Rapid separation culture and induced adipogenesis method for cyprinus carpio peritoneal preadipocytes

Abstract

The invention relates to a rapid separation culture and adipogenesis induction method for carp abdominal preadipocytes, in particular to a rapid separation culture and adipogenesis induction method for fish adipocytes. The isolated culture method comprises the following steps: 1, disinfecting fish bodies; 2, aseptically taking visceral clusters in the abdominal cavity to coat fat; 3, digesting adipose tissues; and 4, preparing the patch and digesting cells. The fat formation induction method comprises the following steps: after fat precursor cells grow to 80%, carrying out induction culture by using a fat formation induction culture medium containing oleic acid and linoleic acid, changing 1 / 2 of the liquid every 3 days, and culturing for 7-15 days. The adipogenic induction liquid used in the invention can enable the adipogenic differentiation of cells to be more than 70% within 12-15 days. The culture method for the properitoneal cells of the carp is fast in cell growth, good in repeatability and high in adipogenesis efficiency of the induction method, and is an ideal method for research on fish adipocyte differentiation.

Description

Technical Field

[0001] The invention relates to a method for quickly separating, culturing and inducing adipogenesis of fish fat cells. Background Art

[0002] Fish meat is safe, nutritious and widely loved by the public. Its meat nutrients mainly include protein, fat, water, ash, etc. The quality of fish meat is closely related to its fat content. When the intramuscular fat content of fish meat increases, its palatability improves (Li Yin, 2024). Fish adipose tissue is mainly deposited in the subcutaneous tissue, muscle, liver and mesentery. The deposition sites vary depending on the species. The conventional method is to increase fish fat by adjusting the ratio of fish feed. This method will increase the abdominal cavity and organ fat while increasing the intramuscular fat of fish, affecting the quality of fish meat. However, studies have shown that there are differences in the fat deposition mechanisms in different parts, and there are different regulatory mechanisms for the deposition of intramuscular fat and abdominal fat. The construction of an abdominal fat model is helpful to analyze the mechanism of abdominal fat deposition.

[0003] At present, the pre-adipocyte models of mammals such as mice, humans, cattle, and pigs have been successfully constructed at home and abroad, and the progress in fish is relatively slow. Since the 1960s, the separation and culture technology of fish adipocytes has also been developed, including rainbow trout, Atlantic salmon (Vegusdal A, 2024), and red sea bream. Wang Yawen explored the differences in adipose tissue in different parts of tilapia, established an in vitro culture system for tilapia adipocytes, and clarified that the proliferation and differentiation of tilapia adipocytes are regulated by exogenous fat (Wang Yawen, 2017). Cao Kai conducted the first study on the primary and subculture of grass carp fat. Ji Hong et al. conducted in-depth research on the effects of docosahexaenoic acid (DHA), highly unsaturated fatty acids (HUFA) and arachidonic acid (ARA) on the development of grass carp pre-adipocytes. The results showed that DHA treatment can significantly inhibit the lipid accumulation of adipocytes, while inhibiting β-catenin activity can alleviate the inhibitory effect of DHA on the lipid accumulation of adipocytes (Cao Kai, 2011). Ke Zhixiong et al. successfully established a pre-adipocyte cell line of Lateolabrax japonicus and verified that it has differentiation ability after induction with oleic acid. The expression of lipid metabolism genes changed significantly, which can be used as a good model for studying fish adipocyte differentiation and fat deposition (Ke Yixiong, 2024). Carp is a major freshwater economic fish in my country. It has strong adaptability, fast growth rate, large yield and many varieties. Human requirements for carp have changed from quantity to quality, seeking high-quality carp with high intramuscular fat and low abdominal fat. The conventional method of increasing intramuscular fat in fish meat through excessive feeding causes abdominal fat accumulation in fish, immune response in fish, and water pollution. The construction of a carp abdominal adipocyte culture system is conducive to the study of the regulation mechanism of carp fat deposition. The conventional method of culturing carp abdominal pre-adipocytes grows slowly, the number is small, and the induced adipogenesis efficiency is low. The construction of a fast and efficient culture method will provide technical support for analyzing the deposition mechanism of carp adipocytes. Summary of the invention

[0004] The invention provides a method for quickly isolating, culturing and inducing adipogenesis of carp peritoneal preadipocytes.

[0005] The method for rapidly isolating and culturing carp peritoneal preadipocytes of the present invention is carried out according to the following steps:

[0006] 1. Disinfection of fish;

[0007] 2. Aseptically remove the fat encapsulating the abdominal viscera:

[0008] Take the fat around the abdominal viscera and put it into phosphate buffer containing 5%-8% by volume of 100* penicillin-streptomycin mixture for 3-5 times, then soak it in 100* penicillin-streptomycin mixture for 5 minutes, and discard the liquid;

[0009] 3. Digestion of adipose tissue

[0010] The adipose tissue obtained in step 2 is placed in a 35 mm easy-hold dish coated cell culture bottle, and the adipose tissue is digested with trypsin until the tissue is viscous, and then fetal bovine serum with an equal volume to the trypsin is added to terminate the digestion, and then 0.2% type I collagenase is used to continue digestion, and L15 complete medium is added to terminate the digestion, and then the digestion solution is blown to obtain a fat cell digestion solution; the L15 complete medium is composed of 13-17% fetal bovine serum, 0.8-1.2% L-glutamine, 0.8-1.2% 100* penicillin-streptomycin mixture, 0.8-1.2% carp serum, 0.8-1.2% embryo extract and 78.2-83.8% L15 basal medium according to volume percentage;

[0011] 4. Preparation of patches and digestion of cells:

[0012] Filter the adipose tissue digestion solution with a filter, take the tissue block from the filter and directly stick it into the cell culture bottle, collect the filtrate, centrifuge at 1500rpm for 6min, resuspend the precipitate in L15 complete medium, and press 50000 cells / cm 2 The cells are then inoculated into the cell culture bottles with tissue blocks attached thereto, wherein the cell culture bottles are pre-coated with 1% gelatin; the serum L15 complete medium is a serum-containing medium, which is composed of 13-17% fetal bovine serum, 0.8-1.2% L-glutamine, 0.8-1.2% 100* penicillin-streptomycin mixed solution, 0.8-1.2% carp serum, 0.8-1.2% embryo extract and 78.2-83.8% L15 basic medium in volume percentage; thus, the separation and culture of carp peritoneal preadipocytes is completed.

[0013] The above-mentioned adipogenic induction method for isolating and culturing adipocytes is as follows:

[0014] Replace 1 / 3 of the L15 complete culture medium of step 4 of claim 1 every two days until the adipocytes grow to 80%; then inoculate the culture medium into an adipogenic induction medium, replace 1 / 2 of the medium every 3 days, and culture for 7 to 15 days to successfully construct a carp preadipocyte adipogenic model; the adipogenic induction medium is made of L15 complete culture medium, wherein the concentration of insulin is 10 to 20 μg / mL, the concentration of IBMX is 0.4 to 0.6 mmol / L, the concentration of dexamethasone is 1 μmol / L, the concentration of 3,3′,5-triiodo-L-thyronine is 10 nmol / L, and the concentration of the oleic acid and linoleic acid mixture is 100 μmol / L.

[0015] Beneficial effects of the present invention:

[0016] The invention provides a culture model for efficiently separating and culturing carp preadipocytes by a method of combining pancreatic enzyme and collagenase digestion with tissue block pasting.

[0017] The cells obtained by the present invention have a short operation time, can rapidly proliferate into a single cell layer, have good repeatability, and provide basic materials for exploring the fat deposition mechanism of carp fish.

[0018] The adipogenesis induction culture medium of the invention can make carp peritoneal preadipocytes rapidly and efficiently form adipogenesis, and is composed of insulin, IBMX, dexamethasone, 3,3′,5-triiodo-L-thyronine and oleic acid mixture. The used adipogenesis induction culture medium can induce more than 70% of peritoneal preadipocytes to form adipogenesis within 12-15 days, and is simple and efficient, and provides basic materials for constructing a carp preadipocyte degeneration model.

[0019] The carp peritoneal preadipocyte model successfully constructed by the present invention can provide high-quality tools and methods for studying physiological and pathological related processes such as regulation of fat development and metabolism. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The cell growth conditions of the preadipocytes in Example 1 after one week of growth under a 4x light microscope and a 10x light microscope;

[0021] Figure 2 is a comparison diagram of the CO1 gene sequence of carp preadipocytes in Example 1;

[0022] Figure 3 The adipogenesis of preadipocytes in Example 2 after being induced to adipogenesis for 8 days under 4x, 10x, and 40x light microscopes;

[0023] Figure 4 This is the Oil Red O staining of preadipocytes induced to adipogenesis 12 days after the induction in Example 2;

[0024] Figure 5 This is the result of fluorescence staining with lipid fluorescent stain BODIPY after preadipocytes were induced to adipogenesis for 12 days in Example 2. The lipids showed green fluorescence under a fluorescence microscope.

[0025] Figure 6 The upper culture medium was collected after the preadipocytes were induced to become adipocytes in Example 2, wherein the total cholesterol (TC) and triglyceride (TG) changed;

[0026] Figure 7 This is the expression of the fat differentiation-related genes in Example 2 at different days of induction of differentiation. DETAILED DESCRIPTION

[0027] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments may be combined with each other.

[0029] Specific implementation method 1: The method for rapid separation and culture of carp peritoneal preadipocytes in this implementation method is carried out according to the following steps:

[0030] 1. Fish disinfection;

[0031] 2. Aseptically remove the fat encapsulating the abdominal viscera:

[0032] Take the fat around the abdominal viscera and put it into phosphate buffer containing 5%-8% 100* penicillin-streptomycin mixture for washing 3-5 times, soak in 100* penicillin-streptomycin mixture for 5 minutes, and discard the liquid;

[0033] 3. Digestion of adipose tissue

[0034] The adipose tissue obtained in step 2 is placed in an easy-to-hold dish, and pancreatic enzyme is used to digest the adipose tissue until the adipose tissue becomes viscous, and then fetal bovine serum with an equal volume to the pancreatic enzyme is added to terminate the digestion, and then 0.2% type I collagenase is used to continue digestion, and L15 complete medium is added to terminate the digestion, and then the digestion solution is blown to obtain adipose tissue digestion solution; the L15 complete medium is composed of 13-17% fetal bovine serum, 0.8-1.2% L-glutamine, 0.8-1.2% 100* penicillin-streptomycin mixed solution, 0.8-1.2% carp serum, 0.8-1.2% embryo extract and 78.2-83.8% L15 basal medium according to volume percentage;

[0035] 4. Preparation of patches and digestion of cells:

[0036] Filter the adipose tissue digestion solution with a filter, take the tissue block from the filter and directly stick it into the cell culture bottle, collect the filtrate, centrifuge at 1500rpm for 6min, resuspend the precipitate in L15 complete medium, and press 50000 cells / cm 2Inoculate in the cell culture flask attached to the tissue block, wherein the cell culture flask is pre-coated with 1% gelatin; the L15 complete medium is a serum-containing medium, which is composed of 13-17% fetal bovine serum, 0.8-1.2% L-glutamine, 0.8-1.2% 100* penicillin-streptomycin mixed solution, 0.8-1.2% carp serum, 0.8-1.2% embryo extract and 78.2-83.8% L15 basal medium according to volume percentage;

[0037] The carp selected in step 1 of this embodiment is a 12-16 month old carp that grows rapidly and has more fat after wintering.

[0038] In this embodiment, the tissue blocks in step 3 do not need to be completely digested, but are half-digested until a small amount of tissue blocks remain.

[0039] In step 3 of this embodiment, the L15 basal culture medium is a commercial reagent purchased from the market, ThermoFisher Scientific 41300039.

[0040] In step 4 of this embodiment, the filter screen is a 100 μm filter screen.

[0041] In the prior art, the tissue blocks are often removed when culturing the growth and differentiation of fish fat cells, resulting in slow cell growth and a long induction time. However, in step 4 of this embodiment, the fat tissue is directly attached to the cell culture bottle to promote rapid cell growth and differentiation.

[0042] The 100% penicillin-streptomycin mixed solution described in this embodiment is purchased from the market.

[0043] Specific embodiment 2: This embodiment differs from specific embodiment 1 in that: in step 1, disinfection method: carp is soaked in a 0.01% potassium permanganate solution by volume for 20 minutes, anesthetized, blood is drained, and then soaked in 75% alcohol for 1 minute for disinfection. Other steps and parameters are the same as those in specific embodiment 1.

[0044] Specific implementation method 3: This implementation method is different from specific implementation method 1 in that: in step 3, the cell culture flask is coated 24 hours in advance with poly-lysine, rat tail collagen or 1% gelatin. Other steps and parameters are the same as those in specific implementation method 1.

[0045] Specific embodiment 4: This embodiment is different from the specific embodiment 1 in that: in step 3, during pancreatic digestion: every 1 cm 3 Add 200 μL of 0.25% pancreatin to the volume of fat tissue. During digestion, cut the fat tissue into 0.1-0.2 cm 3 The small pieces were digested for 1 to 2 minutes until the tissue became viscous. The other steps and parameters were the same as those in the first embodiment.

[0046] In this embodiment, the adipose tissue is cut into small pieces in a centrifuge tube using sharp ophthalmic scissors.

[0047] Specific embodiment 5: This embodiment differs from specific embodiment 1 in that: in step 3, 0.2% type I collagenase at a concentration of 5 times the volume of adipose tissue is added, and digestion is carried out at 28°C for 3.5 to 4 hours. During the digestion process, the mixture is thoroughly mixed by blowing once every half an hour, and L15 complete medium with an equal volume of type I collagenase is added to terminate the digestion. The other steps and parameters are the same as those of specific embodiment 1.

[0048] Specific embodiment 6: Specific embodiment 1 The method for inducing adipogenesis by isolating and culturing fat cells is as follows:

[0049] Replace 1 / 3 of the L15 complete culture medium of step 4 of claim 1 every two days until the adipocytes grow to 80%; then inoculate the culture medium into an adipogenic induction medium, replace 1 / 2 of the medium every three days, and culture for 7 to 15 days to successfully construct a carp preadipocyte adipogenic model; the adipogenic induction medium is made of L15 complete culture medium, wherein the concentration of insulin is 10 to 20 μg / mL, the concentration of IBMX is 0.4 to 0.6 mmol / L, the concentration of dexamethasone is 1 μmol / L, the concentration of 3,3′,5-triiodo-L-thyronine is 10 nmol / L, and the concentration of the oleic acid and linoleic acid mixture is 100 μmol / L.

[0050] The adipogenic induction medium described in this embodiment can cause carp peritoneal preadipocytes to rapidly and efficiently form adipocytes. The adipogenic medium is composed of a mixture of insulin, IBMX, dexamethasone, 3,3′,5-triiodo-L-thyronine and oleic acid.

[0051] In step 5 of this embodiment, the cell growth and adhesion are observed daily, and 1 / 3 of the culture medium is replaced every two days. The cells can grow to 80% in one week.

[0052] In this embodiment, the peritoneal preadipocytes are cultured using an adipogenic induction medium, and 1 / 2 of the medium is replaced every 3 days. Obvious lipid droplets can be observed in 7-8 days, and more than 70% of lipid droplets can be induced in 12-15 days.

[0053] In this embodiment, the liquid aspiration speed is slow when replacing the induction culture medium, and the oleic acid in the oleic acid mixture is not less than 50%.

[0054] Example 1: Cultivation of carp peritoneal preadipocytes and induction of adipogenesis using the method of the present invention

[0055] The specific steps are as follows:

[0056] 1. Fully disinfect the fish body:

[0057] The 14-month-old carp were fasted for 48 hours, and then immersed in a 0.01% potassium permanganate solution for 20 minutes to anesthetize. After serum was extracted from the tail blood vessels, the fish were immersed in 75% alcohol for 1 minute and then transferred to a sterile operating table.

[0058] 2. Aseptically remove the fat encapsulating the abdominal viscera:

[0059] Cut open the fish belly at the front of the cloaca, take the fat around the abdominal organs, wash it 5 times in phosphate buffer containing 8% 100% penicillin-streptomycin mixture, remove blood cells and excess connective tissue, remove the washing liquid, soak it in 100% penicillin-streptomycin mixture for 5 minutes, and discard the liquid;

[0060] 3. Digestion of Adipose Tissue

[0061] Every 1cm 3 Add 200 μL of 0.25% trypsin to the adipose tissue, chop it thoroughly in a centrifuge tube, transfer it to a 35 mm easy-to-hold dish, and add 100 μL of fetal bovine serum to terminate the trypsin digestion until the adipose tissue becomes viscous. Add 0.2% type I collagenase in a volume of 5 times the volume of the tissue, digest it at 28°C for 4 h, and add L15 complete medium to terminate the digestion.

[0062] 4. Prepare patches and digest cells;

[0063] Puff the digestion solution 50 times, filter the liquid with a 100 μm filter, take the tissue block from the filter and stick it directly to the cell culture bottle, collect the filtrate, centrifuge at 1500 rpm for 6 minutes, and resuspend in L15 complete medium. Press 50,000 cells / cm 2 Inoculate in the cell culture flask with the tissue block attached above;

[0064] 5. Medium Change and Subculturing

[0065] Observe cell growth and adhesion every day, replace 1 / 3 of the culture medium every two days, and the cells can grow to 80% ( Figure 1 Figure 1 is the cell growth status of preadipocytes in this embodiment after one week of growth under 4x light microscope and 10x light microscope; Figure a is the cell status under 4x light microscope, and Figure b is the cell status under 10x light microscope).

[0066] During subculture, cells were cultured at 10,000 cells / cm 2 Inoculate in a pre-coated six-well plate for later use.

[0067] The L15 complete medium described in this example is composed of 15% fetal bovine serum, 1% L-glutamine, 1% 100% penicillin-streptomycin mixture, 1% carp serum, 1% embryo extract and 81% L15 basal medium according to volume percentage.

[0068] The L15 basal culture medium described in this example is a commercial reagent purchased from the market, ThermoFisherScientific 41300039.

[0069] The 100% penicillin-streptomycin mixed solution described in this example was purchased from the market.

[0070] Comparison of CO1 gene sequence of carp pre-adipocytes: The pre-adipocytes were analyzed for cell provenance, and the pre-adipocyte DNA was extracted and sequenced after PCR. The comparison showed that the similarity between the pre-adipocytes and the carp gene sequence was more than 99%, indicating that the cells belonged to carp cells ( Figure 2 )( Figure 2 1 is a comparison diagram of the CO1 gene sequence of carp preadipocytes in this embodiment);

[0071] CO1 gene primer F1: TCAACCAACCACAAAGACATTGGCAC

[0072] R1: TAGACTTCTGGGGTGGCCAAAGAATCA.

[0073] Example 2: This example achieves the induction of adipogenesis in carp peritoneal preadipocytes

[0074] 1. Preparation of Adipogenic Induction Solution

[0075] The adipogenic induction medium was prepared within 1 week before use, and the adipogenic induction medium was made of L15 complete medium, wherein the concentration of insulin was 20 μg / mL, the concentration of IBMX was 0.5 mmol / L, the concentration of dexamethasone was 1 μmol / L, the concentration of 3,3′,5-triiodo-L-thyronine was 10 nmol / L, and the concentration of the oleic acid and linoleic acid mixture was 100 μmol / L.

[0076] Specific ingredients include:

[0077] L15 complete medium, 20 μg / mL insulin, 0.5 mmol / L IBMX, 1 μmol / L dexamethasone, 10 nmol / L 3,3′,5-triiodo-L-thyronine and 100 μM / L oleic acid and linoleic acid mixture.

[0078] 2. Replacement of culture medium

[0079] Replace 1 / 3 of the L15 complete medium in step 4 of Example 1 every two days until the adipocytes grow to 80%; then inoculate the culture medium into the adipogenic induction medium, replace 1 / 2 of the medium every 3 days, and culture for 7 to 15 days to successfully construct a carp preadipocyte adipogenic model; obvious lipid droplets can be observed in 7-8 days ( Figure 3This is the adipogenesis status of the preadipocytes in this example under 4x, 10x and 40x light microscopes 8 days after induction of adipogenesis, a. cell status under 4x light microscope, b. cell status under 10x light microscope, c. cell status under 40x light microscope). More than 70% of lipid droplets can be induced in 12-15 days, and the carp preadipocyte adipogenesis model is successfully constructed.

[0080] The following is the verification of the pre-adipocyte induction test results:

[0081] 1. Oil Red O staining

[0082] Use Oil Red O staining solution to stain the adipocytes after adipogenesis. Oil Red O can dye lipid droplets red. Figure 4 12 days after the preadipocytes were induced to form adipocytes, the results of Oil Red O staining were shown in the present embodiment (a is the staining of cells under a 4x microscope, and b is the staining of cells under a 10x microscope); Figure 4 As shown, after 12 days of adipogenesis induction, more than 70% of the adipocytes showed red lipid droplets, proving that the cell-induced adipogenesis model was successfully constructed with high induction efficiency.

[0083] 2. BODIPY lipid staining

[0084] The adipocytes induced to adipogenesis were stained with BODIPY staining solution, and the lipids showed green fluorescence under a fluorescence microscope, indicating that the adipocytes could be induced to produce a large number of lipid droplets through the induction solution, and the adipogenesis model was successfully constructed. Figure 5 The results of BODIPY fluorescence staining of preadipocytes induced to adipogenesis for 12 days in this embodiment (Figures abc show the changes in cell adipogenesis under a 4x microscope, and Figures ABC show the changes in cell adipogenesis under a 10x microscope, where Figures a and A show the results of BODIPY white light, b and B show the results of BODIPY fluorescence, and c and C show the merged images), and lipids show green fluorescence under a fluorescence microscope;

[0085] 3. Detection of changes in total cholesterol (TC) and triglyceride (TG) content

[0086] The total cholesterol (TC) and triglyceride (TG) detection kits were used to detect the changes in lipids in the culture medium after differentiation induction. Figure 6 In this embodiment, the upper layer of culture medium was collected after preadipocytes were induced to become adipogenic, and the total cholesterol (TC) and triglyceride (TG) changed; Figure 6 As shown, the induced solution was used as the control group, and the TC and TG contents in the culture medium collected 12 days after induction increased significantly.

[0087] 4. Changes in the expression of adipogenesis-related factors

[0088] Differentiated adipocytes were obtained at 0, 3, 6, and 9 days after induction, and RNA was extracted using TaKaRa PrimeScript TM cDNA was synthesized by RTreagent Kit, and β-actin was used as an internal reference to analyze the expression of adipogenic factors. PrimerPremier 5.0 was used to design upstream and downstream primers of pparg, lpl, hsl, c / ebpa and fabp3 (Table 1 Adipose differentiation-related gene sequences). Gene expression levels were detected on a 7500qPCR instrument. -ΔΔCT The expression changes of adipogenesis-related factors were calculated by Figure 7 This is the expression of fat differentiation-related genes at different days of induction of differentiation in this example. The expression levels of pparg, lpl, hsl and c / ebpa reached the highest on the 9th day, and the expression level of fabp3 reached the highest on the 2nd day. The high expression of related adipogenic genes shows that adipogenesis was successfully induced.

[0089] Table 1 Sequences of genes related to adipose differentiation

[0090]

Claims

1. A method for rapidly isolating and culturing carp peritoneal preadipocytes, characterized in that The rapid isolation and culture method of carp peritoneal preadipocytes is carried out according to the following steps:

1. Fish disinfection; 2. Aseptically remove the fat encapsulating the abdominal viscera: Take the fat around the abdominal viscera and put it into phosphate buffer containing 5%-8% by volume of 100* penicillin-streptomycin mixture for 3-5 times, then soak it in 100* penicillin-streptomycin mixture for 5 minutes, and discard the liquid; 3. Digestion of adipose tissue The adipose tissue obtained in step 2 is placed in a 35 mm easy-hold dish coated cell culture bottle, and the adipose tissue is digested with trypsin until the adipose tissue becomes viscous, and then fetal bovine serum with an equal volume to the trypsin is added to terminate the digestion, and then 0.2% type I collagenase is used to continue digestion, and L15 complete medium is added to terminate the digestion, and then the digestion solution is blown to obtain a fat cell digestion solution; the L15 complete medium is composed of 13-17% fetal bovine serum, 0.8-1.2% L-glutamine, 0.8-1.2% 100* penicillin-streptomycin mixture, 0.8-1.2% carp serum, 0.8-1.2% embryo extract and 78.2-83.8% L15 basal medium according to volume percentage; 4. Preparation of patches and digestion of cells: Filter the adipose tissue digestion solution with a filter, take the tissue block from the filter and stick it directly into the cell culture bottle, collect the filtrate, centrifuge at 1500rpm for 6min, resuspend the precipitate in L15 complete medium, and press 50000 cells / cm 2 The cells are then inoculated into the cell culture bottles with tissue blocks attached thereto, wherein the cell culture bottles are pre-coated with 1% gelatin; the L15 complete culture medium is a serum-containing culture medium, which is composed of 13-17% fetal bovine serum, 0.8-1.2% L-glutamine, 0.8-1.2% 100* penicillin-streptomycin mixed solution, 0.8-1.2% carp serum, 0.8-1.2% embryo extract and 78.2-83.8% L15 basal culture medium in volume percentage; thus, the separation and culture of carp peritoneal preadipocytes is completed.

2. The method for rapidly isolating and culturing carp peritoneal preadipocytes according to claim 1, characterized in that Disinfection method in step 1: The carp is soaked in a 0.01% by volume potassium permanganate solution for 20 minutes to anesthetize it. After the blood is drained, it is soaked in 75% alcohol for 1 minute for disinfection.

3. A method for rapidly isolating and culturing carp peritoneal preadipocytes according to claim 1, characterized in that In step 3, the cell culture flask is coated 24 hours in advance with poly-lysine, rat tail collagen or 1% gelatin.

4. A method for rapidly isolating and culturing carp peritoneal preadipocytes according to claim 1, characterized in that During trypsin digestion in step 3: 3 Add 200 μL of 0.25% pancreatin to the volume of fat tissue. During digestion, cut the fat tissue into 0.1-0.2 cm 3 Small pieces were digested for 1 to 2 minutes until the tissue became viscous.

5. A method for rapidly isolating and culturing carp peritoneal preadipocytes according to claim 1, characterized in that In step 3, add 0.2% type I collagenase in an amount of 5 times the volume of adipose tissue, digest at 28°C for 3.5 to 4 hours, and thoroughly mix by pipetting every half hour during the digestion process. Add L15 complete medium in an amount equal to that of type I collagenase to terminate the digestion.

6. A method for inducing carp peritoneal preadipocytes to form adipocytes, characterized in that The method uses the peritoneal preadipocytes described in claim 1 to induce adipogenesis: Replace 1 / 3 of the L15 complete culture medium of step 4 of claim 1 every two days until the adipocytes grow to 80%; then inoculate the culture medium into an adipogenic induction medium, replace 1 / 2 of the medium every 3 days, and culture for 7 to 15 days to successfully construct a carp preadipocyte adipogenic model; the adipogenic induction medium is made of L15 complete culture medium, wherein the concentration of insulin is 10 to 20 μg / mL, the concentration of IBMX is 0.4 to 0.6 mmol / L, the concentration of dexamethasone is 1 μmol / L, the concentration of 3,3′,5-triiodo-L-thyronine is 10 nmol / L, and the concentration of the oleic acid and linoleic acid mixture is 100 μmol / L.

Images