Application of DEK618 protein and related biological materials thereof in regulation and control of plant grain development

Abstract

The invention relates to the technical field of plant molecular biology and genetic engineering, in particular to application of DEK618 protein and related biological materials thereof in regulation and control of plant grain development. It is found that the Dek618 protein and the coding gene thereof play an important role in regulation and control of plant kernel development, related biological materials of the Dek618 protein can be used for regulation and control of plant kernel yield, kernel embryo development and starch and protein content in kernels, and the Dek618 protein and the coding gene thereof have great application and popularization value in the aspects of genetic resource germplasm improvement and the like of higher plants such as corn. Meanwhile, a scientific basis is provided for analyzing a development mechanism of grain formation.

Description

Technical Field

[0001] This invention relates to the fields of plant molecular biology and genetic engineering, and in particular to the application of DEK618 protein and related biomaterials in regulating plant grain development. Background Art

[0002] Corn is one of my country's three major grain crops and an important feed and industrial raw material. The kernel is a crucial factor influencing yield, primarily composed of the embryo, endosperm, and seed coat; kernel size is also affected by all three. In a mature kernel, the endosperm accounts for approximately 83% of the kernel's weight and is rich in nutrients such as starch and protein, serving as the primary storage site for these nutrients. The development of the corn kernel significantly impacts both yield and quality.

[0003] Grain development is regulated by a complex genetic network. Using mutants as research subjects allows for the discovery of a large number of genes affecting grain development. Grain mutants are important materials for studying maize seed development. Different types of maize grain mutants, such as small kernels (smk), embryo defective (embryo defective (emb), and endosperm defective (dek), are widely used in the cloning and functional analysis of genes regulating grain development. The dek mutant is a relatively common mutant with defects in both embryo and endosperm development. The phenotype is obvious, and most mutants show their phenotype 11 days after pollination. At this stage, mutant kernels are smaller than normal kernels, the seed coat is whitish, the starch in the endosperm is unsaturated, and the development of the embryo and endosperm often remains stuck in the early mutant stage. There are also many types of mutant genes. For example, the Dek1 gene encodes a calpain that affects the differentiation of aleurone layer cells. The mutant kernels lack an aleurone layer in the endosperm, and the endosperm is soft and powdery (Lid et al., 2002). Dek45 encodes an E+ type PPR protein located in mitochondria. It participates in post-transcriptional C→U editing of mitochondrial genes, affecting normal mitochondrial function and leading to developmental defects in mutant embryos and endosperm (Ren et al., 2019). Dek44 encodes a 50S ribosomal protein L9 located in mitochondria. This gene participates in the expression of respiratory chain-related genes in mitochondria and the genome, thus affecting grain development (Qi et al., 2019).

[0004] Posttranscribed RNA C→U editing is widespread in plant organelles chloroplasts and mitochondria. These transcripts must be edited before they can be translated into normal proteins to perform their functions. RNA editing requires the participation of RNA editing complexes composed of various editing factors, but the specific molecular regulatory mechanisms remain unclear. Studies on SMK and DEK mutants have revealed that the PPR (pentatricopetide repeat) protein family, as trans-acting factors, is widely involved in RNA editing in chloroplasts and mitochondria, playing a crucial role in the differentiation of basal transfer layer cells in flowering plant seeds and the early development of the embryo and endosperm. Cloning PPR genes and analyzing their functional mechanisms is of great significance for the study of editing complexes. Mutations in these PPR proteins impair mitochondrial function, hinder energy metabolism, and severely affect embryo and endosperm development. These findings indicate that embryo and endosperm development is a highly complex biological process with a significant impact on maize kernel morphogenesis.

[0005] Therefore, further exploration of key genes affecting grain development is of great significance for fully revealing the molecular regulatory mechanism of maize grain development. Summary of the Invention

[0006] In a first aspect, the present invention provides the application of DEK618 protein or a fusion protein of DEK618 protein, or its encoding gene, or biological material containing its encoding gene in regulating plant seed development; wherein the amino acid sequence of the DEK618 protein is at least one of the following: (a) The sequence shown in SEQ ID No. 1; (b) A sequence of SEQ ID NO.1 that has been modified by substitution, deletion, and / or addition of one or more amino acid residues and has the function of regulating plant seed development.

[0007] DEK618 protein is a PPR-type protein widely found in plant mitochondria, chloroplasts, and nuclei. It is specifically expressed in mitochondria and specifically recognizes the editing of mitochondrial genes from pyrimidine (C) to uracil (U). This invention reveals that DEK618 protein can directly participate in seed mitochondrial protein assembly and has a positive regulatory effect on seed endosperm development and the mitochondrial electron transport chain. When the expression of this gene is inhibited, the base editing at four sites in the mitochondrial electron transport chain subunits ccmC at position 184, ccmB at position 428, ccmFC at position 1219, and cob at position 298 is completely deleted, leading to amino acid alterations. The assembly and activity of mitochondrial complex III and supercomplex I+III2 are affected, resulting in seed development defects, smaller seeds, and thus affecting plant seed development.

[0008] In some embodiments, the fusion protein is an amino acid sequence obtained by attaching a tag, restriction enzyme site, and / or linker peptide sequence to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID No. 1.

[0009] In this field, replacing proteins with amino acids that have similar or comparable properties usually does not change their function; adding one or more amino acids to the C-terminus and / or N-terminus usually does not change their function either.

[0010] More specifically, the present invention provides the use of the DEK618 protein or a fusion protein of the DEK618 protein, or its encoding gene, or biological materials containing its encoding gene in at least one of the following aspects: (1) Regulating the weight or size of plant seeds; (2) Regulating plant endosperm development; (3) Regulating plant height; (4) Regulating plant yield; (5) Regulate the starch or protein content of plant seeds; (6) Regulating mitochondrial RNA editing.

[0011] Furthermore, the present invention provides the application of the DEK618 protein or a fusion protein of the DEK618 protein, or its encoding gene, or biological materials containing its encoding gene in plant variety improvement.

[0012] In some implementations, the improvements include improvements in plant seed weight or size, plant endosperm development, plant height, yield, and quality.

[0013] Preferably, the gene encoding the DEK618 protein is at least one of the following: (1) The sequence shown in SEQ ID No. 2; (2) DNA molecules that can affect seed development formed by substitution of one or more bases and / or insertion of one or more bases and / or deletion of one or more bases or insertion / deletion / translocation / inversion of large nucleotide sequences based on SEQ ID NO.2; (3) A DNA molecule that can hybridize with the sequence shown in SEQ ID NO.2 and encodes a protein related to plant seed development in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% (w / v) SDS at 65°C and after washing the membrane; (4) A DNA molecule that has more than 85% (e.g., 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) homology with the sequence shown in SEQ ID NO.2 and encodes a protein related to plant seed development.

[0014] The sequence shown in SEQ ID No. 2 consists of 2409 nucleotides, with the 101st nucleotide from the 5' end being an exon and having no introns.

[0015] Preferably, the development of plant seeds, the weight of plant seeds, the length or width of seeds, the yield, the starch or protein content of plant seeds, or the RNA editing of mitochondria are regulated by adjusting the expression level or activity of DEK618 protein or gene.

[0016] Preferably, the expression level or activity of DEK618 protein or gene is regulated by hybridization technology, transgenic technology, or gene editing technology.

[0017] Preferably, the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria, or non-renewable plant cells or tissues.

[0018] Preferably, the plant is a monocotyledonous or dicotyledonous plant; more preferably, the plant is a grass; more preferably, the plant is a maize; and most preferably, the plant is corn.

[0019] Furthermore, the present invention provides a method for preparing a transgenic plant, comprising: introducing the DEK618 protein or a fusion protein of the DEK618 protein, or its encoding gene, or biological material containing its encoding gene into the plant.

[0020] Furthermore, the present invention provides an application of the product, wherein the product is a pesticide, fertilizer, or fertilizer additive; the product contains the aforementioned DEK618 protein or a fusion protein of the DEK618 protein, or its encoding gene, or biological material containing its encoding gene; the application is at least one of the following: (1) Regulates plant seed development; (2) Regulating the weight or size of plant seeds; (3) Regulating plant endosperm development; (4) Regulating plant height; (5) Regulating plant yield; (6) Regulate the starch or protein content of plant seeds; (7) Plant variety improvement; (8) Regulating mitochondrial RNA editing.

[0021] In this invention, when the expression level or activity of DEK618 protein or gene is inhibited, the development of plant grains is arrested, the grain weight is reduced, the grain length or width is reduced, the starch or protein content of plant grains is reduced, the yield is reduced, the plant height is reduced, and mitochondrial function is lost.

[0022] In this invention, full-length nucleotide sequences or fragments thereof are typically obtained using PCR amplification, recombinant methods, or artificial synthesis. For PCR amplification, primers are designed based on the relevant nucleotide sequences disclosed in this embodiment, especially the open reading frame sequences, and commercially available cDNA libraries or cDNA libraries prepared using conventional methods known to those skilled in the art are used as templates to amplify the relevant sequences. When the sequences are long, nested PCR amplification is usually required two or more times, and then the products of each PCR amplification are spliced ​​together in the correct order. Once the relevant sequences are obtained, recombinant methods can be used to obtain the relevant sequences in large quantities. Typically, they are cloned into a vector, and then the relevant sequences are isolated from proliferating host cells using conventional methods such as cell transformation. In addition, mutations can be introduced into the protein sequences of the embodiments through chemical synthesis. Besides recombinant methods, fragments of the protein of the embodiments can also be produced using solid-phase technology by directly synthesizing polypeptides. In vitro protein synthesis can be performed manually or automatically, and the fragments of the protein of the embodiments can be chemically synthesized separately and then chemically linked to produce full-length protein molecules.

[0023] Compared with the prior art, the present invention has the following beneficial effects: This invention discovers that the Dek618 protein and its encoding gene play an important role in regulating plant grain development. Its related biological materials can be used to regulate plant grain yield, grain embryo development, and starch and protein content in grains. It has significant application value in the genetic resource germplasm improvement of higher plants such as maize, and at the same time provides a scientific basis for elucidating the developmental mechanism of grain formation. Attached Figure Description

[0024] Figure 1 This is the result of Dek618 gene identification.

[0025] Figure 2 This is the result of verifying the Gene3 gene's control over the dek618 mutant phenotype.

[0026] Figure 3 This is a comparison of the differences in grain traits between the wild type (WT) and the mutant dek618.

[0027] Figure 4 This is a comparison of base editing results at different sites between wild-type (WT) and mutant dek618.

[0028] Figure 5 This is the result of Dek618 affecting the assembly of mitochondrial complex III and the ultrastructure of mitochondria. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0031] Example 1: Obtaining the Dek618 gene

[0032] 1. A naturally mutated grain-deficient mutant, dek618, was obtained from breeding materials. The heterozygous mutant dek618 / + was used as the male parent and crossed with B73, followed by self-pollination to obtain F2 ears. The F2 ears showed a 3:1 segregation ratio of normal to defective grains, indicating that this mutant phenotype is controlled by a recessive single gene. The dek618 mutant grains are small and flat upon maturity, with noticeable wrinkling at the grain tip. Figure 1 A). After longitudinally cutting the grains, it was found that the mutant embryos were significantly smaller than normal grains and were shrunken. Figure 1 B).

[0033] 2. Using the F2 genetic mapping population, the Dek618 gene was cloned, ultimately locating the target gene to a 70Kb region on chromosome 7. Figure 1 C). Gene annotation and sequencing analysis within the candidate region indicated that the Gene3 gene (CDS sequence as shown in SEQ ID NO.2, amino acid sequence as shown in SEQ ID NO.1) is a potential candidate gene. In the mutant dek618, the Gene3 gene has a 254 bp insertion 1229 bp after the ATG, which may affect normal gene transcription. Amplification and sequencing of transcripts of this gene in wild type and dek618 showed that the transcript in dek618 had different types of breaks near the insertion fragment (…). Figure 1 D). The almost perfect reverse complementarity of the inserted fragment may affect the transcription process or the secondary structure of the posttranscribed RNA, leading to alterations in the identified transcript sequence. Specific primers were designed at the 5' end of the gene for qRT-PCR to identify its expression level, and the results are as follows... Figure 1 As shown in E.

[0034] 3. To further verify that Gene3 is the gene controlling the phenotype of the dek618 mutant, we identified a gene3-ems mutant with a C-to-T single nucleotide variant 538 bp downstream of the ATG in the Gene3 gene, causing premature termination of gene transcription. Figure 2 A). Plants with the genotype gene3-ems / + were screened using PCR ( Figure 2 B), self-pollination of gene3-ems / + plants and hybridization with dek618 / + yielded F1 ears of fruit. Observation revealed a 3:1 segregation of wild-type and mutant kernels. Figure 2 C). The results confirmed that the mutation in the Gene3 (Zm00001d021980) gene was the cause of the dek618 mutant phenotype.

[0035] The primers for detecting gene3-ems mutants are as follows: gene3-ems-F: TCCTTATTCGGCATTTCGTC (SEQ ID NO.3)

[0036] gene3-ems-R: CCTGGCCTCTTCCTCCTACT (SEQ ID NO. 4).

[0037] Example 2: Effects of Dek618 gene mutation on grain and plant development

[0038] The wild-type WT kernels used below are large and plump kernels produced from the F2 generation segregating ears obtained by crossing the dek618 mutant with the B73 maize inbred line and then self-crossing, and have the same phenotype as the B73 maize inbred line; the dek618 mutant kernels used below are small and wrinkled kernels produced from the above segregating ears, and have the same phenotype as dek618.

[0039] 1. Measurement of the 100-kernel weight of mature seeds revealed that the homozygous mutant seed weight was only 31.7% of that of the wild type. Figure 3 A). Some mature homozygous mutants can germinate. Compared with the wild type, the germinated mutants have shorter primary roots and no secondary roots. Figure 3 B), the germination rate is about 45% ( Figure 3 C). When homozygous mutant seeds and wild-type seeds are sown simultaneously, the mutants grow more slowly, are shorter, and seedlings stop growing during the vegetative growth stage. Figure 3 D).

[0040] 2. Paraffin sections were taken from ears of fruit 15 days after pollination and examined for wild-type and mutant kernels. Wild-type kernels showed normal embryo development, with distinct scutellum, coleoptile, leaf primordia, shoot apical meristem, and root apical meristem; starch granules were densely arranged in the endosperm cells. Figure 3E). The differentiation of the embryo in the mutant grains is significantly later than in the wild type, occurring at the coleoptile stage. Endosperm development is delayed, and compared to the wild type, the mutant grains have significantly fewer starch granules accumulated in the endosperm cells, with gaps existing between the granules and the seed coat. Figure 3 F). In wild-type kernels, the basal endosperm transfer layer (BETL) cells are more tightly packed and show a tendency to grow inwards. In dek618 kernels, the BETL cells show some development, but the cell layer is thinner compared to the wild type. Figure 3 G), which may affect the transport of nutrients from the parent plant to the kernel. At 15 days post-pollination, distinct aleurone layer cells were observed on the periphery of the endosperm in wild-type kernels, while the aleurone layer cells on the periphery of the endosperm in dek618 kernels were not clearly developed. Figure 3 E and Figure 3 F). The above results indicate that the development of both the germ and endosperm in the mutant grains is affected.

[0041] Example 3: The Dek618 gene participates in RNA editing after mitochondrial gene transcription.

[0042] Three biological replicates were taken from both wild-type and mutant materials. RNA was extracted from seeds 12 days after pollination (Tiangen Biotech Co., Ltd., #DP432). Using primer sequences for detecting the expression levels of 35 publicly available mitochondrial genes, cDNA reverse transcription amplification was performed on these 35 genes. After agarose gel electrophoresis, the amplification products were analyzed using STS-PCR-seq to comprehensively analyze the number and efficiency of editing sites in the transcripts of the 35 mitochondrial coding genes. The results showed that a total of 498 editing sites were detected in the transcripts of these mitochondrial genes, and these editing sites were widely distributed in the mitochondrial transcripts (Table 1). Compared with the wild type, 71 sites showed decreased editing efficiency (ΔEE≥0.1), while 17 sites showed increased editing efficiency (ΔEE≤-0.1).

[0043] Among the sites with reduced editing efficiency, the most severely affected are genes encoding proteins related to cytochrome c biosynthesis. In mutant materials, the bases at ccmC-184, ccmB-428, and ccmFC-1219 are completely unedited, leading to errors in the amino acids encoded at these sites. Figure 4 In complex III, the base at the cob-298 site is also completely unedited, preventing the amino acid encoded at this site in dek618 from being converted from His to Tyr. These results indicate that the Dek618 gene is involved in post-transcriptional RNA editing of mitochondrial genes.

[0044] Table 1

[0045] Example 4: The effect of Dek618 on the assembly of mitochondrial complex III and mitochondrial ultrastructure

[0046] Mitochondrial proteins were extracted from wild-type and dek618 mutant seeds 15 days after pollination, and the assembly of various mitochondrial complexes was analyzed by BN-PAGE. Compared with the wild type, the content of supercomplex I+III2 was significantly reduced in dek618, the content of complex I was increased to some extent, and complex III was almost invisible in dek618. Figure 5 A). The peroxidase activity of dek618 was detected, and the results showed that the contents of both the supercomplex I+III2 and complex III2 were significantly reduced. Figure 5 B), consistent with CBB staining results.

[0047] Ultrathin sections of the endosperm were prepared from wild-type and mutant kernels from dek618 / + heterozygous ears 15 days after pollination, and the mitochondrial ultrastructure was observed by transmission electron microscopy. In wild-type kernels, the inner mitochondrial membrane could fold normally into a dense cristae structure. Figure 5 C). In the dek618 endosperm, the mitochondrial inner membrane morphology is abnormal, the arrangement is loose, and cristae cannot be formed. The abnormal mitochondrial ultrastructure further proves that the mutation of Dek618 leads to the loss of mitochondrial function.

[0048] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. Application of DEK618 protein or a fusion protein of DEK618 protein, or a gene encoding the same, or a biological material containing the gene encoding the same, in regulating plant seed development; the amino acid sequence of the DEK618 protein is at least one of the following: (a) the sequence shown in SEQ ID No. 1; (b) A sequence having the function of regulating plant seed development after one or more amino acid residues are substituted, deleted, and / or added to the sequence shown in SEQ ID NO.

1.

2. Application of DEK618 protein or fusion protein of DEK618 protein, or its encoding gene, or biological material containing its encoding gene in at least one of the following aspects: (1) Regulating plant seed weight or size; (2) Regulate plant endosperm development; (3) Regulating plant height; (4) Regulating plant yield; (5) Regulating the starch or protein content of plant seeds; (6) Regulate mitochondrial RNA editing; The amino acid sequence of the DEK618 protein is at least one of the following: (a) the sequence shown in SEQ ID No. 1; (b) A sequence having the function of regulating plant seed development after one or more amino acid residues are substituted, deleted, and / or added to the sequence shown in SEQ ID NO.

1.

3. Application of DEK618 protein or a fusion protein of DEK618 protein, or a gene encoding the same, or a biological material containing the gene encoding the same in plant variety improvement; the amino acid sequence of the DEK618 protein is at least one of the following: (a) the sequence shown in SEQ ID No. 1; (b) A sequence having the function of regulating plant seed development after one or more amino acid residues are substituted, deleted, and / or added to the sequence shown in SEQ ID NO.

1.

4. The use according to any one of claims 1 to 3, characterized in that: The coding gene of the DEK618 protein is at least one of the following: (1) the sequence shown in SEQ ID No. 2; (2) A DNA molecule that can affect seed and grain development formed by substitution of one or several bases and / or insertion and / or deletion of one or several bases or insertion / deletion / shift / inversion of a large fragment of nucleotide sequence based on SEQ ID NO.2; (3) hybridization and membrane washing in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% (w / v) SDS at 65°C, and a DNA molecule that can hybridize with the sequence shown in SEQ ID NO.2 and encode a protein related to plant seed development; (4) A DNA molecule that has more than 85% homology with the sequence shown in SEQ ID NO.2 and encodes a protein related to plant seed development.

5. The use according to any one of claims 1 to 3, characterized in that: By regulating the expression level or activity of DEK618 protein or gene, the development of plant seeds, the weight of plant seeds, the length or width of seeds, the yield, the starch or protein content of plant seeds, or the RNA editing of mitochondria can be regulated.

6. The use according to claim 5, characterized in that: The expression level or activity of DEK618 protein or gene is regulated by hybridization technology, transgenic technology or gene editing technology.

7. The use according to any one of claims 1 to 3, characterized in that: The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, virus vector, engineered bacteria or non-renewable plant cells or tissues.

8. The use according to any one of claims 1 to 3, characterized in that: The plant is a monocotyledon or a dicotyledon.

9. A method for preparing a transgenic plant, characterized in that: include: The DEK618 protein or a fusion protein of the DEK618 protein according to claim 1, or a gene encoding the DEK618 protein or a biological material containing a gene encoding the DEK618 protein according to claim 1 is introduced into a plant.

10. An application of a product, characterized in that, The product is a pesticide, a fertilizer or a fertilizer additive; the product contains the DEK618 protein or a fusion protein of the DEK618 protein according to claim 1, or a gene encoding the DEK618 protein, or a biological material containing a gene encoding the DEK618 protein; and the application is at least one of the following: (1) Regulate plant grain development; (2) Regulating plant seed weight or size; (3) Regulate plant endosperm development; (4) Regulating plant height; (5) Regulating plant yield; (6) Regulating the starch or protein content of plant seeds; (7) Plant variety improvement; (8) Regulate mitochondrial RNA editing.

Images