Application of OsPTST1 gene in improvement of plant nitrogen utilization efficiency and yield increase

Abstract

The invention discloses application of a rice OsPTST1 gene in improvement of the nitrogen utilization efficiency and yield increase of plants, and relates to the technical field of gene engineering. According to the invention, a ptst1 mutant plant and an OE-PTST1 overexpression plant are respectively obtained through CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated protein 9) and an overexpression technology. Experiments further prove that compared with wild rice, the ptst1 mutant has the advantages that the plant grain length and thousand grain weight are remarkably increased, the yield of a single plant is increased, and the nitrogen utilization efficiency is improved; the grain length, the grain width and the thousand grain weight of the OE-PTST1 plant are obviously reduced, the yield is reduced, and the nitrogen utilization efficiency is reduced. Therefore, the OsPTST1 can regulate and control the rice yield and the nitrogen utilization efficiency, and a foundation is laid for cultivating a new rice variety with high yield and high nitrogen utilization efficiency.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and more specifically to the application of OsPTST1 gene in improving plant nitrogen utilization efficiency and increasing yield. Background Art

[0002] As one of the most important food crops, rice accounts for about 40% of the country's total grain production. With the increase in population and the reduction in arable land, the demand for food will continue to increase in the future.

[0003] On the other hand, nitrogen is one of the essential mineral nutrients for plants and plays an important role in promoting plant growth and development, promoting the synthesis of plant protein and chlorophyll, and increasing crop yields. However, in agricultural production, in order to overcome the low nitrogen utilization rate and increase food production, a large amount of inorganic nitrogen fertilizers are widely used, and the nitrogen fertilizers that are not absorbed and utilized are lost to the air, water or soil, leading to excessive greenhouse gas emissions, eutrophication of surface water, soil acidification and other problems that damage the ecological environment. At the same time, excessive use of nitrogen fertilizers will also have a negative impact on crop growth, such as reducing stress resistance, easy lodging, quality decline and inhibiting root growth.

[0004] Therefore, reducing the use of nitrogen fertilizers in agricultural production, discovering key genes that regulate nitrogen absorption and utilization, improving nitrogen utilization efficiency, and cultivating new nitrogen-efficient crop varieties are one of the important biological ways to ensure high yield, high quality and stability of crops. Researching, developing and promoting nitrogen-efficient rice varieties is also one of the future development trends of the rice planting industry.

[0005] How to increase rice yield, reduce the use of chemical fertilizers, and achieve "reducing weight and increasing production" is an urgent problem that technicians in this field need to solve. Summary of the invention

[0006] In view of this, the present invention provides the use of OsPTST1 gene in improving plant nitrogen utilization efficiency and increasing yield.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] Application of knocking out the OsPTST1 gene in plant breeding, the application being any one of the following:

[0009] A. Improve the nitrogen utilization efficiency of plants;

[0010] B. Increase grain length;

[0011] C. Increase production;

[0012] The nucleotide sequence of the OsPTST1 gene is shown in SEQ ID NO.1.

[0013] Preferably, the CDS nucleotide sequence of the OsPTST1 gene is as shown in SEQ ID NO.2.

[0014] Another object of the present invention is to provide a biological material for knocking out the above-mentioned OsPTST1 gene in plant breeding, wherein the biological material is any one of the following:

[0015] A. Expression cassette capable of knocking out the OsPTST1 gene;

[0016] B. A recombinant vector containing the expression cassette described in A;

[0017] C. A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

[0018] Another object of the present invention is to provide a gene encoding a rice mutant ptst1-1, characterized in that the gene encoding the mutant has a deletion of the A base at position 829 of the nucleotide sequence shown in SEQ ID NO.1.

[0019] Another object of the present invention is to provide a gene encoding a rice mutant ptst1-2, characterized in that an A base is inserted into the gene encoding the mutant at position 821 of the nucleotide sequence shown in SEQ ID NO.1.

[0020] Another object of the present invention is to provide an application of the coding gene of the above mutant in plant breeding, wherein the application is any one of the following:

[0021] A. Improve the nitrogen utilization efficiency of plants;

[0022] B. Increase grain length;

[0023] C. Increase production.

[0024] Another object of the present invention is to provide a biological material containing the gene encoding the mutant, wherein the biological material is an expression cassette, an expression vector, a cloning vector and / or a recombinant microorganism.

[0025] Another object of the present invention is to provide the use of the above-mentioned biological material in plant breeding, wherein the use is any one of the following:

[0026] A. Improve the nitrogen utilization efficiency of plants;

[0027] B. Increase grain length;

[0028] C. Increase production.

[0029] Another object of the present invention is to provide a method for site-directed mutagenesis of the OsPTST1 gene using the CRISPR / Cas9 system, designing a CRISPR / Cas9-based sgRNA sequence for the target gene, connecting a DNA fragment encoding the sgRNA sequence to a vector carrying CRISPR / Cas, and transforming rice to achieve site-directed mutagenesis of rice OsPTST1;

[0030] The nucleotide sequence of the sgRNA action site is shown in SEQ ID NO.3.

[0031] Beneficial effects: The present invention discloses the application of the rice gene OsPTST1 in improving nitrogen utilization efficiency and increasing rice grain length and yield. The present invention obtains ptst1 mutant plants and OE-PTST1 overexpression plants by CRISPR-Cas9 and overexpression technology, respectively. It is further proved by experiments that: compared with wild-type rice, the grain length and 1000-grain weight of ptst1 mutant plants are significantly increased, the yield per plant is increased, and the nitrogen utilization efficiency is improved; the grain length, grain width and 1000-grain weight of OE-PTST1 plants are significantly reduced, the yield is reduced, and the nitrogen utilization efficiency is reduced. It shows that OsPTST1 can regulate rice yield and nitrogen utilization efficiency, laying the foundation for breeding new rice varieties with high yield and high nitrogen utilization efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0033] Figure 1 The attached figure shows the engineering vector pYLCRISPR / CAS9P ubi -H plasmid map.

[0034] Figure 2 The attached figure shows the structure of the OsPTST1 gene, the mutation sites and the mutation types of the mutants.

[0035] Figure 3 The attached figure is a plasmid map of the overexpression vector pU1301.

[0036] Figure 4 The attached figure shows the expression analysis of OsPTST1 gene in mutants and overexpression plants.

[0037] Figure 5 The attached figure shows the expression analysis of OsPTST1 gene in different rice tissues.

[0038] Figure 6 The attached figure shows the expression of OsPTST1 gene in proOsPTST1::OsPTST1-GUS transformed plants.

[0039] Figure 7 The attached figures show the phenotypes and ten-grain lengths of OsPTST1 mutant and overexpressing rice lines.

[0040] Figure 8 The attached figure shows the statistical data of agronomic traits of OsPTST1 mutants and overexpression strains; A is grain width, B is grain length, C is thousand-grain weight, and D is single plant yield.

[0041] Fig. 9 The attached figure shows the analysis and comparison of nitrogen utilization efficiency (NUE) of the OsPTST1 gene in mutant plants and overexpression plants. DETAILED DESCRIPTION

[0042] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0043] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0044] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0045] Example 1 Construction of CRISPR-Cas9 vector for rice OsPTST1 gene

[0046] According to the OsPTST1 gene sequence (such as SEQ ID No. 1, SEQ ID No. 2) published on the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / ), a suitable target sequence (such as SEQ ID No. 3) was selected, and primers gRNA-Os PTST1-F (such as SEQ ID No. 4) and gRNA-OsPTST1-R (such as SEQ ID No. 5) were designed.

[0047] The primer pair gRNA-OsPTST1-F / R was denatured and annealed to obtain the dimer product of gRNA-OsPTST1-F / R. The dimer product of gRNA-OsPTST1-F / R was connected to the pYLgRNA-U3 vector to obtain an intermediate vector. Then, according to the steps in the reference: MaX, Zhang Q, Zhu Q, et al. A Robust CRISPR / Cas9 System for Convenient, High Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant. 2015; 8(8): 1274-1284., the intermediate vector was connected to the pYLCRISPR / Cas9-MH final vector using the side-by-side ligation method to obtain the single-target OsPTST1 CRISPR / Cas9 gene editing vector. After the vector was successfully constructed, the callus tissue of Zhonghua 11 was finally transformed by Agrobacterium-mediated transformation to obtain the T0 generation transgenic plants (see Appendix Figure 1 The rice genetic transformation system mediated by Agrobacterium was based on the method reported by Hiei et al. (Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. The Plant Journal, 1994). The ptst1 mutant plants ptst1-1 and ptst1-2 were obtained (the structure and mutation site of OsPTST1 gene are shown in the attached Figure 2 The gene expression levels of the mutants are shown in the Appendix Figure 4 ).

[0048] The nucleotide sequence of rice OsPTST1 gene is as follows:

[0049] AAGAGCACAAGAGTGCACGAAGACGAGACGAGAGCGAGCTGTTCATCCT

[0050] CCCACTCCACCTCGGAGCTGAGCTCTGCTTCTCTCCCGATCTCTCCACCCA

[0051] CCGCAGCAGCATCCTTTCGACCTCTCTAGGGTTCCAGCCTCGAGTTGGCCT

[0052] CGTCCCCCCCCCCCCCCCCCCACATTCGCTGCGAGGTTGCTGCTCGCTTCA

[0053] CTTGTCTTCGGTTTGATTTCCCCCCACCTAACTGATTCTGATTGATACGGCT

[0054] CGGCTCGTGTGTGCGGCTCACTTAGGTTTGGGATTCTCTTCCGGATTGGAT

[0055] TGGTGGAGTGGCAGGGAATTGTTAGTTCTGGTGTGGTTTGTGGTTAAGAG

[0056] AAGGGGTGAGGTTCTTGCTGCCGTGTATCTGTACTGATTCCTTTTGCATAG

[0057] TTGTTTTTTTTTCTTTTCGTGTATACTGTTATCTGCTACTGTATGAGAGACT

[0058] TATGTTTTGGCTAATGTTCTCGATTGGAAGCTATGAAAATGTAATTTTGAT

[0059] CTATCTTATTTCCTATTTTTGTTCAGGGAAATAGCTATGGAGTGTCTGACC

[0060] ACAAGTTTTACTAGGTAAGTTATTCTCTTGATTGTGCAATATTATTATTCA

[0061] GATATAGAATACTCCAACATGAACAGCATGTATGTATGATCTATTGATATT

[0062] GTCCGTAATCTGATTTTAGCTTGGTAAGTTAGTTAATCCCCGTACGACTTT

[0063] CAGAATTCCCCATGCCCTGTTGAAACCACATCCAGAATGCATAGTTCTTCT

[0064] TTTACCCCCCTTTTATCATTACTTTAACATGGTTAGGTGATGTTTTTGGTGA

[0065] AGGAATCCGGGAAGGGAGTATAATCTCATATGTCCGAGCGAAGCTCTGTC

[0066] TGAAAAACAAAGGATTCAAAGAAGGGTTCTATGCTATTTTCCAGCTTCCA

[0067] CAAACTCAAGACGATGTCGCAAGTTCACAACTATGGCATATCCTGTTAGC

[0068] CCAATAGCTGGCAGACGTTCAAATTGGAGATCTTTTGCTGCAAGTCTGAA

[0069] TTTGGAAGATGGTCCTGCATCCTCTGACTCAACATCATCCCCTTCAGAGCA

[0070] AACTAGTGATGGTGGTGAAGTTTATGGTGACCCTTCTGAAAATCTGAATTC

[0071] TCGGAAACTTAAATCTGACGAGGTATCATATCATCCAATTGTGTATTGTTT

[0072] CACCCATGCAGTTTTTTTTCTTTGCCAGGACGGCGGAAGGACACGCCGTCC

[0073] GAAATTCATTAGATTTTAAAAGGAGTACAGTACAAATAGCTTGGCAAACC

[0074] CGTGCAGCTTATCACTCTGCATTCCTGTACCATATGTCACTCAAAGATTAG

[0075] CAGAGCCAGCATTTCAATTCCTCCAATGAGTTCACTATAAATGATCTCTAC

[0076] TTTCAAGGCATACCTCACGTTATTATACTTTCCTGCATAAATCTTTCAGTCC

[0077] ATTTTTAGGAGTTATTGTTTGTATTTGTCAAATATTAGGTCAACAGGGGGT

[0078] TTTAATGTAGCATCTGCGTAAGAGAAATATGTATCTGTATGATATCTATG

[0079] TGGTCTTATTCCCTAGCAGCTAAGACAGCTTAAGGAGATATTCTCCTTAAC

[0080] CCTTATAATCATAAGTATTAGAGAGTGACCTCCTTCAGAAATGAACTCAA

[0081] CAGAGAAATGGCAAACTTGATTGTAGCTCTAACAGTTGATGTTCGGTTCG

[0082] TAGATCGCACTTGAAAGATTGATACTTCCAAAGTACAAAGAACAACGTTG

[0083] CAACTTGGTCTTTTTTTTTCTTTTCGATTAGCAACCTACAGACACTAGCAT

[0084] TATTTTATATATGACTAATGTTGTGCTTCTCTTTTTTATTTTGGCATGCAGTT

[0085] GAAATCTCTTTTGGCTGATTCAGAACGATCTAAGCTTTTGAAAGGCTTAG

[0086] TGAAGCAAACCAATACAACCGGTTCCTCAAGAGACAGGTTCTATTATTGT

[0087] ACCTTTTTCCAAAGTGTTCATTGAATTGCATCATATATACTGTTCACAATT

[0088] ATCAGCAAATAACATAATACAGAATTGTTCATACTGAATAGCTTTCTATTA

[0089] TCTGCGACTTGAACTTTATGCTTTCTACTGAAGATAGCCGCCTAGACGTTTT

[0090] GTAAAATGAAAAACAATTACTCTGTCCAGGCACTGTATTTGCTGTCATGAT

[0091] GCAAGTCAGCAAGAACTAGCAATTTTGTTCAGTCAGGATCGAATAGAATA

[0092] TAGAACTCCCCTTTTACTTGTAGATTACTGTGTTGATTCACTTTATGCTAC

[0093] GCACTATATCGCCAGAAAAATTACATTTTTTTTATAAAAAATCTATAATGC

[0094] ATTTTGTAGTACAAATGTATTTAAATATTCCTAACGAATCCAGGACTTTGA

[0095] ACTACTGAAAGTATCTTAGGATATTTTTCTTTAAAAAATCATTCATGAACT

[0096] AGTTTGCTAAATTGAAGCTTCTTTTGCATCAGATGAATATTTTTGTGAGAT

[0097] TACATTTTTTTTGTATAAATAGCTGTCCATACAGAGTTGTGGTTATGTCAA

[0098] ATATGCACAATTCCATTTCTCTTATTAAGCACTGAATCATTGCTAACTAGA

[0099] TAGAAATGTACTATTTCTTGCAGTTGCAAATGAAGGATAATGACGTTGTG

[0100] AAGTTCAAGAGTGAACTTGCCGTTATGGAACTTGAACTGCAGGTTAGCTC

[0101] TAACAGACTTTTCTTGTTTCATAGTTCAATCATAAGCCCTTTGGGGGACAGG

[0102] GGATGCTATCAACATGCCTTTAACTCATCTAGCATCTTGAGAATTCATTCA

[0103] TAACTTCATGTTTCCTTTTCCATAAAGATATCAGACTGTAAATACATGAAT

[0104] GAAGTATGTCTGGCTTCCTCTAAAGGATTGTATGATTTTGTATGCCTCTGT

[0105] ACTTTGTCTCCCCTAGGACTGGCTTTAAATCAATATATTTTGTTTCTTGGTT

[0106] TTGTTCAAACTTTTATCAGTGATCAGTATTGTTGATACTGTTACTCTAAATG

[0107] TATTTACATTTTGTATGTATTCACTGTTTCTTTATGTCCACAGGCTCTGGTT

[0108] GCCCTAGCTGAAGAGATTGCTAATTTTGATGTTCCATCTGGGTCTAGGAAG

[0109] ATAAATGGAAAATATATCCAGTCACATCTTCTCACCAGATTAGAAGGTTA

[0110] TCTCTATCACAATGCTCCAAGTTGAATTAACAATGAAATTTTCTGACGAAA

[0111] TGTTTGTTTCCTATAGCTGTTCATGATAAGGTTATGGAACAAAATTAAGGAT

[0112] GTAGACTCTTTAAAGCACCAAGAAAATTTCTGTCTTCTGGGTTGGCATTGCT

[0113] GAGGTAAAACAAGGTTTTTGACTTAACTCGTTATATGGAACAGAACTATT

[0114] GTCATATATCTACAGCTATCATTTATGTCCTCTATTGTTCTTCATTGGTTTT

[0115] TTGTCTGCACATCAGAATGTACAAATTATGGGCTCCTTCGATGGCTGGTCC

[0116] CAGGGAGAGGCAATGTCCATGGAGTATTCAGGTTACCAAGCAAGATTCTC

[0117] TGCAACTCTGAATCTTAGACCTGGGAGGTGTGTTTTGTGAATTCTGCAGAG

[0118] CGATCTGATTTGCTATGATTTATTTATTAACTAAACAATCTCACTTATCTGT

[0119] TTGTATGCAAAATAAAGGTATGAGATCAAATTCTTGGTTGATGGAGAGTG

[0120] GAGGCTGTCACTGGAGTACCCAATTGATGGCGAAGGTTCAATGCAGAACA

[0121] ATATACTTGTTGTAAATTAATGTAGATATCTGTTGGCTCCTAGTTTGCCAT

[0122] AGTTGTAACTTGCAGCTATAAAACCTAGCGCAAGATTGAACTGTACTCGA

[0123] TTGCTATCATGCATCCGATTTGCAAAATTTCACTTTACCATGAAATGCAAG

[0124] GCCTTTTTTTCCTGGTTGGA; SEQ ID No.1。

[0125] The nucleotide sequence of the CDS of the rice OsPTST1 gene is as follows:

[0126] ATGGAGTGTCTGACCACAAGTTTTACTAGGAATCCGGGAAGGGAGTATAA

[0127] TCTCATATGTCCGAGCGAAGCTCTGTCTGAAAAACAAAGGATTCAAAGAA

[0128] GGGTTCTATGCTATTTTCCAGCTTCCACAAACTCAAGACGATGTCGCAAGT

[0129] TCACAACTATGGCATATCCTGTTAGCCCAATAGCTGGCAGACGTTCAAATT

[0130] GGAGATCTTTTGCTGCAAGTCTGAATTTGGAAGATGGTCCTGCATCCTCTG

[0131] ACTCAACATCATCCCCTTCAGAGCAAACTAGTGATGGTGGTGAAGTTTAT

[0132] GGTGACCCTTCTGAAAATCTGAATTCTCGGAAACTTAAATCTGACGAGTT

[0133] GAAATCTCTTTTGGCTGATTCAGAACGATCTAAGCTTTTGAAAAAGCTTAG

[0134] TGAAGCAAACCAATACAACCGGTTCCTCAAGAGACAGTTGCAAATGAAG

[0135] GATAATGACGTTGTGAAGTTCAAGAGTGAACTTGCCGTTATGGAACTTGA

[0136] ACTGCAGGCTCTGGTTGCCCTAGCTGAAGAGATTGCTAATTTTGATGTTCC

[0137] ATCTGGGTCTAGGAAGATAAATGGAAAATATATCCAGTCACATCTTCTCA

[0138] CCAGATTAGAAGCTGTTCATGATAAGGTTATGGAACAAATTAAGGATGTA

[0139] GACTCTTTAAAGCACCAAGAAATTTCTGTCTTCTGGGTTGGCATTGCTGAG

[0140] AATGTACAAATTATGGGCTCCTTCGATGGCTGGTCCCAGGGAGAGGCAAT

[0141] GTCCATGGAGTATTCAGGTTACCAAGCAAGATTCTCTGCAACTCTGAATCT

[0142] TAGACCTGGGAGGTATGAGATCAAATTCTTGGTTGATGGAGAGTGGAGGC

[0143] TGTCACTGGAGTACCCAATTGATGGCGAAGGTTCAATGCAGAACAATATA

[0144] CTTGTTGTAAATTAA; SEQ ID No. 2.

[0145] PAM

[0146] CRISPR / cas9 target site:TGGTGAAGGAATCCGGGAA GGG ; SEQ ID No.3;

[0147] The adapter primer pair containing the target sequence has the following sequence:

[0148] gRNA-OsPTST1-F: ggcaTGGTGAAGGAATCCGGGAA; SEQ ID

[0149] No.4;

[0150] gRNA-OsPTST1-R: aaacTTCCCGGATTCCTTCACCA; SEQ ID No. 5.

[0151] Example 2 Construction of Rice OsPTST1 Gene Overexpression Vector

[0152] Primers OE-PTST1-F (such as SEQ ID No. 6) and OE-PTST1-R (such as SEQ ID No. 7) were designed based on the OsPTST1 gene sequence (such as SEQ ID No. 1) published on the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / ), and NIP cDNA was used as a template (since the sequencing was completed using rice NIP as the background material). The restriction sites KpnI and BamHI were designed on the primers, respectively, to amplify the full length of the cDNA of the target gene from the start codon to the stop codon (such as SEQ ID No. 2). The target fragment purified after KpnI and BamHI digestion was connected to the pU1301 vector after the same digestion by double cutting and double ligation (see Appendix). Figure 3) (Construction method as Jian, Zhang, Babi, et al. OsMADS6 plays an essential role in endosperm nutrient accumulation and is subject to epigenetic regulation in rice (Oryza sativa) [J]. The Plant Journal, 2010). Thaw the competent E. coli DH5ɑ on ice, add the ligation product to the competent cells, flick the tube wall to mix, and place on ice for 30 minutes; heat shock in a 42°C water bath for 45 seconds, and immediately place on ice to cool for 3-5 minutes; add 700 μL of LB (Luria-Bertani) culture medium without antibiotics, and shake the bacteria on a shaker at 37°C for 45 minutes; centrifuge at 4000 rpm for 1 minute, discard about 500 μL of supernatant, resuspend the remaining bacteria, spread on the corresponding resistance LB solid plate, and invert and culture in a 37°C incubator for 13-16 hours. After a single colony was grown, positive engineering bacteria were identified and screened, and a kit (Shanghai Yisheng, 19001ES50) was used to extract the plasmid to obtain the PU1301-OsPTST1 overexpression vector, which was sequenced and identified as correct. After the vector was successfully constructed, genetic transformation was further performed to obtain OE-OsPTST1 overexpression plants (the gene expression level is shown in the attached Figure 4 ).

[0153] OE-PTST1-F:TTACTTCTGCACTAGGTACCTCAACATCATCC CCTTCAG; SEQ ID No. 6;

[0154] OE-PTST1-R: TCCTCTTAGAATTCCCGGGGATTAATTTACAA CAAGTATA; SEQ ID No. 7.

[0155] Example 3 Quantitative expression analysis of rice OsPTST1 gene in various tissues of rice NIP

[0156] The cDNA was obtained by extracting and reverse-transcribing the sample RNA, and the expression level of the OsPTST1 gene was detected by qRT-PCR. The specific method is as follows:

[0157] RNA was extracted from fresh leaf samples of wild-type rice ZH11, NIP, mutant plant ptst1, and overexpression plant OE-OsPTST1 using the Trizol method. cDNA was synthesized using the First Strand cDNA Synthesis Kit Rever Tra Ace-ɑ from TOYOBO. The synthesized first-strand cDNA was diluted to 50 μL with DEPC·H2O for molecular experiments such as cloning. Real-time fluorescence quantitative qPCR (quantitative PCR) reactions were performed using Hieff Power qPCR SYBR Green MasterMix.

[0158] The 10μL system includes: 1μL cDNA, 5μL SYBR Green MasterMix, 0.2μL 10μM Primer F (forward), 0.2μL 10μM Primer R (reverse), 3.6μL ddH2O.

[0159] The amplification program was: 95°C for 3 mins, 95°C for 10 s, 60°C for 30 s, 72°C for 15 s, 40 cycles, performed in a fluorescence quantitative PCR instrument. The Ubiquitin (LOC_Os03g13170) gene was used as an internal reference, and the relative expression of the gene was calculated using 2-ΔΔCT.

[0160] The primer sequences for quantitative detection of OsPTST1 expression are:

[0161] OsPTST1-qRT-F: AAAGGATTCAAAGAAGGGTT; SEQ IDNo.8;

[0162] OsPTST1-qRT-R: AGCTATTGGGCTAACAGGAT; SEQ ID No. 9.

[0163] The results showed that the rice OsPTST1 gene was expressed most highly in the panicle, followed by the leaf sheath and leaf. The OsPTST1 gene was highly expressed in the aboveground part of the rice (see Appendix). Figure 5 ).

[0164] Example 4 Construction and transformation of rice proOsPTST1::OsPTST1-GUS recombinant vector

[0165] (1) The CTAB method was used to extract rice NIP genomic DNA.

[0166] (2) Based on the 2000 bp sequence upstream of the ATG transcription start site of the OsPTST1 gene found on the RGAP (http: / / rice.plantbiology.msu.edu / ) website, the OsPTST1 promoter primers were designed. The promoter OsPTST1 was amplified using the rice NIP genomic DNA as a template using the high-fidelity enzyme KOD FX. The primer sequences are as follows:

[0167] proOsPTST1-F: acgaattcgagctcggtaccACAGAGAGATATCTCAG CTAG; SEQ ID No. 10;

[0168] proOsPTST1-R: TCGTGCACTCTTGTGCTCT; SEQ ID No. 11.

[0169] (3) Use the GUS vector as a template to amplify the GUS gene coding sequence. The GUS gene coding sequence was amplified by the high-fidelity enzyme KOD FX, and the primer sequences are as follows:

[0170] GUS-F: TCGTGCACTCTTGTGCTCTATGTTACGTCCTGTAGA AACCCCA; SEQ ID No. 12;

[0171] GUS-R: caggtcgactctagaggatccTCATTGTTTGCCTCCCTGCT; SEQ ID No. 13.

[0172] Finally, the pYLCRISPR / CAS9P ubi -H (see Appendix Figure 1 ) connection, the connection product was transformed into competent cells, coated on LB solid plates with corresponding resistance, colony PCR identification and screening of positive engineering bacteria, and plasmids were extracted for sequencing verification. Finally, the proOsPTST1::OsPTST1-GUS recombinant vector was successfully constructed. It was transformed into the callus tissue of Nipponbare rice through Agrobacterium-mediated method, and positive transformed seedlings were obtained.

[0173] (4) Immerse the transgenic resistant plants in the GUS staining solution and place them in a 37°C incubator protected from light overnight. Rinse the samples with 50%, 70%, and 100% ethanol in sequence, soaking for 5 minutes each time, add 100% ethanol and soak until completely decolorized, and finally take pictures and record under a stereomicroscope. Preparation of GUS staining solution: Dissolve X-gluc in sodium phosphate buffer (containing 100mmol / L pH 7.0 sodium phosphate buffer, 10mmol / L EDTA, 5mmol / L potassium ferrocyanide, 5mmol / L potassium ferrocyanide) to a final concentration of 1mmol / L. The results showed that the GUS gene driven by the OsPTST1 promoter was strongly expressed in panicles, leaf sheaths, and leaves, and weakly expressed in seeds and roots at 0Dap. The gene was highly expressed in the aboveground tissues (see Appendix). Figure 6 ), which is consistent with the quantitative expression results.

[0174] Example 5 Phenotypic observation and agronomic trait statistics of OsPTST1 mutant plants and overexpression plants

[0175] The obtained ptst1 mutant plants and OE-OsPTST1 overexpression plants were planted in the experimental field of Fuyang Base of China National Rice Research Institute, with single plants planted, row spacing of 19.8 cm, and plant spacing of 16.5 cm. All field experiments were managed in a unified manner in accordance with normal field production methods. Yield trait investigation: After the seeds matured, 15 to 20 plants in the middle of the row were selected as the investigation objects, and 10 replicates were performed.

[0176] After multiple generations of planting, the agronomic traits of the wild type, ptst1 and OE-PTST1 lines were investigated and analyzed (see Appendix for phenotypes). Figure 7 , statistical data, see the attached Figure 8 ), the results showed that: compared with the wild type, the ptst1 strain had unchanged plant height and dark green leaves at maturity; the OE-PTST1 plant had unchanged plant height and premature leaf senescence. Compared with the wild type ZH11 mature grains, the mutant ptst1 strain had significantly increased grain length and 1000-grain weight, ultimately leading to an 8.9%-11.2% increase in yield per plant; compared with the wild type NIP, the overexpressing OE-PTST1 strain had significantly reduced grain length, grain width and 1000-grain weight, and a 30.5%-40.2% reduction in yield.

[0177] Example 6 Determination of nitrogen utilization efficiency of OsPTST1 mutant plants and overexpression plants

[0178] The OsPTST1 mutant plants and overexpression plants involved in this project were planted in low nitrogen (LN: nitrogen fertilizer application rate 10kg / mu) fields at the China National Rice Research Institute. After the materials matured, the seeds were harvested and cleaned to weigh the single plant yield. The single plant yield was divided by the average nitrogen application rate of the low nitrogen field to obtain the nitrogen use efficiency of each genetic material in the low nitrogen field. Compared with the wild type, the nitrogen use efficiency of ptst1 plants in low nitrogen fields was significantly improved (see Appendix Fig. 9 ).

[0179] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0180] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of knocking out the OsPTST1 gene in plant breeding, characterized in that: The application is any of the following: A. Improve the nitrogen utilization efficiency of plants; B. Increase grain length; C. Increase production; The nucleotide sequence of the OsPTST1 gene is shown in SEQ ID NO.

1.

2. The use of knocking out the OsPTST1 gene in plant breeding according to claim 1, characterized in that: The CDS nucleotide sequence of the OsPTST1 gene is shown in SEQ ID NO.

2.

3. Use of the biological material with the OsPTST1 gene knocked out according to claim 1 in plant breeding, characterized in that: The biological material is any one of the following: A. Expression cassette capable of knocking out the OsPTST1 gene; B. A recombinant vector containing the expression cassette described in A; C. A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

4. A gene encoding a rice mutant ptst1-1, characterized in that: The coding gene of the mutant has a deletion of base A at position 829 of the nucleotide sequence shown in SEQ ID NO.

1.

5. A gene encoding a rice mutant ptst1-2, characterized in that: The encoding gene of the mutant has an A base inserted at the 821st position of the nucleotide sequence shown in SEQ ID NO.

1.

6. Use of the gene encoding the mutant according to claim 4 or 5 in plant breeding, characterized in that: The application is any of the following: A. Improve the nitrogen utilization efficiency of plants; B. Increase grain length; C. Increase production.

7. A biological material containing a gene encoding a mutant according to claim 4 or 5, characterized in that: The biological material is an expression cassette, an expression vector, a cloning vector and / or a recombinant microorganism.

8. The use of the biological material according to claim 7 in plant breeding, characterized in that: The application is any of the following: A. Improve the nitrogen utilization efficiency of plants; B. Increase grain length; C. Increase production.

9. A method for site-directed mutagenesis of the OsPTST1 gene using the CRISPR / Cas9 system, characterized in that: Designing a CRISPR / Cas9-based sgRNA sequence for the target gene, connecting a DNA fragment encoding the sgRNA sequence to a vector carrying CRISPR / Cas, and transforming rice to achieve site-directed mutagenesis of the rice OsPTST1 gene; The nucleotide sequence of the sgRNA action site is shown in SEQ ID NO.3.

Images