α-glucan phosphorylase mutant and its preparation method and application

Abstract

The present invention discloses an alpha-glucan phosphorylase mutant and its preparation method and application. The present invention is directed to the key enzyme elements of cellulose-based starch, which have low catalytic efficiency, poor stability and adaptability, and difficulty in heterologous expression. Through big data analysis and bioinformatics methods of metagenomics and public databases, the key enzyme elements of novel cellulose degradation and starch synthesis are accurately mined and identified to obtain alpha-glucan phosphorylase from tobacco, which has better enzyme activity and starch synthesis function than alpha-glucan phosphorylase from potato; the present invention further performs a single-site mutation on the Cap domain of alpha-glucan phosphorylase from tobacco, and it is found that the amino acid sequence is a unit-site mutant obtained by performing a N563T unit-site mutation on the alpha-glucan phosphorylase from tobacco shown in SEQ ID No.1, and its enzyme activity and expression amount are significantly higher than those of wild-type alpha-glucan phosphorylase.

Description

Technical Field

[0001] The invention relates to a glucan phosphorylase mutant, in particular to a mutant of alpha-glucan phosphorylase derived from tobacco and application thereof in bioconversion of starch, belonging to the field of glucan phosphorylase mutants and applications thereof. Background Art

[0002] Carbohydrates, proteins and fats are the three main nutrients in the human diet, and balancing their proportions is essential for preventing chronic diseases such as obesity, type II diabetes, cardiovascular disease, hypertension and cancer. A good diet should contain slowly metabolized starch, which is essential for preventing chronic diseases.

[0003] Cellulose is the supporting material of plant cell walls and the most abundant carbohydrate on earth. The global agricultural production of lignocellulosic biomass is about 200 billion tons per year, of which cellulose accounts for about 40%, and 80 billion tons of cellulose are produced annually; in contrast, the global annual production of cereals is about 2.7 billion tons, which contains about 75% starch, and 2 billion tons of starch are harvested annually as food and feed. Therefore, the ratio of annual cellulose resources as food / feed to starch is about 40. Amylose is a linear glucan linked by α-1,4-glycosidic bonds, while cellulose is a linear glucan linked by β-1,4-glycosidic bonds. Humans can digest α-1,4-glycosidically linked glucans (starch), but cannot digest β-1,4-glycosidically linked glucans (cellulose), which is due to the lack of cellulose hydrolase in the human body. Enzymatic bioconversion of β-1,4-glycosidically linked glucans to α-1,4-glycosidically linked glucans to produce starch from non-food biomass has application prospects.

[0004] Efficient use of agricultural waste resources, especially the efficient conversion of cellulose waste resources into artificial food, is one of the important ways to alleviate the food crisis and achieve sustainable agricultural development. The rapid development of synthetic biology technology has made it possible for people to break the natural synthesis path and create an efficient artificial biosynthesis system. It also provides a strong technical guarantee for the efficient biosynthesis of artificial starch based on lignocellulose raw materials.

[0005] In previous studies, the inventors cooperated with Zhang Yiheng, a researcher at the Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, to develop a new biorefining technology based on lignocellulose, which can produce artificial food (i.e., starch and protein, the two most important food components) to cope with the imminent food crisis. The process of enzymatic hydrolysis and saccharification of corn straw was improved, and the lowest-cost commercial cellulase mixture was used to effectively remove β-glucosidase (BG) from the mixture. The cellulose-enzyme-yeast complex was used to reduce product inhibition and was applied to pre-treat corn straw. Studies have shown that the removal of β-glucanase (BG) from the cellulase component, that is, only endoglucanases (EGs) and cellulose biohydrolases (CBHs) are needed to hydrolyze cellulose into cellobiose. Under the action of cellobiose phosphorylase (CBP), it is converted into glucose 1-phosphate and glucose. Glucose can be used by Saccharomyces cerevisiae cells to produce microbial protein, and glucose 1-phosphate can be further catalyzed by potato-derived α-glucan phosphorylase (PGP) to produce artificial starch.

[0006] The in vitro coenzyme-free bioconversion of cellulose to starch consists of three steps: first, the cellulose is partially hydrolyzed into cellobiose using a cellulase mixture without BG; second, CBP converts cellobiose into glucose 1-phosphate and glucose in the presence of phosphate; third, a glucose unit from glucose 1-phosphate is added to the non-reducing end of amylose. The reaction of phosphate cycling between CBP and PGP is catalyzed by PGP. This integrated bioprocess is highly energy efficient in the bioconversion of cellulose to starch and does not waste any glucose units in cellulose. However, the current cost of enzyme use in this system is still high. How to further improve the catalytic performance of enzyme elements, reduce the production and use costs of enzymes, and improve the conversion efficiency of the system will directly determine the industrial feasibility of this technology.

[0007] Enzyme components are the core of in vitro multi-enzyme molecular machine biomanufacturing and the key and core of new biorefineries. The existing key enzyme components for cellulose-based starch production have problems such as low catalytic efficiency, poor stability and adaptability, or difficulty in heterologous expression, which need to be improved. Summary of the invention

[0008] One of the objects of the present invention is to provide a mutant of α-glucan phosphorylase 5CC5 derived from tobacco;

[0009] The second object of the present invention is to provide a gene encoding a mutant of the tobacco-derived α-glucan phosphorylase 5CC5.

[0010] The third object of the present invention is to provide an expression cassette containing the gene encoding the mutant, a recombinant expression vector or a recombinant host cell containing the recombinant expression vector;

[0011] The fourth object of the present invention is to apply the mutant of the tobacco-derived α-glucan phosphorylase 5CC5, its encoding gene, an expression cassette containing the encoding gene of the mutant, a recombinant expression vector or a recombinant host cell containing the recombinant expression vector to the synthesis or bioconversion of starch.

[0012] The above object of the present invention is achieved through the following technical solutions:

[0013] One aspect of the present invention is to provide a single-site mutant of tobacco-derived α-glucan phosphorylase 5CC5, which is a single-site mutant obtained by subjecting tobacco-derived α-glucan phosphorylase 5CC5 with an amino acid sequence as shown in SEQ ID No.1 to a N563T single-site mutation, and its amino acid sequence is shown in SEQ ID No.2.

[0014] In the present invention, the single-site mutant "N563T" means that the 563rd amino acid of the tobacco-derived α-glucan phosphorylase 5CC5 with the amino acid sequence shown in SEQ ID NO.1 is mutated from asparagine (N) to lysine (K); the expressions of the remaining single-site mutations in the present invention are similar.

[0015] Another aspect of the present invention is to provide a gene encoding a single-site mutant of tobacco-derived α-glucan phosphorylase 5CC5.

[0016] Another aspect of the present invention is an expression cassette containing a gene encoding a single-site mutant of the tobacco-derived α-glucan phosphorylase 5CC5, a recombinant expression vector, or a recombinant host cell containing the recombinant expression vector; wherein the recombinant expression vector can be a recombinant prokaryotic expression vector or a recombinant eukaryotic vector.

[0017] The present invention further provides a method for preparing a single-site mutant of any of the tobacco-derived α-glucan phosphorylase 5CC5, comprising:

[0018] (1) The coding gene of the single-site mutant of the tobacco-derived α-glucan phosphorylase 5CC5 is operably connected to an expression control element to construct a recombinant expression vector;

[0019] (2) The recombinant expression vector is transformed into host cells, the host cells are cultured, the recombinant protein is induced to express, and then purified.

[0020] In order to improve the expression or purification efficiency of the single-site mutant of the tobacco-derived α-glucan phosphorylase 5CC5; preferably, in step (1), a dockerin sequence (AGTACTAAACTATACGGCGACGTTAATGACGACGGCAAAGTGAATTCAACCGATGCAGTGGCATTAAAGCGATACGTCTTACGTTCTGGAATATCCATCAATACCGACAATGCCGATCTCAACGAAGACGGTCGGGTTAATAGTACCGACCTTGGCATACTCAAGAGATACATTCTGAAAGAAATAGATACTCTGCCTTACAAGAAT (SEQ ID No. 3)) is added to the front end of the coding gene of the tobacco-derived α-glucan phosphorylase 5CC5, and then connected with the expression regulatory element to construct a recombinant prokaryotic expression vector; the protein containing CBM3 (cellulose binding domain) can be tightly bound to the cellulose surface due to the high affinity adsorption of CBM3 to the cellulose surface, so the CBM3 domain-containing protein or complex bound to cellulose can be separated from the aqueous solution by high-speed centrifugation. A recombinant protein, mini-scaffoldin, was expressed in Escherichia coli BL21 (DE3) through experiments. The synthetic protein mini-scaffoldin contains a CBM3 domain and three different binding modules CipA, CbpA and ScaB. Due to the high-affinity interaction between the binding module and dockerin, the protein and mini-scaffoldin can assemble into an enzyme complex, which can be well adsorbed to regenerated amorphous cellulose (RAC) through the CBM3 domain of mini-scaffoldin. Finally, the protein in the crude enzyme solution can be selectively recovered by high-speed centrifugation.

[0021] Preferably, the method for purification in step (2) is preferably as follows: adding microcrystalline cellulose to the crude enzyme liquid product induced to express in the host cells and then centrifuging, collecting the precipitate, resuspending it with 0.5 mol EDTA and then centrifuging it again, and taking the supernatant to obtain the purified protein; adding microcrystalline cellulose to the crude enzyme liquid product induced to express in the host cells to obtain the enzyme and mini-scaffoldin complex adsorbed on the microcrystalline cellulose, and resuspending the precipitate obtained after centrifugation of the microcrystalline cellulose, enzyme and mini-scaffoldin complex with 0.5 mol EDTA and then centrifuging it again to dissociate the mini-scaffoldin from the dockerin structure on the mutant protein. Since the adsorption of mini-scaffoldin to microcrystalline cellulose is not affected, the precipitate after centrifugation is microcrystalline cellulose and mini-scaffoldin, and the supernatant is αGP protein, thereby achieving selective and efficient recovery of the mutant protein in the crude enzyme liquid.

[0022] Another aspect of the present invention is to apply the single-site mutant of the tobacco-derived α-glucan phosphorylase 5CC5, its encoding gene, an expression cassette containing the encoding gene of the single-site mutant, a recombinant expression vector or a recombinant host cell containing the recombinant expression vector to the synthesis or bioconversion of starch.

[0023] A preferred specific embodiment of the present invention provides an application of the single-site mutant of the tobacco-derived α-glucan phosphorylase 5CC5 in synthesizing starch, comprising: using cellobiose as a substrate and the single-site mutant of the tobacco-derived α-glucan phosphorylase 5CC5 as a converting enzyme to carry out an enzymatic bioconversion reaction to obtain starch; more preferably, the converting enzyme also contains cellobiose phosphorylase.

[0024] In view of the problems of low catalytic efficiency, poor stability and adaptability, and difficulty in heterologous expression of key enzyme components for preparing starch from cellulose, the present invention accurately mines novel key enzyme components for cellulose degradation and starch synthesis through big data analysis of metagenomics and public databases and bioinformatics methods, and mines and identifies a novel α-glucan phosphorylase protein (αGP-5CC5) from tobacco, which has better enzyme activity and starch synthesis function than PGP from potato. On this basis, the present invention further performs single-site mutation on the Cap domain of the mined and identified αGP-5CC5, and the results show that the enzyme activity and expression level of the single-site mutant obtained by performing N563T single-site mutation on the tobacco-derived α-glucan phosphorylase 5CC5 with an amino acid sequence shown in SEQ ID No.1 are significantly higher than those of the wild-type α-glucan phosphorylase.

[0025] Definitions of terms used in this invention

[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods, devices and materials are now described.

[0027] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioates, phosphoramidates, etc.). Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including but not limited to degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences. In particular, degenerate codon substitutions ( Mol Cell. Probes 8:91-98 (1994)).

[0028] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. That is, a description directed to a polypeptide is equally applicable to describing a peptide and describing a protein, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the terms encompass amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0029] The terms "mutation" and "mutant" have their ordinary meanings herein and refer to genetic, naturally occurring or introduced changes in nucleic acid or polypeptide sequences, and their meanings are the same as those generally known to those skilled in the art.

[0030] The term "recombinant host cell strain" or "host cell" means a cell comprising a polynucleotide of the invention, regardless of the method used for insertion to produce a recombinant host cell, such as direct uptake, transduction, f-mating, or other methods known in the art. The exogenous polynucleotide may be maintained as a non-integrating vector such as a plasmid or may be integrated into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell.

[0031] The term "operably linked" refers to a functional connection between two or more elements. The operably linked elements may be contiguous or non-contiguous.

[0032] The term "transformation" refers to the genetic transfer of a polynucleotide or polypeptide into a host cell in such a way that the encoding gene is introduced into the interior of the host cell.

[0033] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a host cell. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The mining and screening process of the novel α-glucan phosphorylase (αGP-5CC5) from tobacco; (a) The mining process of the novel αGP-5CC5; (b) The dendrogram of 50 core similar sequences of αGP.

[0035] Figure 2 Expression and purification results of the novel αGP-5CC5 derived from tobacco; (a) Principle of binding of mini-scaffoldin to αGP-5CC5; (b) SDS-PAGE electrophoresis of bound and purified αGP-5CC5; (c) Concentration of purified αGP-5CC5 protein.

[0036] Figure 3 The starch synthesis function verification results of the new tobacco-derived αGP-5CC5.

[0037] Figure 4 The results of catalytic activity assay of single-site mutants of novel αGP-5CC5 derived from tobacco.

[0038] Figure 5 The results of the starch synthesis ability test of the single-site mutant of the novel αGP-5CC5 derived from tobacco. DETAILED DESCRIPTION

[0039] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0040] Experimental Example 1: Mining, expression and functional identification of α-glucan phosphorylase (αGP), a key enzyme in artificial starch biosynthesis

[0041] 1 Gene discovery of novel αGP

[0042] Derived from Solanum tuberosumThe full-length amino acid sequence of α-glucan phosphorylase (PGP) from the UniParc database was used as a template and jackhammer was used to search in the UniParc database, and a total of 61,661 similar sequences were screened. The study found that among the αGP proteins from different species, only PGP can cooperate with cellobiose phosphorylase (CBP) to synthesize amylose from cellobiose. By searching the PGP sequence in the protein database of various model species from bacteria to humans and comparing these sequences using the Basic Local Alignment Search Tool (BLAST), it was shown that in all αGP sequences, the residues related to substrate binding and catalysis are quite conserved in various species. Phylogenetic analysis showed that these αGP enzymes evolved from a common ancestor, and the enzymes of primitive plants remained relatively stable during evolution. By constructing homologous structural models for all αGPs, it was observed that PGP has a special cap (CAP) region at its catalytic site, which is missing in all bacterial αGPs and other plant αGPs that cannot synthesize starch (such as corn and Arabidopsis).

[0043] Then, two PGP mutants were designed through experiments: one with part of the Cap region sequence removed, and the other with the Cap region sequence completely removed. The experiment found that the partially decapped PGP had reduced starch synthesis ability compared with the wild type, while the completely decapped PGP completely lost this ability. Therefore, it is speculated that the Cap region on the catalytic site of PGP is closely related to the function of catalyzing G-1-P to synthesize starch, so this Cap sequence was used to continue screening, and finally 50 core similar sequences containing the Cap region were obtained, belonging to four species: potato, wolfberry, tobacco and pepper ( Figure 1 ).

[0044] The expression prediction software (MPEPE) is a deep learning classifier for screening high-expression and low-expression proteins independently constructed by the inventor's research group using the expression data of 6438 heterologous proteins under the same expression conditions. Since these proteins come from different developmental systems, the changes in codon usage frequency in organisms from different sources can provide a wide range of codon and amino acid sampling spaces. The model can be combined with conservative residue analysis to minimize functional disruptions, thereby virtually screening mutation sites that may make a positive contribution to protein expression but do not destroy its function. This experiment used this model to predict the expression of 50 sequences of these four species, and finally selected 5 sequences that were predicted to have a greater probability of high expression from the 50 sequences of wolfberry, tobacco and pepper, and named them 2969, 09B0, BACF, 5CC5 and 4C66 respectively.

[0045] Among them, 5CC5 is tobacco ( Nicotiana tabacum L) derived from a novel α-glucan phosphorylase, the amino acid sequence of which is shown in SEQ ID No.1:

[0046] >(SEQ ID No. 1).

[0047] 2 Heterologous expression and purification of novel αGP

[0048] The expression vectors pET30a-2969, pET30a-09B0, pET30a-BACF, pET30a-5CC5 and pET30a-4C66 of the above five genes were constructed, transformed into competent E. coli BL21 (DE3) cells, spread on plates, and cultured overnight to grow monoclonal colonies. Pick a single colony and culture it in 10 mL LB medium overnight (12-16 h), inoculate it into 500 mL LB medium at a 1% (v / v) inoculum, and culture it at 37°C and 220 r / min until OD 600 The induction agent IPTG (final concentration of 0.1 mmol / L) was added and induced at 16°C for 18-20 h. After induction, the induction was continued at 8000 r / min, 4 o C high-speed centrifuge to collect the cells and remove the supernatant.

[0049] Next, the cells were resuspended and washed twice in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer at pH 7.2 to remove the residual LB components. -1 Resuspend the cells in HEPES buffer (pH 7.2) with CaCl2 to a concentration of OD 600 10. After using ultrasound to lyse the bacteria, use 12000 r / min, 4 o C high-speed centrifuge to collect the soluble crude enzyme solution in the supernatant.

[0050] Since CBM3 domain proteins can be tightly bound to the cellulose surface due to the high affinity adsorption of CBM3 on the cellulose surface, CBM3 domain proteins or complexes bound to cellulose can be separated from aqueous solutions by high-speed centrifugation. In previous experiments, a recombinant protein, mini-scaffoldin, was expressed by Escherichia coli BL21 (DE3). The synthetic protein mini-scaffoldin contains a CBM3 domain and three different binding modules CipA, CbpA and ScaB. Due to the high affinity interaction between the binding module and dockerin, only a dockerin sequence matching the binding module needs to be added to the front end of PGP to enable PGP and mini-scaffoldin to assemble into an enzyme complex. This complex can be well adsorbed to regenerated amorphous cellulose (RAC) through the CBM3 domain of mini-scaffoldin, and finally the protein in the crude enzyme solution can be selectively recovered by high-speed centrifugation. Therefore, these five new αGPs also added a corresponding dockerin domain during gene synthesis, so they can bind to mini-scaffoldin like PGP to achieve the effect of simple purification of crude enzyme solution ( Figure 2 a, Figure 2 b). Because the module and dockerin are connected through Ca 2+ The precipitate of microcrystalline cellulose and enzyme complex was resuspended with an appropriate volume of 0.5 mol EDTA and then centrifuged to dissociate mini-scaffoldin from αGP. Since the adsorption of mini-scaffoldin to microcrystalline cellulose was not affected, the precipitate after centrifugation was microcrystalline cellulose and mini-scaffoldin, and the supernatant was αGP protein. The concentration of αGP protein in the supernatant was determined by Bradford method using bovine serum albumin as the standard ( Figure 2 c).

[0051] 3 Functional identification of novel αGP

[0052] In the synthesis reaction, maltodextrin and glucose-1-phosphate (G-1-P) were used as substrates, and the activity of αGP was determined by measuring the amount of Pi released from G-1-P.

[0053] The 200 μl reaction mixture included 50 μL of 2% (w / v) maltodextrin, 50 μl of 160 mM G-1-P, 50 μl of 200 mM sodium acetate buffer (pH 5.5), and 50 μl of the same amount of diluted αGP protein. The mixture was incubated at 37°C for 15 minutes. The reaction was terminated by adding 2 mL of molybdate reagent (15 mM ammonium molybdate, 100 mM zinc acetate [pH 5.0]), followed by the addition of 500 μl of ascorbic acid reagent (10% [w / v], pH 5.0) and incubation at 30°C for 15 minutes. Finally, the absorbance was measured at 850 nm, and one unit of αGP was defined as the amount of enzyme that produces 1 μmol of phosphate per minute.

[0054] The function of the novel αGP and CBP in synthesizing starch was verified by using cellobiose as the raw material. The reaction system of 100 μl contained 15 μl 100 mM phosphate buffer, 1 μL 10 mM maltotetraose, 5 μl 100 mM magnesium chloride, 20 μl 300 mM cellobiose and 50 μl RAC-enzyme complex. o C for 8 h, and use iodine solution to test whether starch is produced.

[0055] According to the test results, in this reaction system, the enzyme complex of PGP and CBP can directly synthesize starch using cellobiose as a substrate. Therefore, if iodine solution is added after a period of reaction to detect the production of starch, it can be proved that this new αGP has the function of synthesizing starch. Among the six αGPs, only 09B0 from the Lycium genus has no starch synthesis function, while the other five αGPs have starch synthesis function ( Figure 3 ).

[0056] Experimental Example 2 Design, Screening, Expression and Enzymatic Performance Determination of a Novel Tobacco-derived α-glucan phosphorylase 5CC5 Mutant

[0057] 1 Rational design of a novel tobacco-derived α-glucan phosphorylase 5CC5 mutant

[0058] Since the CAP region mentioned in Experimental Example 1 is closely related to the function of αGP to catalyze G-1-P to synthesize starch, the 50 core sequences obtained by screening were used as the basis for the conservative site and entropy value analysis of PSAP on the wild-type αGP-5cc5 protein gene from tobacco with starch synthesis function.

[0059] First, 50 similar protein sequences were aligned with the wild type of αGP-5CC5 (SEQ ID NO. 1) and spliced ​​to the same length. Then, the probabilities of 20 amino acids at each position were calculated to form a position-specific amino acid probability (PSAP) matrix to determine the conservation of amino acids at each position. The PSAP calculation tool was then used to determine the entropy of each residue. In theory, sites with higher entropy values ​​are more likely to mutate.

[0060] Based on the comprehensive consideration of conservation and entropy values ​​in the Cap region of 5CC5, nine single-point mutations with conservation scores higher than 0.8 and high entropy values ​​were selected, namely S524H, V529A, V530S, E535V, S538N, N541D, E545K, N563T, and M576K.

[0061] 2 Construction, expression and purification of mutants

[0062] Designed mutagenesis primer pairs 5cc5 The gene was amplified and transformed into E. coli top10 competent cells. After the positive clones were verified by colony PCR, the plasmids were extracted and further sequenced. The mutant plasmids that were verified to be correct by sequencing were transformed into E. coli BL21 (DE3). After screening for positive clones, a single colony was picked and cultured in 10 mL LB medium overnight (12-16 h). It was inoculated into 500 mL LB medium at a 1% (volume fraction) inoculation rate and cultured at 37°C and 220 r / min until OD 600 The concentration of IPTG was 0.6-0.8, and the inducer IPTG (final concentration was 0.1 mmol / L) was added. The induction was carried out at 16°C for 18-20 h. After the induction was completed, the bacteria were collected using a high-speed centrifuge at 8000 r / min and 4°C, and the supernatant was removed.

[0063] Next, the cells were resuspended and washed twice in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer at pH 7.2 to remove the residual LB components. -1 Resuspend the cells in HEPES buffer (pH 7.2) with CaCl2 to a concentration of OD 600 The value is 10. After the bacteria are lysed by ultrasound, the soluble crude enzyme solution in the supernatant is collected by high-speed centrifuge at 12000 r / min and 4°C.

[0064] The 5CC5 wild type and mutants were simply purified by regenerated amorphous cellulose (RAC) and mini-scaffoldin using the same purification method as in Experimental Example 1. After purification, they were dissociated using EDTA and their concentrations were measured using the same method.

[0065] 3 Functional characterization of mutants

[0066] The activity of wild type and mutants was determined by measuring the amount of Pi released from G-1-P using maltodextrin and G-1-P as substrates, and one unit of αGP was defined as the amount of enzyme that produces 1 μmol of phosphate per minute. Based on the analysis of the PSAP conserved sites of 50 core sequences of 5CC5, this experiment designed 9 single-site mutants (S524H, V529A, V530S, E535V, S538N, N541D, E545K, N563T, M576K) based on the particularity of the CAP region of 5CC5 and successfully expressed them in Escherichia coli BL21 (DE3).

[0067] The results of enzyme activity assay showed that the enzyme activities of multiple single-point mutants after transformation, especially the three single-point mutants S524H, E535V or N563T, were significantly higher than those of wild-type αGP-5CC5 ( Figure 4 ), which not only proves the importance of the CAP area, but also proves that 5CC5 has a high transformation potential.

[0068] 4 Identification of starch synthesis ability of αGP-5CC5 mutant

[0069] Cellobiose was used as a substrate to verify the function of αGP-5CC5 mutant and CBP in synthesizing starch: 100 μl of the reaction system contained 15 μl of 100 mM phosphate buffer, 1 μL of 10 mM maltotetraose, 5 μl of 100 mM magnesium chloride, 20 μl of 300 mM cellobiose and 50 μl of RAC-enzyme complex at 40 °C. o C for 8 h, and the starch yield was detected.

[0070] The experimental results showed that the starch synthesis ability of the single-site mutants S524H, E535V, and N563T of αGP-5CC5 was significantly improved compared with the wild-type αGP-5CC5 protein and PGP ( Figure 5 ).

[0071] The amino acid sequence of the single-site mutant N563T of αGP-5CC5 is shown in SEQ ID No. 2:

[0072] >(SEQ ID No. 2).

Claims

1. A single-site mutant of α-glucan phosphorylase 5CC5, characterized in that Its amino acid sequence is shown in SEQ ID No.

2.

2. A gene encoding the single-site mutant according to claim 1.

3. A recombinant expression vector containing the coding gene according to claim 2.

4. A recombinant host cell containing the recombinant expression vector according to claim 3.

5. A method for preparing the single-site mutant of α-glucan phosphorylase 5CC5 according to claim 1, characterized in that: include: (1) The coding gene described in claim 2 is operably connected to an expression control element to construct a recombinant expression vector; (2) The recombinant expression vector is transformed into host cells, the host cells are cultured, the recombinant protein is induced to express, and then purified.

6. The method according to claim 5, characterized in that In step (1), a dockerin sequence is added to the front end of the coding gene described in claim 2 and then connected to the expression regulatory element to construct a recombinant prokaryotic expression vector; the nucleotide sequence of the dockerin sequence is shown in SEQ ID No.

3.

7. The method according to claim 5, characterized in that The purification method described in step (2) is as follows: adding microcrystalline cellulose to the crude enzyme solution product induced to express in the host cells and then centrifuging, collecting the precipitate, resuspending it with 0.5 mol EDTA and centrifuging it again, and taking the supernatant to obtain the purified protein.

8. Use of the single-site mutant according to claim 1 in the synthesis of starch.

9. Use of the encoding gene according to claim 2, the recombinant expression vector according to claim 3 or the recombinant host cell according to claim 4 in the synthesis of starch.

10. The use according to claim 8, characterized in that: include: Starch is obtained by carrying out an enzymatic bioconversion reaction using cellobiose as a substrate and the single-site mutant described in claim 1 as a converting enzyme; wherein the converting enzyme also contains cellobiose phosphorylase.

Images