Application of OsPTST1 gene in improving plant nitrogen use efficiency and increasing yield
By knocking out or overexpressing the OsPTST1 gene, rice mutants and overexpression plants were constructed using the CRISPR/Cas9 system, solving the problem of low nitrogen use efficiency in rice and achieving efficient nitrogen use and yield improvement.
Patent Information
- Application Number
- CN202411538126.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-31
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2044-10-31
AI Technical Summary
Current technologies result in low nitrogen utilization rates in rice, leading to significant losses of inorganic nitrogen fertilizers, causing environmental pollution and negative impacts on crop growth. Furthermore, it is difficult to increase yields by reducing fertilizer use.
By knocking out or overexpressing the OsPTST1 gene, site-directed mutagenesis was performed using the CRISPR/Cas9 system to construct rice mutants and overexpressing plants, thereby regulating nitrogen absorption and utilization efficiency.
It significantly improves nitrogen use efficiency in rice, increases grain length and yield per plant, reduces fertilizer use, and provides new high-yield and high-efficiency rice varieties.
Smart Images

Figure CN119177254B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and more specifically to the application of the OsPTST1 gene in improving nitrogen use efficiency and increasing yield in plants. Background Technology
[0002] Rice, as one of the most important food crops, accounts for about 40% of the country's total grain production. With the increase in population and the decrease in arable land, the demand for food will continue to increase in the future.
[0003] On the other hand, nitrogen is one of the essential mineral nutrients for plants, playing a vital role in promoting plant growth and development, facilitating the synthesis of plant proteins and chlorophyll, and increasing crop yield. However, in agricultural production, to overcome low nitrogen utilization rates and increase grain yield, large amounts of inorganic nitrogen fertilizer are widely used. Unabsorbed nitrogen fertilizer is lost into the air, water bodies, or soil, leading to a series of ecologically damaging problems such as excessive greenhouse gas emissions, eutrophication of surface water, and soil acidification. Furthermore, excessive use of nitrogen fertilizer can also negatively impact crop growth, such as reducing stress resistance, increasing lodging susceptibility, decreasing quality, and inhibiting root growth.
[0004] Therefore, reducing the use of nitrogen fertilizer in agricultural production, discovering key genes that regulate nitrogen absorption and utilization, improving nitrogen utilization efficiency, and cultivating new varieties of nitrogen-efficient crops are important biological approaches to ensure high yield, high quality, and stable crop production. Developing and promoting nitrogen-efficient rice varieties is also one of the future development trends of rice cultivation.
[0005] How to increase rice yield and reduce the use of chemical fertilizers to achieve "reduced fertilizer use and increased yield" is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0006] In view of this, the present invention provides the application of the OsPTST1 gene in improving plant nitrogen use efficiency and increasing yield.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] Application of OsPTST1 gene knockout in plant breeding, wherein the application is any one of the following:
[0009] A. Improve the efficiency of nitrogen use in plants;
[0010] B. Increase grain length;
[0011] C. Increase production;
[0012] The nucleotide sequence of the OsPTST1 gene is shown in SEQ ID NO.1.
[0013] Preferably, the CDS nucleotide sequence of the OsPTST1 gene is shown in SEQ ID NO.2.
[0014] Another object of the present invention is to provide the application of biological materials with the OsPTST1 gene knocked out above in plant breeding, wherein the biological material is any one of the following:
[0015] A. Expression cassettes capable of knocking out the OsPTST1 gene;
[0016] B. A recombinant vector containing the expression cassette described in A;
[0017] C. Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.
[0018] Another object of the present invention is to provide a coding gene for a rice mutant ptst1-1, characterized in that the coding gene of the mutant has a deletion of an A base at position 829 of the nucleotide sequence shown in SEQ ID NO.1.
[0019] Another object of the present invention is to provide a coding gene for a rice mutant ptst1-2, characterized in that the coding gene of the mutant has an insertion of an A base at position 821 of the nucleotide sequence shown in SEQ ID NO.1.
[0020] Another object of the present invention is to provide the application of the coding gene of the above-mentioned mutant in plant breeding, wherein the application is any one of the following:
[0021] A. Improve the efficiency of nitrogen use in plants;
[0022] B. Increase grain length;
[0023] C. Increase production.
[0024] Another object of the present invention is to provide a biological material containing the coding gene of the above-mentioned mutant, wherein the biological material is an expression cassette, an expression vector, a cloning vector and / or a recombinant microorganism.
[0025] Another object of the present invention is to provide the application of the above-mentioned biological materials in plant breeding, wherein the application is any one of the following:
[0026] A. Improve the efficiency of nitrogen use in plants;
[0027] B. Increase grain length;
[0028] C. Increase production.
[0029] Another objective of this invention is to provide a method for site-directed mutagenesis of the OsPTST1 gene using the CRISPR / Cas9 system. This method involves designing a CRISPR / Cas9-based sgRNA sequence for the target gene, ligating a DNA fragment encoding the sgRNA sequence into a vector carrying CRISPR / Cas, transforming the vector into rice, and thus achieving site-directed mutagenesis of the rice OsPTST1 gene.
[0030] The nucleotide sequence of the sgRNA action site is shown in SEQ ID NO.3.
[0031] Beneficial Effects: This invention discloses the application of the rice gene OsPTST1 in improving nitrogen use efficiency and increasing rice grain length and yield. This invention obtained ptst1 mutant plants and OE-PTST1 overexpressing plants using CRISPR-Cas9 and overexpression technologies, respectively. Further experiments demonstrated that compared to wild-type rice, ptst1 mutant plants showed significantly increased grain length and thousand-grain weight, higher yield per plant, and improved nitrogen use efficiency; while OE-PTST1 plants showed significantly reduced grain length, grain width, and thousand-grain weight, decreased yield, and lower nitrogen use efficiency. This indicates that OsPTST1 can regulate rice yield and nitrogen use efficiency, laying the foundation for breeding new high-yielding rice varieties with high nitrogen use efficiency. Attached Figure Description
[0032] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0033] Figure 1 The attached image shows the engineering carrier pYLCRISPR / CAS9P. ubi -H plasmid map.
[0034] Figure 2 The attached figure shows the structure of the OsPTST1 gene, mutation sites, and mutation types of mutants.
[0035] Figure 3 The attached image shows the plasmid map of the overexpression vector pU1301.
[0036] Figure 4 The attached figure shows the expression level analysis of the OsPTST1 gene in mutant and overexpressing plants.
[0037] Figure 5 The attached figure shows the expression level analysis of the OsPTST1 gene in different tissues of rice.
[0038] Figure 6 The attached figure shows the expression of the OsPTST1 gene in proOsPTST1::OsPTST1-GUS transformed plants.
[0039] Figure 7 The attached figure shows the phenotype and ten-grain length of the OsPTST1 mutant and overexpressing rice lines.
[0040] Figure 8 The attached figure shows the statistical data of agronomic traits of the OsPTST1 mutant and overexpression lines; where A is grain width, B is grain length, C is thousand-grain weight, and D is yield per plant.
[0041] Figure 9 The attached figure shows the analysis and comparison of nitrogen use efficiency (NUE) of the OsPTST1 gene in mutant and overexpressing plants. Detailed Implementation
[0042] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0043] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art described herein.
[0044] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available products.
[0045] Example 1: Construction of the CRISPR-Cas9 vector for the rice OsPTST1 gene
[0046] Based on the OsPTST1 gene sequence (e.g., SEQ ID No. 1, SEQ ID No. 2) published on the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / ), appropriate target sequences (e.g., SEQ ID No. 3) were selected, and primers gRNA-OsPTST1-F (e.g., SEQ ID No. 4) and gRNA-OsPTST1-R (e.g., SEQ ID No. 5) were designed.
[0047] The primer pair gRNA-OsPTST1-F / R was denatured and annealed to obtain the dimer product of gRNA-OsPTST1-F / R. The dimer product of gRNA-OsPTST1-F / R was ligated into the pYLgRNA-U3 vector to obtain an intermediate vector. Then, according to the steps in the reference: MaX, Zhang Q, Zhu Q, et al. A Robust CRISPR / Cas9 System for Convenient, High Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. MolPlant. 2015; 8(8):1274-1284., the intermediate vector was ligated into the pYLCRISPR / Cas9-MH final vector using the method of cutting and ligating simultaneously to obtain a single-target OsPTST1 CRISPR / Cas9 gene editing vector. After the vector was successfully constructed, the callus tissue of Zhonghua 11 was transformed by Agrobacterium-mediated transformation to obtain T0 generation transgenic plants (see Appendix). Figure 1 The Agrobacterium-mediated rice genetic transformation system followed the method reported by Hiei et al. (Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. The Plant Journal, 1994). The ptst1 mutant plants ptst1-1 and ptst1-2 were obtained (see Appendix for OsPTST1 gene structure and mutation site). Figure 2 See Appendix for gene expression levels of mutants. Figure 4 ).
[0048] The nucleotide sequence of the rice OsPTST1 gene is as follows:
[0049] AAGAGCACAAGAGTGCACGAAGACGAGACGAGAGCGAGCTGTTCATCCT
[0050] CCCACTCCACCTCGGAGCTGAGCTCTGCTTCTCTCCCGATCTCTCCACCCA
[0051] CCGCAGCAGCATCCTTTCGACCTCTCTAGGGTTCCAGCCTCGAGTTGGCCT
[0052] CGTCCCCCCCCCCCCCCCCCCACATTCGCTGCGAGGTTGCTGCTCGCTTCA
[0053] CTTGTCTTCGGTTTGATTTCCCCCCACCTAACTGATTCTGATTGATACGGCT
[0054] CGGCTCGTGTGTGCGGCTCACTTAGGTTTGGGATTCTCTTCCGGATTGGAT
[0055] TGGTGGAGTGGCAGGGAATTGTTAGTTCTGGTGTGGTTTGTGGTTAAGAG
[0056] AAGGGGTGAGGTTCTTGCTGCCGTGTATCTGTACTGATTCCTTTTGCATAG
[0057] TTGTTTTTTTTTCTTTTCGTGTATACTGTTATCTGCTACTGTATGAGAGACT
[0058] TATGTTTTGGCTAATGTTCTCGATTGGAAGCTATGAAAATGTAATTTTGAT
[0059] CTATCTTATTTCCTATTTTTGTTCAGGGAAATAGCTATGGAGTGTCTGACC
[0060] ACAAGTTTTACTAGGTAAGTTATTCTCTTGATTGTGCAATATTATTATTCA
[0061] GATATAGAATACTCCAACATGAACAGCATGTATGTATGATCTATTGATATT
[0062] GTCCGTAATCTGATTTTAGCTTGGTAAGTTAGTTAATCCCCGTACGACTTT
[0063] CAGAATTCCCCATGCCCTGTTGAAACCACATCCAGAATGCATAGTTCTTCT
[0064] TTTACCCCCCTTTTATCATTACTTTAACATGGTTAGGTGATGTTTTTGGTGA
[0065] AGGAATCCGGGAAGGGAGTATAATCTCATATGTCCGAGCGAAGCTCTGTC
[0066] TGAAAAACAAAGGATTCAAAGAAGGGTTCTATGCTATTTTCCAGCTTCCA
[0067] CAAACTCAAGACGATGTCGCAAGTTCACAACTATGGCATATCCTGTTAGC
[0068] CCAATAGCTGGCAGACGTTCAAATTGGAGATCTTTTGCTGCAAGTCTGAA
[0069] TTTGGAAGATGGTCCTGCATCCTCTGACTCAACATCATCCCCTTCAGAGCA
[0070] AACTAGTGATGGTGGTGAAGTTTATGGTGACCCTTCTGAAAATCTGAATTC
[0071] TCGGAAACTTAAATCTGACGAGGTATCATATCATCCAATTGTGTATTGTTT
[0072] CACCCATGCAGTTTTTTTTCTTTGCCAGGACGGCGGAAGGACACGCCGTCC
[0073] GAAATTCATTAGATTTTAAAAGGAGTACAGTACAAATAGCTTGGCAAACC
[0074] CGTGCAGCTTATCACTCTGCATTCCTGTACCATATGTCACTCAAAGATTAG
[0075] CAGAGCCAGCATTTCAATTCCTCCAATGAGTTCACTATAAATGATCTCTAC
[0076] TTTCAAGGCATACCTCACGTTATTATACTTTCCTGCATAAATCTTTCAGTCC
[0077] ATTTTTAGGAGTTATTGTTTGTATTTGTCAAATATTAGGTCAACAGGGGGT
[0078] TTTTAATGTAGCATCTGCGTAAGAGAAATATGTATCTGTATGATATCTATG
[0079] TGGTCTTATTCCCTAGCAGCTAAGACAGCTTAAGGAGATATTCTCCTTAAC
[0080] CCTTATAATCATAAGTATTAGAGAGTGACCTCCTTCAGAAATGAACTCAA
[0081] CAGAGAAATGGCAAACTTGATTGTAGCTCTAACAGTTGATGTTCGGTTCG
[0082] TAGATCGCACTTGAAAGATTGATACTTCCAAAGTACAAAGAACAACGTTG
[0083] CAACTTGGTCTTTTTTTTTCTTTTCGATTAGCAACCTACAGACACTAGCAT
[0084] TATTTTATATATGACTAATGTTGTGCTTCTCTTTTATTTTGGCATGCAGTT
[0085] GAAATCTCTTTTGGCTGATTCAGAACGATCTAAGCTTTTGAAAGGCTTAG
[0086] TGAAGCAAACCAATACAACCGGTTCCTCAAGAGACAGGTTCTATTATTGT
[0087] ACCTTTTTCCAAAGTGTTCATTGAATTGCATCATATATACTGTTCACAATT
[0088] ATCAGCAAATAACATAATACAGAATTGTTCATACTGAATAGCTTTCTATTA
[0089] TCTGCGACTTGAACTTTATGCTTTCTACTGAAGATAGCCGCCTAGACGTTTT
[0090] GTAAAATGAAAAACAATTACTCTGTCCAGGCACTGTATTTGCTGTCATGAT
[0091] GCAAGTCAGCAAGAACTAGCAATTTTGTTCAGTCAGGATCGAATAGAATA
[0092] TAGAACTCCCCTTTTACTTGTAGATTACTGTGTTGATTCACTTTATGCTAC
[0093] GCACTATATCGCCAGAAAAATTACATTTTTTTTATAAAAAATCTATAATGC
[0094] ATTTTGTAGTACAAATGTATTTAAATATTCCTAACGAATCCAGGACTTTGA
[0095] ACTACTGAAAGTATCTTAGGATATTTTTCTTTAAAAAATCATTCATGAACT
[0096] AGTTTGCTAAATTGAAGCTTCTTTTGCATCAGATGAATATTTTTGTGAGAT
[0097] TACATTTTTTTTGTATAAATAGCTGTCCATACAGAGTTGTGGTTATGTCAA
[0098] ATATGCACAATTCCATTTCTCTTATTAAGCACTGAATCATTGCTAACTAGA
[0099] TAGAAATGTACTATTTCTTGCAGTTGCAAATGAAGGATAATGACGTTGTG
[0100] AAGTTCAAGAGTGAACTTGCCGTTATGGAACTTGAACTGCAGGTTAGCTC
[0101] TAACAGACTTTTCTTGTTTCATAGTTCAATCATAAGCCCTTTGGGGGACAGG
[0102] GGATGCTATCAACATGCCTTTAACTCATCTAGCATCTTGAGAATTCATTCA
[0103] TAACTTCATGTTTCCTTTTCCATAAAGATATCAGACTGTAAATACATGAAT
[0104] GAAGTATGTCTGGCTTCCTCTAAAGGATTGTATGATTTTGTATGCCTCTGT
[0105] ACTTTGTCTCCCCTAGGACTGGCTTTAAATCAATATATTTTGTTTCTTGGTT
[0106] TTGTTCAAACTTTTATCAGTGATCAGTATTGTTGATACTGTTACTCTAAATG
[0107] TATTTACATTTTGTATGTATTCACTGTTTCTTTATGTCCACAGGCTCTGGTT
[0108] GCCCTAGCTGAAGAGATTGCTAATTTTGATGTTCCATCTGGGTCTAGGAAG
[0109] ATAAATGGAAAATATATCCAGTCACATCTTCTCACCAGATTAGAAGGTTA
[0110] TCTCTATCACAATGCTCCAAGTTGAATTAACAATGAAATTTTCTGACGAAA
[0111] TGTTTGTTTCCTATAGCTGTTCATGATAAGGTTATGGAACAAATTAAGGAT
[0112] GTAGACTCTTTAAAGCACCAAGAAATTTCTGTCTTCTGGGTTGGCATTGCT
[0113] GAGGTAAAACAAGGTTTTTGACTTAACTCGTTATATGGAACAGAACTATT
[0114] GTCATATATCTACAGCTATCATTTATGTCCTCTATTGTTCTTCATTGGTTTT
[0115] TTGTCTGCACATCAGAATGTACAAATTATGGGCTCCTTCGATGGCTGGTCC
[0116] CAGGGAGAGGCAATGTCCATGGAGTATTCAGGTTACCAAGCAAGATTCTC
[0117] TGCAACTCTGAATCTTAGACCTGGGAGGTGTGTTTTGTGAATTCTGCAGAG
[0118] CGATCTGATTTGCTATGATTTATTTATTAACTAAACAATCTCACTTATCTGT
[0119] TTGTATGCAAAATAAAGGTATGAGATCAAATTCTTGGTTGATGGAGAGTG
[0120] GAGGCTGTCACTGGAGTACCCAATTGATGGCGAAGGTTCAATGCAGAACA
[0121] ATATACTTGTTGTAAATTAATGTAGATATCTGTTGGCTCCTAGTTTGCCAT
[0122] AGTTGTAACTTGCAGCTATAAAACCTAGCGCAAGATTGAACTGTACTCGA
[0123] TTGCTATCATGCATCCGATTTGCAAAATTTCACTTTACCATGAAATGCAAG
[0124] GCCTTTTTTTCCTGGTTGGA; SEQ ID No.1。
[0125] The nucleotide sequence of the CDS of the rice OsPTST1 gene is as follows:
[0126] ATGGAGTGTCTGACCACAAGTTTTACTAGGAATCCGGGAAGGGAGTATAA
[0127] TCTCATATGTCCGAGCGAAGCTCTGTCTGAAAAACAAAGGATTCAAAGAA
[0128] GGGTTCTATGCTATTTTCCAGCTTCCACAAACTCAAGACGATGTCGCAAGT
[0129] TCACAACTATGGCATATCCTGTTAGCCCAATAGCTGGCAGACGTTCAAATT
[0130] GGAGATCTTTTGCTGCAAGTCTGAATTTGGAAGATGGTCCTGCATCCTCTG
[0131] ACTCAACATCATCCCCTTCAGAGCAAACTAGTGATGGTGGTGAAGTTTAT
[0132] GGTGACCCTTCTGAAAATCTGAATTCTCGGAAACTTAAATCTGACGAGTT
[0133] GAAATCTCTTTTGGCTGATTCAGAACGATCTAAGCTTTTGAAAAAGCTTAG
[0134] TGAAGCAAACCAATACAACCGGTTCCTCAAGAGACAGTTGCAAATGAAG
[0135] GATAATGACGTTGTGAAGTTCAAGAGTGAACTTGCCGTTATGGAACTTGA
[0136] ACTGCAGGCTCTGGTTGCCCTAGCTGAAGAGATTGCTAATTTTGATGTTCC
[0137] ATCTGGGTCTAGGAAGATAAATGGAAAATATATCCAGTCACATCTTCTCA
[0138] CCAGATTAGAAGCTGTTCATGATAAGGTTATGGAACAAATTAAGGATGTA
[0139] GACTCTTTAAAGCACCAAGAAATTTCTGTCTTCTGGGTTGGCATTGCTGAG
[0140] AATGTACAAATTATGGGCTCCTTCGATGGCTGGTCCCAGGGAGAGGCAAT
[0141] GTCCATGGAGTATTCAGGTTACCAAGCAAGATTCTCTGCAACTCTGAATCT
[0142] TAGACCTGGGAGGTATGAGATCAAATTCTTGGTTGATGGAGAGTGGAGGC
[0143] TGTCACTGGAGTACCCAATTGATGGCGAAGGTTCAATGCAGAACAATATA
[0144] CTTGTTGTAAATTAA; SEQ ID No. 2.
[0145] PAM
[0146] CRISPR / cas9 target site:TGGTGAAGGAATCCGGGAA GGG ;SEQ ID No.3;
[0147] The adapter primer pair containing the target sequence is as follows:
[0148] gRNA-OsPTST1-F: ggcaTGGTGAAGGAATCCGGGAA; SEQ ID
[0149] No. 4;
[0150] gRNA-OsPTST1-R: aaacTTCCCGGATTCCTTCACCA; SEQ ID No. 5.
[0151] Example 2: Construction of rice OsPTST1 gene overexpression vector
[0152] Primers OE-PTST1-F (e.g., SEQ ID No. 6) and OE-PTST1-R (e.g., SEQ ID No. 7) were designed based on the OsPTST1 gene sequence (e.g., SEQ ID No. 1) published on the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / ). Using NIP cDNA as a template (sequencing was performed using rice NIP as background material), KpnI and BamHI restriction enzyme sites were designed on the primers to amplify the full-length cDNA of the target gene from the start codon to the stop codon (e.g., SEQ ID No. 2). The purified target fragment after KpnI and BamHI digestion was ligated into the same digested pU1301 vector using a double-digestion and double-ligation method (see Appendix). Figure 3(Construction method as described by Jian, Zhang, Babi, et al. OsMADS6 plays an essential role in endosperm nutrient accumulation and is subject to epigenetic regulation in rice (Oryza sativa) [J]. The Plant Journal, 2010). Thaw competent E. coli DH5α cells on ice, add the ligation product to the competent cells, gently tap the tube wall to mix, and incubate on ice for 30 mins; after heat shock at 42℃ for 45 s, immediately cool on ice for 3–5 mins; add 700 μL of antibiotic-free LB (Luria-Bertani) culture medium, and shake on a shaker at 37℃ for 45 mins; centrifuge at 4000 rpm for 1 min, discard approximately 500 μL of supernatant, resuspend the remaining bacteria, spread on LB agar plates with the appropriate antibiotics, and incubate upside down at 37℃ for 13–16 hrs. After single-cell colonies emerged, positive engineered bacteria were identified and screened. Plasmids were extracted using a kit (Shanghai Yisheng, 19001ES50) to obtain the PU1301-OsPTST1 overexpression vector, which was confirmed by sequencing. Following successful vector construction, genetic transformation was performed to obtain OE-OsPTST1 overexpressing plants (the gene expression levels are shown in the appendix). Figure 4 ).
[0153] OE-PTST1-F:TTACTTCTGCACTAGGTACCTCAACATCATCC CCTTCAG; SEQ ID No. 6;
[0154] OE-PTST1-R: TCCTCTTAGAATTCCCGGGGATTAATTTACAA CAAGTATA; SEQ ID No. 7.
[0155] Example 3: Quantitative expression analysis of rice OsPTST1 gene in various tissues of rice NIP
[0156] cDNA was obtained by extracting RNA from the sample and reverse transcribing it. The expression level of the OsPTST1 gene was detected by qRT-PCR. The specific method is as follows:
[0157] RNA was extracted from fresh leaf samples of wild-type rice ZH11, NIP, the mutant ptst1, and the overexpressing plant OE-OsPTST1 using the Trizol method. cDNA synthesis was performed using the TOYOBO First Strand cDNA Synthesis Kit Rever Tra Ace-α. The synthesized first-strand cDNA was diluted to 50 μL with DEPC·H2O for cloning and other molecular experiments. Real-time quantitative PCR (qPCR) reactions were performed using Hieff Biotech (Shanghai Yisheng Biotechnology Co., Ltd.). Power qPCR SYBR Green MasterMix.
[0158] The 10μL system includes: 1μL cDNA, 5μL SYBR Green MasterMix, 0.2μL 10μM Primer F (forward), 0.2μL 10μM Primer R (reverse), 3.6μL ddH2O.
[0159] The amplification program was: 95℃ for 3 mins, 95℃ for 10 s, 60℃ for 30 s, 72℃ for 15 s, for 40 cycles, performed in a real-time PCR instrument. The Ubiquitin (LOC_Os03g13170) gene was used as an internal control, and the relative expression level of the gene was calculated using 2-ΔΔCT.
[0160] The primer sequences for quantitative detection of OsPTST1 expression are as follows:
[0161] OsPTST1-qRT-F: AAAGGATTCAAAGAAGGGTT; SEQ IDNo.8;
[0162] OsPTST1-qRT-R: AGCTATTGGGCTAACAGGAT; SEQ ID No. 9.
[0163] The results showed that the OsPTST1 gene was most highly expressed in the panicle, followed by the leaf sheath and leaf midsection. The OsPTST1 gene was also highly expressed in the aboveground parts of rice (see Appendix). Figure 5 ).
[0164] Example 4: Construction and transformation of rice proOsPTST1::OsPTST1-GUS recombinant vector
[0165] (1) Extract rice NIP genomic DNA using the CTAB method.
[0166] (2) Based on the 2000bp upstream sequence of the transcription start site ATG of the OsPTST1 gene found on the RGAP website (http: / / rice.plantbiology.msu.edu / ), primers for the OsPTST1 promoter were designed. Using the high-fidelity enzyme KOD FX, the OsPTST1 promoter was amplified using rice NIP genomic DNA as a template. The primer sequences are as follows:
[0167] proOsPTST1-F: acgaattcgagctcggtaccACAGAGAGATATCTCAG CTAG; SEQ ID No. 10;
[0168] proOsPTST1-R: TCGTGCACTCTTGTGCTCT; SEQ ID No. 11.
[0169] (3) The GUS vector was used as a template for amplifying the GUS gene coding sequence. The GUS gene coding sequence was amplified using the high-fidelity enzyme KOD FX. The primer sequences are as follows:
[0170] GUS-F: TCGTGCACTCTTGTGCTCTATGTTACGTCCTGTAGA AACCCCA; SEQ ID No. 12;
[0171] GUS-R: caggtcgactctagaggatccTCATTGTTTGCCTCCCTGCT; SEQ ID No. 13.
[0172] Finally, pYLCRISPR / CAS9P was subjected to homologous recombination and KpnI and BamHI digestion. ubi -H (see appendix) Figure 1 The ligation product was transformed into competent cells, plated on LB agar plates with appropriate antibiotic resistance, and screened for positive engineered bacteria by colony PCR. Plasmids were extracted and sequenced for verification. The proOsPTST1::OsPTST1-GUS recombinant vector was successfully constructed. It was then transformed into callus tissue of Nipponbare rice using Agrobacterium-mediated transformation, yielding positive transformed seedlings.
[0173] (4) The transgenic resistant plants were immersed in GUS staining solution and placed in a 37°C incubator overnight in the dark. The samples were rinsed sequentially with 50%, 70%, and 100% ethanol, soaking for 5 minutes each time, followed by 100% ethanol until complete decolorization. Finally, the samples were photographed and recorded under a stereomicroscope. GUS staining solution preparation: X-gluc was dissolved in sodium phosphate buffer (containing 100 mmol / L pH 7.0 sodium phosphate buffer, 10 mmol / L EDTA, 5 mmol / L potassium ferricyanide, and 5 mmol / L potassium ferrocyanide) to a final concentration of 1 mmol / L. The results showed that the GUS gene driven by the OsPTST1 promoter was strongly expressed in spikes, leaf sheaths, and leaves, but weakly expressed in ODap seeds and roots. The gene expression level was high in the aboveground tissues (see Appendix). Figure 6 This is consistent with the quantitative expression results.
[0174] Example 5: Phenotypic observation and agronomic trait statistics of OsPTST1 mutant plants and overexpressing plants.
[0175] The obtained ptst1 mutant plants and OE-OsPTST1 overexpressing plants were planted in the experimental field of the Fuyang Base of the China National Rice Research Institute. Planted individually, with a row spacing of 19.8 cm and a plant spacing of 16.5 cm, all field trials were managed according to normal field production methods. Yield trait assessment: After seed maturity, the middle 15–20 plants in each row were selected as the subjects for evaluation, with 10 replicates.
[0176] After multiple generations of cultivation, agronomic traits of wild-type, ptst1, and OE-PTST1 lines were investigated and analyzed (see appendix for phenotypes). Figure 7 Statistical data can be found in the appendix. Figure 8 The results showed that compared with the wild type, the ptst1 line maintained the same plant height at maturity, but had dark green leaves; the OE-PTST1 plant height remained unchanged, but its leaves senescent prematurely. Compared with the wild type ZH11 mature grains, the mutant ptst1 line showed a significant increase in grain length and thousand-grain weight, ultimately leading to an increase in yield per plant of 8.9%-11.2%; compared with the wild type NIP, the overexpression OE-PTST1 line showed a significant decrease in grain length, grain width, and thousand-grain weight, resulting in a yield reduction of 30.5%-40.2%.
[0177] Example 6: Determination of nitrogen use efficiency in OsPTST1 mutant plants and overexpression plants
[0178] The OsPTST1 mutant plants and overexpression plants involved in this project were planted in low-nitrogen (LN: nitrogen fertilizer application rate of 10 kg / mu) fields at the China National Rice Research Institute. After the materials matured, seeds were harvested and cleaned to measure the yield per plant. The nitrogen use efficiency of each genetic material in low-nitrogen fields was obtained by dividing the yield per plant by the average nitrogen application rate of the low-nitrogen fields. Compared with the wild type, the nitrogen use efficiency of ptst1 plants in low-nitrogen fields was significantly improved (see Appendix). Figure 9 ).
[0179] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.
[0180] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. Knockout OsPTST1 The application of genes in plant breeding is characterized by, The application is any one of the following: Improve the efficiency of nitrogen use in plants; Increase grain length; Increase production; The OsPTST1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The plant in question is rice.
2. The knockout according to claim 1 OsPTST1 The application of genes in plant breeding is characterized by, The OsPTST1 The CDS nucleotide sequence of the gene is shown in SEQ ID NO.
2.
3. Knockout of claim 1 OsPTST1 The application of gene-based biomaterials in plant breeding is characterized by, The biomaterial is any one of the following: A. capable of OsPTST1 Gene knockout expression cassette; B. A recombinant vector containing the expression cassette described in A; C. Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B; The plant breeding refers to any one of the following: A. Improve the efficiency of nitrogen use in plants; B. Increase grain length; C. Increase production; The plant in question is rice.