and therapeutic effects on myopia to achieve effective prevention and treatment of myopia. Summary of the invention

[0005] The purpose of the present invention is to overcome the defect that the existing products have poor preventive and therapeutic effects on myopia, and provide a Chinese medicine compound composition for myopia prevention and control and its application.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] A traditional Chinese medicine compound composition for myopia prevention and control comprises the following raw materials in parts by weight: 1-180 parts of wolfberry, 1.5-180 parts of yam, 0.5-72 parts of astragalus and 1-120 parts of peony seed oil.

[0008] Among them, preferably, the Chinese medicine compound composition comprises the following raw materials in parts by weight: 6-36 parts of wolfberry, 15-90 parts of yam, 15-90 parts of astragalus and 5-30 parts of peony seed oil.

[0009] Further preferably, the weight ratio of the astragalus to the peony seed oil is 1-5:1; more preferably, the weight ratio of the astragalus to the peony seed oil is 2-3:1.

[0010] Most preferably, the weight ratio of wolfberry, yam, astragalus and peony seed oil is 4:6:6:3.

[0011] Among them, wolfberry is sweet in taste, neutral in nature, and enters the liver and kidney meridians. It not only contains rich nutrients such as vitamins, amino acids, trace elements and inorganic salts, but also contains polysaccharides, flavonoids, anthocyanins, anthocyanins, alkaloids, carotenoids and other chemical components. It has important effects such as protecting visual function, anti-oxidation, anti-inflammation, anti-fatigue, lowering blood sugar and regulating lipids, protecting the liver, kidneys, lungs and nerves, and enhancing immunity.

[0012] Among them, yam belongs to the Dioscorea genus of the Dioscoreaceae family, and its tubers are rich in nutrients, such as mucopolysaccharides, dioscin, minerals, etc. Yam has the effects of nourishing the spleen and stomach, promoting fluid production and benefiting the lungs, nourishing the kidneys and astringing semen, and is widely used in traditional Chinese medicine prescriptions.

[0013] Among them, Astragalus is one of the most commonly used Qi-replenishing drugs in clinical practice, and Astragaloside and Astragaloside IV are its main active ingredients. Astragaloside IV can directly scavenge free radicals in vitro, and can also exert an antioxidant effect in cells by upregulating the expression and activity of SOD, improving the activity of antioxidant enzymes, and inhibiting oxidative stress damage.

[0014] Among them, peony seed oil, as a new resource food, is an oil product extracted from peony seeds through a certain process. It can be used as daily oil and has considerable medicinal value. Peony seed oil is rich in ω-3 unsaturated fatty acids and α-linolenic acid, has high nutritional value and is safe and non-toxic. It can play an antioxidant, lipid-lowering, UV-resistant, anti-inflammatory, cardiovascular and nerve-protecting role, and is known as "plant brain gold".

[0015] Among them, preferably, the Chinese medicine compound composition can be prepared by extracting the active components of the raw materials according to the conventional extraction method in Chinese medicine, and then adding pharmaceutically acceptable carriers and / or excipients, such as starch, dextrin, microcrystalline cellulose, compressible starch, magnesium stearate, micropowder silica gel, sucrose, sodium carboxymethyl starch, hydroxypropyl methylcellulose, vegetable oil, lecithin, polyethylene glycol, propylene glycol, ethyl paraben, etc., to prepare pharmaceutically suitable dosage forms, such as capsules, emulsions, oral liquids, pills, water-flooded pills, etc.

[0016] Furthermore, the Chinese medicine compound composition for myopia prevention and control of the present invention can be prepared by the following method:

[0017] Take wolfberry, yam and astragalus in proportion, extract with water or an organic solvent miscible with water, and then add peony seed oil in proportion after obtaining the extract; preferably, the organic solvent miscible with water is selected from one or more of methanol, ethanol and acetone; more preferably 60-80% ethanol; further preferably 70% ethanol.

[0018] Preferably, the Chinese medicine compound composition for myopia prevention and control of the present invention can also be prepared by the following method:

[0019] Take wolfberry, yam and astragalus according to proportion, adopt water extraction and alcohol precipitation method to prepare extract, and then add peony seed oil according to proportion; preferably, the alcohol precipitation concentration is 60-80%.

[0020] Preferably, the Chinese medicine compound composition of the present invention can be prepared by the method of extracting the raw materials separately, in addition to the method of extracting the raw materials together as described above. The specific method is as follows:

[0021] (1) extracting wolfberry, Chinese yam and astragalus with 8 times the amount of 70% ethanol solution respectively at a percolation rate of 5 (ml / min) to obtain the corresponding raw material percolate;

[0022] (2) Recovering ethanol from the percolated liquid of the corresponding raw material drug under reduced pressure and evaporating until there is no alcohol taste, diluting with water (equivalent to containing 0.2 g / ml of the original drug), filtering, and obtaining the corresponding raw material drug filtrate;

[0023] (3) The filtrate of the corresponding API is loaded, washed, and gradient eluted (loaded on a D101 macroporous resin column at a loading rate of 7 ml / min, and allowed to adsorb for 2 hours after loading; impurities are eluted with water until the effluent is nearly colorless, at an elution rate of 6 ml / min, and eluted for 3 times the column volume; saponin is eluted with 70% ethanol until the eluate is nearly colorless, and the eluate is collected) to obtain the corresponding API eluate;

[0024] (4) placing the corresponding API eluate in a rotary evaporator at a water bath temperature of 80° C. and a rotation speed of 40 r / min, recovering ethanol and concentrating it into a thick paste, and vacuum drying at 60° C. to obtain the corresponding API extract;

[0025] (5) Mixing the wolfberry extract, yam extract, astragalus extract and peony seed oil according to the mass ratio of the original drugs to obtain a traditional Chinese medicine compound composition.

[0026] Furthermore, the present invention also provides the use of the above-mentioned Chinese medicine compound composition in the preparation of medicines for preventing and treating myopia.

[0027] Among them, in the guinea pig form deprivation myopia model experiment, it was proved that the inhibition rate of the Chinese herbal compound composition of the present invention on the thinning of the sclera thickness of guinea pigs was greater than 50%, which shows that it has a significant inhibitory effect on the thinning of the sclera thickness, and thus the Chinese herbal compound composition can be used to prepare a drug for inhibiting the thinning of the sclera thickness.

[0028] Preferably, in a guinea pig form deprivation myopia model experiment, it is proved that the inhibition rate of the Chinese herbal compound composition of the present invention on the expression of MMP-2 (remodeling protein) in the guinea pig sclera is greater than 50.1%, which shows that it has a significant inhibitory effect on the expression of MMP-2 in the sclera, and thus the Chinese herbal compound composition can be used to prepare a drug for inhibiting the expression of MMP-2 in the sclera.

[0029] In particular, the promoting effect on TIMP-2 (inhibitory remodeling protein) expression in the guinea pig sclera is greater than 16.8%, which shows that it has a significant promoting effect on TIMP-2 expression in the sclera. Therefore, the Chinese medicine compound composition can be used to prepare a drug for promoting TIMP-2 (inhibitory remodeling protein) expression in the sclera.

[0030] In particular, the promoting effect on the expression of COL1α1 (type I collagen α1) in the guinea pig sclera is greater than 32.5%, which shows that it has a significant promoting effect on the expression of COL1α1 in the sclera, and thus the Chinese medicine compound composition can be used to prepare a drug for promoting the expression of COL1α1 in the sclera.

[0031] In particular, the inhibition rate of HIF-1α (hypoxia-inducible factor-1α) expression in the guinea pig sclera is greater than 63.8%, which shows that it has a significant inhibitory effect on HIF-1α expression in the sclera. Therefore, the Chinese medicine compound composition can be used to prepare a drug for inhibiting HIF-1α expression in the sclera.

[0032] In particular, the promoting effect on TGF-β1 (transforming growth factor) expression in the guinea pig sclera is greater than 48.4%, which shows that it has a significant promoting effect on TGF-β1 expression in the sclera, so the Chinese medicine compound composition can be used to prepare a drug for promoting TGF-β1 expression in the sclera.

[0033] Furthermore, in a guinea pig form deprivation myopia model experiment, it was demonstrated that the Chinese herbal compound composition of the present invention has a significant effect of increasing the blood flow in the choroid of guinea pigs, and thus the Chinese herbal compound composition can be used to prepare a drug for increasing the blood flow in the choroid.

[0034] In particular, the inhibition rate of ET-1 (endothelin-1) expression in guinea pig choroid is greater than 56%, which shows that it has a significant inhibitory effect on ET-1 expression in choroid, so the Chinese medicine compound composition can be used to prepare a drug for inhibiting ET-1 expression in choroid.

[0035] In particular, the inhibition rate of HIF-1α (hypoxia-inducible factor-1α) expression in guinea pig choroid is greater than 63%, which shows that it has a significant inhibitory effect on HIF-1α expression in the choroid. Therefore, the Chinese medicine compound composition can be used to prepare a drug for inhibiting HIF-1α expression in the choroid.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] The invention discloses a Chinese medicine compound composition for myopia prevention and control and application thereof. The compound composition is formed by combining wolfberry, Chinese yam, astragalus and peony seed oil in a specific proportion, and has a significant preventive and therapeutic effect on myopia. The compound composition is verified by a guinea pig form deprivation myopia model experiment, and can not only significantly inhibit the expression of MMP-2 and HIF-1α in the sclera (the inhibition rate is greater than 50.1%), but also promote the expression of TIMP-2, COL1α1 and TGF-β1 (the promotion effect is greater than 16.8%), thereby inhibiting the thinning of the sclera thickness; and can also significantly inhibit the expression of ET-1 and HIF-1α in the choroid (the inhibition rate is greater than 56%), thereby increasing the blood flow in the choroid. The Chinese medicine compound composition can significantly delay the development of myopia by inhibiting the thinning of the sclera thickness and increasing the blood flow in the choroid, thereby facilitating the effective prevention and treatment of myopia. DETAILED DESCRIPTION

[0038] The present invention is further described in detail below in conjunction with test examples and specific implementation methods. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following embodiments, and all technologies realized based on the content of the present invention belong to the scope of the present invention.

[0039] Example 1

[0040] A traditional Chinese medicine compound composition comprises 12 parts of wolfberry, 18 parts of yam, 18 parts of astragalus and 9 parts of peony seed oil.

[0041] Example 2

[0042] A traditional Chinese medicine compound composition comprises 12 parts of wolfberry, 18 parts of yam, 18 parts of astragalus and 12 parts of peony seed oil.

[0043] Example 3

[0044] A traditional Chinese medicine compound composition comprises 12 parts of wolfberry, 18 parts of yam, 18 parts of astragalus and 18 parts of peony seed oil.

[0045] Example 4

[0046] A traditional Chinese medicine compound composition comprises 12 parts of wolfberry, 18 parts of yam, 25 parts of astragalus and 5 parts of peony seed oil.

[0047] Example 5

[0048] A traditional Chinese medicine compound composition comprises 6 parts of wolfberry, 90 parts of yam, 90 parts of astragalus and 5 parts of peony seed oil.

[0049] Example 6

[0050] A traditional Chinese medicine compound composition comprises 36 parts of wolfberry, 15 parts of yam, 15 parts of astragalus and 30 parts of peony seed oil.

[0051] Example 7

[0052] A traditional Chinese medicine compound composition comprises 1 part of wolfberry, 180 parts of yam, 0.5 parts of astragalus and 120 parts of peony seed oil.

[0053] Example 8

[0054] A traditional Chinese medicine compound composition comprises 180 parts of wolfberries, 1.5 parts of yam, 72 parts of astragalus and 1 part of peony seed oil.

[0055] Comparative Example 1

[0056] A traditional Chinese medicine compound composition comprises 180 parts of wolfberry, 1.5 parts of yam, 75 parts of astragalus and 1 part of peony seed oil.

[0057] Comparative Example 2

[0058] A traditional Chinese medicine compound composition comprises 1 part of wolfberry, 200 parts of yam, 0.5 parts of astragalus and 120 parts of peony seed oil.

[0059] Comparative Example 3

[0060] A traditional Chinese medicine compound composition comprises 200 parts of wolfberries, 180 parts of yam, 0.5 parts of astragalus, and 120 parts of peony seed oil.

[0061] Comparative Example 4

[0062] A traditional Chinese medicine compound composition comprises 180 parts of wolfberry, 1.5 parts of yam, 0.5 parts of astragalus and 125 parts of peony seed oil.

[0063] Comparative Example 5

[0064] A traditional Chinese medicine compound composition comprises 12 parts of wolfberries, 18 parts of yam and 9 parts of peony seed oil.

[0065] Comparative Example 6

[0066] A traditional Chinese medicine compound composition contains only astragalus.

[0067] Comparative Example 7

[0068] A traditional Chinese medicine compound composition comprises 12 parts of wolfberry, 18 parts of astragalus and 9 parts of peony seed oil.

[0069] Comparative Example 8

[0070] A traditional Chinese medicine compound composition contains only Chinese yam.

[0071] Comparative Example 9

[0072] A traditional Chinese medicine compound composition comprises 12 parts of wolfberries, 18 parts of yam, 18 parts of codonopsis pilosula and 9 parts of peony seed oil.

[0073] Comparative Example 10

[0074] A traditional Chinese medicine compound composition comprises 12 parts of wolfberry, 18 parts of yam, 18 parts of astragalus and 9 parts of linseed oil.

[0075] Comparative Example 11

[0076] A dairy product prepared according to the formula of Example 1 in Patent Publication No. CN 112136887A.

[0077] Experimental example:

[0078] 1. Experimental subjects: 3-week-old healthy British tricolor short-haired guinea pigs (ordinary grade, license number: SCXK (Yu) 2021-0003); weight 180±30g, both males and females, caged separately, all guinea pigs were fed adaptively for 3 days and then had their eyes checked to rule out eye diseases such as cataracts, keratoconjunctivitis, myopia, etc. Feeding conditions: room temperature 20-24℃, relative air humidity 45%-50%, strict day and night cycle, guinea pigs were free to eat special guinea pig feed, drink water with added vitamin C, and provide fresh vegetables during the experiment.

[0079] 2. Construction of guinea pig form deprivation myopia model

[0080] According to the size of the guinea pig's head and body, cut a 10-inch translucent non-toxic latex balloon into a suitable headgear, cover the right eye (form deprivation eye), fully expose the left eye, mouth, nose and ears on both sides, inspect the eye mask daily to see if it has fallen off, clean the headgear in time, keep it clean, and do nothing in the blank group. Regularly check the eye for abnormal secretions and infection and other eye health conditions. If there are abnormal conditions such as severe eye infection, the guinea pig will be eliminated. Observe the diet and mental state of the guinea pigs every day.

[0081] 3. Treatment of Chinese herbal compound compositions

[0082] (1) extracting the solid API with 8 times the amount of 70% ethanol solution by percolation at a percolation rate of 5 (ml / min) to obtain a percolation solution of the API;

[0083] (2) Recover ethanol from the percolated liquid of the raw material drug under reduced pressure and evaporate until there is no alcohol smell, dilute with water (equivalent to 0.2 g / ml of the raw material drug), filter, and obtain the raw material drug filtrate;

[0084] (3) The API filtrate is loaded, washed, and gradient eluted (loaded on a D101 macroporous resin column at a loading rate of 7 ml / min, and allowed to adsorb for 2 hours after loading; impurities are eluted with water until the effluent is nearly colorless, at an elution rate of 6 ml / min, and eluted for 3 times the column volume; saponin is eluted with 70% ethanol until the eluate is nearly colorless, and the eluate is collected) to obtain the API eluate;

[0085] (4) placing the API eluate in a rotary evaporator at a water bath temperature of 80° C. and a rotation speed of 40 r / min, recovering ethanol and concentrating it into a thick paste, and vacuum drying at 60° C. to obtain a solid API extract;

[0086] (5) The solid raw material drug extract and the oily raw material drug are mixed according to the mass ratio of the original drug to obtain an experimental sample.

[0087] 4. Dosage

[0088] The raw drug was gavaged at a dose of 10 g / kg guinea pig body weight, twice a day.

[0089] 5. Experimental groups:

[0090] 210 3-week-old guinea pigs were randomly divided into a blank group, a model group, experimental groups 1-8 (Examples 1-8), and comparative groups 1-11 (Comparative Examples 1-11), with 10 guinea pigs in each group, and the right ears were marked with ear tags.

[0091] 6. Experimental methods

[0092] (1) Refractive power and eye axis test

[0093] The diopter and axial length of guinea pigs in each group were measured at 0, 2, 4, and 6 weeks of the experiment. For the measurement of diopter, the indoor light source was turned off 30 minutes in advance, and compound tropicamide eye drops were used for 4 times, with an interval of 5 minutes each time. When the pupil was fully dilated and fixed by an assistant, a band retinoscope was held at an arm's length (about 50 cm) for retinoscopy. The horizontal and vertical main meridians were tested, and the astigmatism was included in the test results with half the equivalent spherical lens. The measurement was repeated 3 times to calculate the average value. For the measurement of axial length, 0.5% proparacaine hydrochloride eye drops were first used for local anesthesia of both eyes, and then an ophthalmic A-type ultrasound instrument was used for measurement under natural light. The probe was gently aligned with the center of the cornea and perpendicular to the corneal surface. The measurement was performed 5 times in a row, and the values ​​with severe deviation were eliminated and the average value was calculated. After the measurement was completed, levofloxacin eye drops were used for eye drops to prevent infection.

[0094] (2) Eyeball sampling

[0095] ① Killing guinea pigs: After the experiment, all guinea pigs were euthanized by intraperitoneal injection of 3% pentobarbital (dose of 50 mg / kg), and the guinea pigs were confirmed dead after the corneal reflex disappeared.

[0096] ② Remove the eyeball: Immediately use ophthalmic surgical instruments to carefully remove the guinea pig's right eyeball, clean it in PBS buffer, and remove non-target tissues such as fascia and fat on the eyeball.

[0097] ③ Cut the optic nerve and fix it: cut the posterior optic nerve, leaving about 1mm in length, and quickly place the eyeball into an EP tube containing 4% paraformaldehyde fixative for fixation, and mark the EP tube at the same time.

[0098] ④ Sample processing: After sufficient fixation, cut the eyeball in a circular manner along the corneoscleral limbus to remove excess anatomical tissue. Then, separate the choroid and sclera tissues and place them in a 2 ml sterile cryotube.

[0099] ⑤ Cryopreservation: Place the cryotube containing the tissue sample in a liquid nitrogen tank at -180℃ for cryopreservation.

[0100] (3) Choroidal thickness experiment

[0101] The fixed eyeball tissue was dehydrated and embedded in an automatic dehydrator, and the following operations were performed after sectioning: the sections were dewaxed to water → hematoxylin staining for 10-20 minutes → tap water rinse for 1-3 minutes → hydrochloric acid alcohol differentiation for 5-10 seconds → hydrochloric acid alcohol differentiation for 5-10 seconds → tap water rinse for 1-3 minutes → put into 50°C warm water or weak alkaline aqueous solution to return to blue → tap water rinse for 1-3 minutes → put into 85% alcohol for 3-5 minutes → eosin staining for 3-5 minutes → water rinse for 3-5 seconds → gradient alcohol dehydration → xylene transparent → neutral gum sealing. The entire process follows the standard operating procedure (SOP) of pathological examination, and after a series of steps such as dehydration, trimming, embedding, sectioning, staining, and sealing, the sections were finally examined under a microscope; the sections were imaged using a Pannoramic 250 digital slide scanner. The entire tissue was observed at a low magnification, and then a specific area adjacent to the optic disc was selected for image acquisition at a magnification of 200 times. Caseviewer image analysis software was used to accurately measure the collected images. For each numbered slice, a total of 10 sets of data were measured and their average values ​​were calculated for subsequent analysis.

[0102] (4) Expression of ET-1 and HIF-1α in the choroid and expression of MMP-2, HIF-1α, TIMP-2, and COL1α1 in the sclera

[0103] aSample preparation and total protein extraction

[0104] The guinea pig choroid-sclera tissue was placed in a grinding tube, and lysed with lysis buffer at 4°C. After centrifugation, the supernatant was taken and the protein concentration was determined using a BCA protein quantification kit.

[0105] b. Sample determination

[0106] Dilute the protein sample with the lysis buffer and mix it with the lysis buffer and BCA working solution. Measure the light absorbance of the sample at a wavelength of 562nm and determine the protein content of the sample based on the standard curve.

[0107] Denaturation and electrophoresis of c-protein

[0108] After the protein was denatured, it was loaded and electrophoresed at 180 V until the bromophenol blue dye reached the bottom of the separation gel.

[0109] d. Transfer and blocking

[0110] Cut the PVDF membrane and 6 filter papers to match the size of the separation gel, soak them in the transfer solution for 10 minutes, and fully wet them. Stack them in the order of sponge → 3 layers of filter paper → membrane → gel → 3 layers of filter paper → sponge, and use a glass rod to remove bubbles between the layers. During the transfer process, connect the gel and PVDF membrane to the negative electrode and the positive electrode respectively, and transfer the membrane at 200mA for 1 to 2 hours after power is turned on. After completion, seal the PVDF membrane.

[0111] eIncubation with antibody

[0112] Primary antibody incubation: PVDF membrane was incubated in primary antibody solution (HIF-1α concentration 1:1000, tubulinβ1 concentration 1:5000), placed at 4°C, and gently shaken on a shaker overnight; then the PVDF membrane was washed 3 times with TBST solution, each time for 5 minutes. Secondary antibody incubation: The membrane was transferred to the secondary antibody solution (dilution ratio 1:5000), incubated on a shaker at room temperature for 2-3 hours, and then rinsed as described above.

[0113] fDevelopment and fixing

[0114] The optical density value was measured using Tianneng GIS chassis control software V2.0 to calculate the relative expression level of the target protein.

[0115] (5) Real-time fluorescence quantitative PCR experiment

[0116] Total RNA extraction from sample A

[0117] ① Before the first use, add 24 mL of anhydrous ethanol to the binding solution (2.4 mL / 24 mL for 5T / 50T, respectively) and 52 mL of anhydrous ethanol to the rinsing solution (5.2 mL / 52 mL for 5T / 50T, respectively), and mix thoroughly.

[0118] ② Take 10-20 mg of fresh sample into an EP tube and add 350 ul of lysis buffer LB, and crush it with a high-speed low-temperature tissue grinder.

[0119] ③ Transfer the evenly ground homogenate to a DNA removal / RNA adsorption universal column (the column is placed in a 2 mL collection tube), centrifuge at 13,000 rpm for 1 min, and collect the filtrate containing RNA.

[0120] ④ Add a binding solution of equal volume to the above filtrate, and mix gently by pipetting immediately.

[0121] ⑤ Add all the above mixed solutions to a new DNA removal / RNA adsorption universal column, centrifuge at 13,000 rpm for 30 seconds, and discard the filtrate.

[0122] ⑥ Add 700 μL of deproteinization solution, incubate at room temperature for 30 seconds, centrifuge at 13,000 rpm for 30 seconds, discard the filtrate, and put the DNA removal / RNA adsorption universal column back into the 2 mL collection tube.

[0123] ⑦ Add 500ul of rinse solution, centrifuge at 13,000rpm for 30s, and discard the filtrate.

[0124] ⑧Repeat step 7.

[0125] ⑨ Centrifuge the empty column at 13,000 rpm for 2 minutes to remove the remaining rinse solution.

[0126] ⑩Put the DNA removal / RNA adsorption universal column into a new 1.5mL centrifuge tube, add 30-50ul RNase-free H2O in the center of the membrane, and leave it at room temperature for 1min. Then centrifuge at 13,000rpm for 1min, collect the filtrate, which is the RNA solution, to be tested or stored at -80℃.

[0127] B. Removal reaction of genomic DNA:

[0128] Table 1 Genomic DNA removal reaction system

[0129] Reagents Volume (μL) 5×gDNAEraserBuffer 2 gDNAEraser 1 Total RNA 2 RNaseFreedH2O 5 Total 10

[0130] Note: After adding each reagent in turn, place in thermal cycler, 42°C, 2min

[0131] C reverse transcription reaction

[0132] Table 2 Reverse transcription reaction system

[0133] Reagents Volume (μL) 5×PrimeScriptBuffer2 4 PrimeScriptRTEnzymeMixI 1 RTPrimerMix 1 RNA 10 RNaseFreedH2O 4 Total 20

[0134] Note: Add each reagent in turn and place in a thermal cycler, 37℃, 15min; 85℃, 5sec

[0135] Real-time fluorescence quantitative polymerase chain reaction (qPCR)

[0136] a Primer design

[0137] The complete gene sequence was retrieved from the National Center for Biotechnology Information (NCBI) database, and specific primers were designed for each gene using PrimerPremier software. The design and synthesis of primers were undertaken by Shanghai Shenggong Bioengineering Technology Service Co., Ltd., and the primers were purified using the ULTRAPAGE method (see Table 3).

[0138] Table 3 Primers and base sequences used in this test

[0139] Primer name Upstream Downstream β-actin gaagcccagagcaaaagaggtatcc gatcttctccatgtcgtcccagttg ET-1 tgctcctgctcctccctgatg tgttgacccagatgatgtccaagtg HIF-1α acaactacagcattccagcagactc ggtgtggtggtgttggcagtg COL1α1 ccttcaggtcctcgtggtctcc aggttctccatcatcgccattcttg MMP-2 acggcttcctgtggtgctctac aaggctgtctgtcggcattgc TGF-β1 ctgctaccgttactgtggctactg cttccgcttcaccagctccatatc TMP-2 tcgctggatgtcggtgggaag cagggcacaatgaagtcacagagg

[0140] b Real-time fluorescence quantitative PCR reaction (Table 4, Table 5):

[0141] Table 4 PCR reaction system

[0142]

[0143]

[0144] Table 5 PCR reaction system

[0145] Reaction temperature time Remark 95℃ 30s Pre-denaturation 95℃ 5s transsexual 55℃ 30s annealing 72℃ 30s Fully extend to collect fluorescence

[0146] Note: 45 cycles

[0147] c QuantStudioTM Design&Analysis SE Software was used to analyze the CT (Threshold cycle) value of each test sample during the PCR process.

[0148] 7. Experimental results

[0149] (1) Diopter D) Experimental results (Table 6):

[0150] Table 6 Refractive index experimental data

[0151]

[0152]

[0153] Note: Compared with the blank group, * indicates P < 0.05, ** indicates P < 0.001;

[0154] Compared with the model group, & indicates P < 0.05, && indicates P < 0.001.

[0155] By analyzing the refractive test results in Table 6, it can be seen that the Chinese herbal compound compositions in Examples 1-8 of the present invention can significantly improve the refractive power of guinea pigs, while in Comparative Examples 1-10, changing the composition and ratio of the Chinese herbal compound compositions will lead to a significant decrease in the improvement effect on the refractive power of guinea pigs; in particular, from the analysis of the data of Comparative Example 6 and Example 1, it can be seen that Astragalus itself has no improvement effect on the refractive power of guinea pigs, but has a synergistic effect when combined with wolfberry, yam and peony seed oil, and can significantly improve the improvement effect of wolfberry, yam and peony seed oil on the refractive power of guinea pigs.

[0156] (2) Changes in the right eye axis ( mm) Experimental results (Table 7):

[0157] Table 7 Experimental data of right eye axis change

[0158]

[0159]

[0160] Note: Compared with the blank group, * indicates P < 0.05, ** indicates P < 0.001;

[0161] Compared with the model group, & indicates P < 0.05, && indicates P < 0.001.

[0162] By analyzing the experimental results of axial length change in Table 7, it can be known that the Chinese herbal compound compositions in Examples 1-8 of the present invention can significantly reduce the axial length change of guinea pigs, while in Comparative Examples 1-10, changing the composition and ratio of the Chinese herbal compound compositions will lead to a significant reduction in the effect of reducing the axial length change of guinea pigs.

[0163] (3) Choroidal thickness ( μm) experimental results (Table 8):

[0164] Table 8 Experimental data of choroidal thickness after 6 weeks of intervention

[0165]

[0166]

[0167] Note: Compared with the blank group, * indicates P < 0.05, ** indicates P < 0.001;

[0168] Compared with the model group, & indicates P < 0.05, && indicates P < 0.001.

[0169] By analyzing the experimental results of choroidal thickness in Table 8, it can be seen that the Chinese herbal compound compositions in Examples 1-8 of the present invention can significantly inhibit the thinning of the choroidal thickness of guinea pigs, while in Comparative Examples 1-10, changing the composition and ratio of the Chinese herbal compound compositions will lead to a significant reduction in the inhibitory effect on the thinning of the choroidal thickness of guinea pigs; in particular, from the analysis of the data of Comparative Example 6 and Example 1, it can be seen that Astragalus itself has no inhibitory effect on the thinning of the choroidal thickness of guinea pigs, but has a synergistic effect when combined with wolfberry, yam and peony seed oil, and can significantly improve the inhibitory effect of wolfberry, yam and peony seed oil on the thinning of the choroidal thickness of guinea pigs.

[0170] (4) Expression of ET-1 and HIF-1α in the choroid Experimental results (Table 9)

[0171] Table 9 Experimental data of ET-1 and HIF-1α expression in choroid

[0172]

[0173]

[0174] Note: Compared with the blank group, * indicates P < 0.05, ** indicates P < 0.001;

[0175] Compared with the model group, & indicates P < 0.05, && indicates P < 0.001.

[0176] By analyzing the experimental results of the expression of ET-1 and HIF-1α in the choroid in Table 9, it can be seen that the Chinese herbal compound compositions in Examples 1-8 of the present invention can significantly inhibit the expression of ET-1 and HIF-1α in the guinea pig choroid, while in Comparative Examples 1-10, changing the composition and ratio of the Chinese herbal compound compositions will lead to a significant decrease in the inhibitory effect on the expression of ET-1 and HIF-1α in the guinea pig choroid.

[0177] (5) Expression of MMP-2, HIF-1α, TIMP-2, COL1α1, and TGF-β1 in the sclera Experimental results (Table 10):

[0178] Table 10 Experimental data of expression of MMP-2, HIF-1α, TIMP-2, COL1α1, and TGF-β1 in sclera

[0179]

[0180]

[0181] Note: Compared with the blank group, * indicates P < 0.05, ** indicates P < 0.001;

[0182] Compared with the model group, & indicates P < 0.05, && indicates P < 0.001.

[0183] By analyzing the experimental results of the expression of MMP-2, HIF-1α, TIMP-2, COL1α1, and TGF-β1 in the sclera in Table 10, it can be seen that the Chinese medicine compound composition in Examples 1-8 of the present invention can significantly inhibit the expression of MMP-2 and HIF-1α in the choroid and sclera of guinea pigs, and promote the expression of TIMP-2, COL1α1, and TGF-β1 in the sclera. In Comparative Examples 1-10, changing the composition and ratio of the Chinese medicine compound composition will lead to a significant decrease in the effect of the Chinese medicine compound composition. (6) Real-time fluorescence quantitative PCR experimental results (Table 11, Table 12):

[0184] Table 11 Expression of ET-1 mRNA and HIF-1α mRNA in choroid Experimental data

[0185]

[0186]

[0187] Note: Compared with the blank group, * indicates P < 0.05, ** indicates P < 0.001;

[0188] Compared with the model group, & indicates P < 0.05, && indicates P < 0.001.

[0189] By analyzing the experimental results of the expression of ET-1mRNA and HIF-1αmRNA in the choroid in Table 11, it can be seen that the Chinese herbal compound composition in Examples 1-8 of the present invention can significantly inhibit the expression of ET-1mRNA and HIF-1αmRNA in the guinea pig choroid, while in Comparative Examples 1-10, changing the composition and ratio of the Chinese herbal compound composition will lead to a significant decrease in its inhibitory effect on the expression of ET-1mRNA and HIF-1αmRNA in the guinea pig choroid.

[0190] Table 12 Expression levels of HIF-1αmRNA, MMP-2mRNA, TIMP-2mRNA, TGF-β1mRNA, and COL1α1mRNA in sclera Experimental data

[0191]

[0192]

[0193] Note: Compared with the blank group, * indicates P < 0.05, ** indicates P < 0.001;

[0194] Compared with the model group, & indicates P < 0.05, && indicates P < 0.001.

[0195] By analyzing the experimental results of the expression levels of MMP-2 mRNA, HIF-1α mRNA, TIMP-2 mRNA, COL1α1 mRNA and TGF-β1 mRNA in the sclera in Table 12, it can be seen that the Chinese medicine compound composition in Examples 1-8 of the present invention can significantly affect the expression of MMP-2 mRNA, HIF-1α mRNA, TIMP-2 mRNA, COL1α1 mRNA and TGF-β1 mRNA in the choroid and sclera of guinea pigs, while in Comparative Examples 1-10, changing the composition and ratio of the Chinese medicine compound composition will lead to a significant reduction in the effect of the Chinese medicine compound composition.

Claims

1. A Chinese medicine compound composition for myopia prevention and control, characterized in that: The invention comprises the following raw materials in parts by weight: 1-180 parts of wolfberry, 1.5-180 parts of yam, 0.5-72 parts of astragalus and 1-120 parts of peony seed oil.

2. The Chinese herbal compound composition for myopia prevention and control according to claim 1, characterized in that: The traditional Chinese medicine compound composition comprises the following raw materials in parts by weight: 6-36 parts of wolfberry, 15-90 parts of yam, 15-90 parts of astragalus and 5-30 parts of peony seed oil.

3. The Chinese herbal compound composition for myopia prevention and control according to claim 2, characterized in that: The weight ratio of the astragalus root to the peony seed oil is 1-5:

1.

4. The Chinese herbal compound composition for myopia prevention and control according to claim 3, characterized in that: The weight ratio of the astragalus root to the peony seed oil is 2-3:

1.

5. An application of the Chinese medicine compound composition for myopia prevention and control according to any one of claims 1 to 4, characterized in that: Application in the preparation of medicines for preventing and treating myopia.

6. An application of the Chinese medicine compound composition for myopia prevention and control according to any one of claims 1 to 4, characterized in that: Application in the preparation of drugs for inhibiting the thinning of sclera thickness.

7. The use of the Chinese herbal compound composition for myopia prevention and control according to claim 6, characterized in that: Application in the preparation of drugs for inhibiting the expression of MMP-2 and / or TIMP-2 in the sclera.

8. The use of the Chinese herbal compound composition for myopia prevention and control according to claim 6, characterized in that: Application in the preparation of drugs for promoting the expression of COL1α1, TGF-β1 and / or HIF-1α in the sclera.

9. An application of the Chinese medicine compound composition for myopia prevention and control according to any one of claims 1 to 4, characterized in that: Use in the preparation of a drug for increasing choroidal blood flow.

10. The use of the Chinese herbal compound composition for myopia prevention and control according to claim 9, characterized in that: Application in the preparation of drugs for inhibiting the expression of ET-1 and / or HIF-1 in choroid.

Images