Molecular marker for identifying sex of leukemia macadamia and application of molecular marker

Abstract

The invention discloses a molecular marker for sex identification of leukemia macadamia and application of the molecular marker. The invention specifically discloses an application of a Meyeshade macadaensis sex identification molecular marker or a substance for detecting the Meyeshade macadaensis sex identification molecular marker in identification or auxiliary identification of Meyeshade macadaensis sex. The Meyeshade macadaensis sex identification molecular marker is a DNA (deoxyribonucleic acid) fragment at the 27th-318th site of which the nucleotide sequence is SEQ ID No.1. The invention designs a primer of the gender identification molecular marker, and provides a method for identifying or assisting in identifying the gender of the leukemia macadamia. The molecular marker for sex of leukemia macadamia and the detection substance thereof have the advantages of high accuracy, good repeatability, simplicity and convenience.

Description

Technical Field

[0001] The invention belongs to the technical field of Hawaiian shrimp, and in particular relates to a molecular marker for sex identification of Hawaiian shrimp and an application thereof. Background Art

[0002] Hawaiian shrimp ( Parhyale hawaiensis ) is an important model animal among crustaceans. It plays an important role in scientific research and in exploring embryonic development, limb regeneration, tidal rhythms, environmental pollution and many other aspects. It is also a high-quality bait for economic animals such as shrimp and fish, with high yield and economic value. Nowadays, many aquacultured crustaceans can achieve monosexual farming through sex control technology to increase production and improve quality. Hawaiian shrimp are dioecious, with males larger than females and growing faster, but it is still impossible to perform early sex identification and sex control on Hawaiian shrimp. With the increasing demand for early sex identification in scientific research and sex-controlled breeding, it is of great significance to develop a convenient sex identification method.

[0003] At present, the sex identification of Hawaiian shrimp is mainly based on external morphological characteristics. The external morphological characteristics of males include strong and enlarged second branchiopods, more olfactory hairs on the first antenna, longer flagella on the second antenna, usually with shoe-shaped receptors, and larger compound eyes. The external morphological characteristics of female Hawaiian shrimp are mainly that the chest has four pairs of brooding valves, which are attached to the inner side of the coxal plate of the thoracic foot. In addition, the male genital pore is located on the ventral surface of the eighth thoracic segment, while the female genital pore is located on the ventral surface of the sixth thoracic segment.

[0004] However, for juvenile Hawaiian shrimp, many sex-related characteristics are not fully developed due to the development stage, and it is difficult to identify the sex of juvenile Hawaiian shrimp by morphological characteristics. In addition, the subtle morphological characteristics of Hawaiian shrimp are difficult to distinguish for people who lack morphological knowledge. Therefore, it is necessary to develop a simple and easy-to-implement method for sex identification, which is both practical and scientific. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a molecular marker for sex identification of Hawaiian gammarus. The technical problem to be solved is not limited to the technical subject described, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions: The present invention provides a Hawaiian shrimp sex identification molecular marker or a substance for detecting the Hawaiian shrimp sex identification molecular marker and its application in identifying or assisting in identifying the sex of Hawaiian shrimp. The Hawaiian shrimp sex identification molecular marker is a DNA fragment with a nucleotide sequence of positions 27-318 of SEQ ID No.1.

[0007] The present invention also provides an application of a substance for detecting whether the Hawaiian shrimp genome contains a DNA fragment having nucleotides at positions 27-318 of SEQ ID No. 1 in identifying or assisting in identifying the sex of the Hawaiian shrimp.

[0008] In the above application, the substance contains PCR primers for amplifying a Hawaiian shrimp genomic DNA fragment containing the Hawaiian shrimp sex identification molecular marker.

[0009] In the above application, the PCR primer is a primer pair, which consists of a forward primer and a reverse primer. The forward primer is a single-stranded DNA with a nucleotide sequence of SEQ ID No.2, and the reverse primer is a single-stranded DNA with a nucleotide sequence of SEQ ID No.3.

[0010] The present invention also provides a method for identifying or assisting in identifying the sex of Hawaiian gammarus, the method comprising the following steps: (1) using the genomic DNA of the Hawaiian shrimp to be identified as a template, and performing PCR amplification using any of the aforementioned PCR primers to obtain a PCR product; (2) Identifying the sex of the Hawaiian shrimp based on whether the PCR product contains the aforementioned Hawaiian shrimp sex identification molecular marker.

[0011] The present invention also provides a method for identifying or assisting in identifying the sex of Hawaiian gammarus, the method comprising the following steps: (1) using the genomic DNA of the Hawaiian shrimp to be identified as a template, and performing PCR amplification using any of the aforementioned PCR primers to obtain a PCR product; (2) The sex of the Hawaiian shrimp is identified based on whether the PCR product contains a specific DNA fragment, wherein the size of the specific DNA fragment is 292 bp.

[0012] Specifically, the PCR procedure was as follows: 25 μL of PCR amplification system, including 0.5 μL of upstream primer and downstream primer, 1 μL of template DNA, 10 μL of 2× M5 HiPer plus Taq HiFi PCR mix, dd H 2O 8μL. PCR reaction program: 95℃ pre-denaturation for 3min; 94℃ denaturation for 25s, 55℃ annealing for 25s, 72℃ extension for 10s, a total of 30 cycles; 72℃ extension for 10min.

[0013] The sequence of the upstream primer is SEQ ID No.2, and the sequence of the downstream primer is SEQ ID No.3.

[0014] In the above method, the PCR product contains the Hawaiian shrimp sex identification molecular marker or contains a DNA fragment with a size of 292 bp, and the Hawaiian shrimp to be identified is or is a candidate for a male Hawaiian shrimp. The PCR product does not contain the Hawaiian shrimp sex identification molecular marker or does not contain a DNA fragment with a size of 292 bp, and the Hawaiian shrimp to be identified is or is a candidate for a female Hawaiian shrimp.

[0015] The aforementioned DNA molecules also fall within the protection scope of the present invention.

[0016] The application of the DNA with the nucleotide sequence SEQ ID No. 1 in the analysis of Hawaiian shrimp germplasm resources or molecular marker-assisted breeding.

[0017] The application of the above-mentioned PCR primers in the analysis of Hawaiian shrimp germplasm resources or molecular marker-assisted breeding.

[0018] The advantage of the present invention is that there is currently a lack of effective genetic molecular markers for sex identification in the Hawaiian shrimp of the order Amphipoda. The identification of the male and female characteristics of the Hawaiian shrimp is mainly based on morphological classification, but this method cannot effectively distinguish between immature larvae, and due to the defects that may exist in individual development, there are similarities between males and females. For example, features such as the second branchial leg are not fully enlarged in male individuals during the larval stage, and the difference between males and females is not obvious. Therefore, morphological identification cannot fully achieve complete identification of Hawaiian shrimp in the larval stage and individuals with developmental defects. As an important model species in the order Amphipoda, the Hawaiian shrimp ( Parhyale hawaiensis ), the molecular markers provided by the present invention can effectively identify the sex of adults and larvae of Hawaiian shrimp, and can simply and quickly realize the sex identification of Hawaiian shrimp through polymerase chain reaction (PCR), gel electrophoresis and other methods, thereby improving the scope and accuracy of sex identification, and the results are stable, reliable, repeatable and simple, so there is no need to rely on the identification experience and judgment criteria of its external morphology.

[0019] In the present invention, the molecular genetic markers and morphological identification of 15 male and female adults and 4 juveniles were detected, and it was confirmed that the accuracy of the molecular markers reached 100%. In addition, the method is repeatable and does not need to rely on experience to judge the morphological characteristics. It only needs to judge the sex by the number of bands in the experimental results. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The figure shows the gel electrophoresis results of 10 adult male Hawaiian shrimps. The marker is a 2500bp DNA marker, and the numbers from top to bottom are 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.

[0021] Figure 2 The gel electrophoresis results of 5 adult female Hawaiian shrimps are shown in Figure 1. The marker is a 2500 bp DNA marker, and the markers from top to bottom are 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp.

[0022] Figure 3 The gel electrophoresis results of four juvenile gammarids are shown in Figure 1. Lanes 1 and 6 are 2500bp DNA markers, and from top to bottom they are 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. Lanes 2-5 are respectively gammarids 1, 2, 3, and 4. DETAILED DESCRIPTION

[0023] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0024] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0025] Example 1. Development of DNA Molecular Markers The sexually mature Hawaiian gammarus crayfish cultured in Example 5 were selected and their sex was identified by the following morphological criteria.

[0026] Morphological standard: The external morphological characteristics of males include strong and enlarged second branchiopods, more olfactory hairs on the first antennae, longer flagella on the second antennae, usually with shoe-shaped receptors, and larger compound eyes. The external morphological characteristics of female Hawaiian shrimp are mainly that the chest has four pairs of brooding valves, which are attached to the inner side of the coxal plate of the thoracic foot. In addition, the male genital pore is located on the ventral surface of the eighth thoracic segment, while the female genital pore is located on the ventral surface of the sixth thoracic segment.

[0027] The genomic DNA of the Hawaiian shrimp identified as female and male was extracted and sequenced using the Illumina high-throughput sequencing platform NovaSeq 6000. The sequencing data was 100Gb for each male and female. By comparing the sequencing depth of the male and female resequencing data and the differences in the male and female genomes, the genomic regions with differences in the male and female genome sequences were determined. By comparison, it was found that there was a sequence of about 300 base pairs in the male genome sequence, which was missing in the female genome. Moreover, no similar homologous sequences were found in this sequence of the male Hawaiian shrimp in the whole genome, indicating that this sequence is specific. Therefore, this fragment can be defined as a potential sex-specific molecular marker (SEQ ID No.1).

[0028] SEQ ID No.1 5'-CGTATTTCTGACAGAGACGACTATTTGATCAACCCGTTCCATCAAATGGATAACACGAAGAACTTTGATGTTCCTTTTGACTACATGTCGGCCATGATGTACCATGTGAGTATTTGTAACGTTAAGCAGCATACCATTCGTAATTTGCTACGTCTGCACGGATCTCAGGCAGTCGAATTTTGCATTGATGGGTCT CATGCAAAAACAATTTTTCACCTTTAACAACTTCAAATAATTCTAGTAGCTATGTTGAACGCAGTATATGTAGCTACTAACTATCCTGAAATTTATTGCAAAGTGCCGCGTATAAGACAGCTGATACGATTAATGTTGCCAATTTTAGGCGCTCAACTGATTTATTAAAATGAATTTCTGCACTGCTGATACTG-3'.

[0029] According to SEQ ID No.1, an amplification primer pair was designed in the conserved regions on both sides thereof. The amplification primer pair consisted of an upstream primer F and a downstream primer R, and its specific nucleotide sequence was as follows: F (SEQ ID No. 2): 5'-GATCAACCCGTTCCATC-3'; R (SEQ ID No. 3): 5'-CAGCTGTCTTATACGCGGCAC-3'.

[0030] The primer pair F / R can amplify a DNA fragment whose nucleotide sequence is nucleotides 27-318 of SEQ ID No. 1 in the genome of male Hawaiian shrimp, but cannot amplify a DNA fragment whose nucleotide sequence is nucleotides 27-318 of SEQ ID No. 1 in the genome of female Hawaiian shrimp.

[0031] Example 2: Identification of Sex of Sexually Mature Hawaiian Shrimp Using Male-Specific Molecular Markers Ten sexually mature male Hawaiian shrimps (numbered M1-10) and five female Hawaiian shrimps (numbered F1-F5) bred in Example 5 were selected. The specific identification steps are as follows: 1. Take one leg of the aforementioned Hawaiian shrimp and use the Tiangen DP316 micro-sample genomic DNA extraction kit to extract genomic DNA. Use the genomic DNA as a template and use the aforementioned primers F and R for PCR amplification. The PCR amplification system is 25 μL, including 0.5 μL of upstream primers and downstream primers, 1 μL of template DNA, 10 μL of 2× M5 HiPer plus Taq HiFi PCRmix, and dd H 2 O 8μL. PCR reaction program: 95℃ pre-denaturation for 3min; 94℃ denaturation for 25s, 55℃ annealing for 25s, 72℃ extension for 10s, a total of 30 cycles; 72℃ extension for 10min.

[0032] 2. Perform agarose gel electrophoresis on the amplified PCR product. The operation of agarose gel electrophoresis to detect PCR products is as follows: first weigh 0.25g of agarose, measure 25ml of 1×TAE buffer to prepare 1% gel solution, then heat the solution to boiling to completely melt the agarose, add 2μl GelStain nucleic acid dye (full gold GS101-02), pour it into the horizontal plate of the electrophoresis tank and wait for it to solidify. After solidification, draw 3μl of the PCR product into the groove, and add 1000bp DNA marker to an empty groove. Run the gel at 220V for 15 minutes.

[0033] The results show that ( Figure 1 , Figure 2and Table 1), the PCR products of Hawaiian shrimp M1-M10 identified as male according to morphological characteristics all have a target band at 250-500 bp, while the PCR products of Hawaiian shrimp identified as female according to morphological characteristics do not have a target band at 250-500 bp. The target bands of the aforementioned male Hawaiian shrimp M1-M10 were recovered for sequencing, and the sequencing results showed that the nucleotide sequences of the target bands of male Hawaiian shrimp were consistent with the nucleotides 27-318 of SEQ ID No.1. It can be seen that the aforementioned molecular markers can effectively distinguish between males and females, with an accuracy rate of 100%.

[0034] Table 1

[0035] Example 3: Identification of sex of juvenile Hawaiian shrimp using male-specific molecular markers The juvenile hook shrimp bred in Example 5 was selected. The specific identification steps are as follows: 1. Take one leg of the aforementioned Hawaiian shrimp larvae and use the Tiangen DP316 micro-sample genomic DNA extraction kit to extract genomic DNA. Use the genomic DNA as a template and use the aforementioned primers F and R for PCR amplification. The PCR amplification system is 25 μL, including 0.5 μL of upstream primers and downstream primers, 1 μL of template DNA, 10 μL of 2× M5 HiPer plus Taq HiFiPCR mix, and dd H 2 O 8μL. PCR reaction program: 95℃ pre-denaturation for 3min; 94℃ denaturation for 25s, 55℃ annealing for 25s, 72℃ extension for 10s, a total of 30 cycles; 72℃ extension for 10min.

[0036] 2. Perform agarose gel electrophoresis on the amplified PCR product. The operation of agarose gel electrophoresis to detect PCR products is as follows: first weigh 0.25g of agarose, measure 25ml 1×TAE buffer to prepare 1% gel solution, then heat the solution to boiling to completely melt the agarose, add 2μl GelStain nucleic acid dye (Full Gold GS101-02), pour into the horizontal plate of the electrophoresis tank and wait for it to solidify. After solidification, draw 3μl of the PCR product into the groove, and add 1000bp DNA marker to an empty groove. Run the gel at 220V for 15 minutes.

[0037] The results show that ( Figure 3), the PCR products of lane 1 (labeled as Hawaiian shrimp 1) and lane 2 (labeled as Hawaiian shrimp 2) both have a target band at 250-500 bp, indicating that Hawaiian shrimp 1 and Hawaiian shrimp 2 are male Hawaiian shrimp. The PCR products of lane 3 (labeled as Hawaiian shrimp 3) and lane 4 (labeled as Hawaiian shrimp 4) do not have a target band at 250-500 bp. The target bands of the male Hawaiian shrimp 1 and Hawaiian shrimp 2 were recovered and sequenced, and the sequencing results showed that the nucleotide sequences of the target bands of Hawaiian shrimp 1 and Hawaiian shrimp 2 were both nucleotides 27-318 of SEQ ID No.1.

[0038] Example 4: Collection and identification of Hawaiian shrimp Source of Hawaiian shrimp: The first generation of Hawaiian shrimp was collected from the wild in Haikou City, Hainan Province. Subsequent Hawaiian shrimp were completely bred by themselves. The above-collected Hawaiian shrimp have the following morphological characteristics: the body is slightly flattened laterally, and the lateral lobes of the head are prominent. The eyes are large, oval, and dark brown. The thoracic segments are smooth, and the posterior and lower corners of the 1st to 3rd abdominal segments are blunt. The tail segment has two lobes, the lobes are triangular, and there is a bristle at the end. The first antenna is slightly shorter, and the 3 segments of the stalk are almost equal in length, with long bristles on the lower edge. The whip is slightly longer than the stalk, with 12 segments. The second antenna is longer than the first antenna, the terminal segment of the stalk is longer, with long bristles, and the whip is longer, with 20 segments. The female antennae are thinner and weaker. The front edge of the upper lip is slightly arched and has fine hairs. The incisors and molars of the mandibles are well developed, and there are no tentacles. The lower lip has no inner lobe, and the lateral lobe is more prominent. The inner plate of the mandible is narrow, with 1 bristle at the end, and the top of the outer plate has a thorn, and the tentacles have 1 segment and 1 bristle at the end. The front edge of the inner plate of the second maxilla has a long and strong seta. The inner and outer plates of the maxilla are smaller, with well-developed antennae and 4 segments. The base plates of the 1st to 4th segments are broad, and the base plates of the 5th and 6th segments have front and rear lobes. The branchiopod is sub-chelicerate. The first branchiopod of the male is smaller, with a sharp lower angle after the long segment, a triangular carpal segment, an oval palm segment, an oblique palm margin with small spines, and a protrusion on the ventral margin with seta, and the knuckles are claw-like. The second branchiopod of the male is strong, with a front terminal process of the long segment, a sharp rear terminal angle, a short carpal segment, located between the long and palm segments, and no protruding leaves. The palm segment is oval and large, with a smooth dorsal margin, an oblique and long palm margin with a small spine, and the palm horn is bounded by two small spines, and the ventral margin is short, and the knuckles are claw-like. The first branchiopod of the female is similar to that of the male, and the second branchiopod of the female is similar to the first branchiopod, but larger, with a more prominent lobe after the carpal segment, and a more oblique palm margin of the palm segment. The third and fourth walking legs are simple, the fifth to seventh walking legs are stronger, the base segment is oval, the long, wrist, and palm segments have small spines on the side edges, the knuckles are claw-shaped, and there is a ventral spine. The first and second tail limbs have lateral spines and marginal spines on the handle, and the third tail limb is short, the outer limb is long and has spines, the inner limb is very small, and has a bristle at the end. The above characteristics are consistent with the description in "Ren Xianqiu. Chinese Fauna Invertebrates Volume 41 Crustacea Subphylum Amphipoda Hawaiian Shrimp Suborder (I). Beijing: Science Press, 2006, 395-396".

[0039] The sequencing identification method was as follows: After the Hawaiian shrimp genomic DNA was extracted using an animal tissue genomic DNA extraction kit (Tiangen Company, Beijing, China), the COI gene was selected for amplification and sequencing. The upstream primer sequence of the COI gene (5'-3'): GGTCAACAAATCATAAAGATATTGG, the downstream primer sequence of the COI gene (5'-3'): TAAACTTCAGGGTGACCAAAAAATCA. The PCR amplification system was 25 μL, including 0.5 μL of upstream primer and downstream primer, 1 μL of template DNA, 10 μL of 2× M5 HiPer plus Taq HiFi PCR mix, dd H 2 O 8μL. PCR reaction program: 95℃ pre-denaturation for 3min; 94℃ denaturation for 25s, 55℃ annealing for 25s, 72℃ extension for 10s, a total of 30 cycles; 72℃ extension for 10min. The obtained PCR product was sequenced by Sangon Biotech Co., Ltd. The sequencing identification results showed that the COI gene sequence of Hawaiian shrimp is as follows.

[0040] Based on the COI gene sequence of Hawaiian shrimp, a BLAST comparison of COI gene was performed on the NCBI website. The results showed that the COI sequence of Hawaiian shrimp was similar to that of Hawaiian shrimp ( Parhyale hawaiensis ) has a COI sequence similarity of 100%. Combining the morphological and molecular identification results, the Hawaiian shrimp was identified as Hawaiian shrimp ( Parhyale hawaiensis ).

[0041] COI gene sequence of Hawaiian shrimp: 5'--3'.

[0042] Example 5: Method for artificially raising and breeding Hawaiian shrimp Artificial seawater with a salinity of 30% was prepared by adding 30 g of sea salt to 1 L of deionized water. The salinity of the artificial seawater was detected by a handheld refractometer to be 30%.

[0043] Hawaiian shrimp are organisms that reproduce by carrying eggs. The steps for raising and breeding Hawaiian shrimp are as follows: 1. Mating Sexually mature Hawaiian shrimp were taken, and the male and female individuals were distinguished. 500-600 male Hawaiian shrimp and 500-600 female Hawaiian shrimp (male-female ratio was 1:1) were placed in the same breeding box (the breeding box was pre-placed with artificial seawater with a salinity of 30% and a height of 10 cm), and then the breeding box was placed in a small Hawaiian shrimp breeding room, and the indoor temperature of the small Hawaiian shrimp breeding room was 26-28°C and the indoor humidity was 40-60%.

[0044] Feed artificial feed or natural feed once a week, wherein the artificial feed is cichlid fish food (small particles) (purchased from: Dolphin Aquarium Co., Ltd., Pengjiang District, Jiangmen City, Guangdong Province) and spirulina tablets (sinking type, thin type) (purchased from: American Ocean Nutrition Products Co., Ltd.); the natural feed is carrots, kelp, dead leaves, snapdragon, cucumber, apple, potato, banana, cantaloupe, watermelon, pear or peach. The artificial seawater with a salinity of 30% is regularly replaced in the Hawaiian shrimp breeding box once a week. An attachment matrix is ​​placed at the bottom of the breeding box, and the attachment matrix is ​​coral stone or fine sand.

[0045] Before and after mating, the oxygen flow rate is adjusted to 1.5-4.5 liters / min (2L / min is optimal) through the oxygen generator. The water flow brought by the oxygenation can promote the swimming and chasing of Hawaiian shrimp adults, thus successfully reproducing. At the same time, the water temperature is controlled at 26-28℃ through the heating device.

[0046] 2. Embryo culture The female Hawaiian shrimp with eggs is anesthetized by carbon dioxide, and the carbon dioxide is introduced for 10-15 seconds. The fertilized eggs in the abdomen of the female Hawaiian shrimp are taken out and placed in a 6 cm culture dish (pre-added with 1 / 3 to 2 / 3 of the culture medium of the culture dish volume), and the number of fertilized eggs in each culture dish does not exceed 25. The culture dish is placed on a moist absorbent sponge (to reduce the evaporation of seawater in the culture dish), and then the culture dish and the absorbent sponge are placed in a rectangular square plate, and cultured in an artificial climate box (temperature 26°C, relative humidity 80%, light 8h / dark 16h). After 10-12 days, the Hawaiian shrimp embryos are hatched to obtain juvenile Hawaiian shrimp. The culture medium of the Hawaiian shrimp embryos cultured in vitro is changed once a day, and the dead embryos are removed when the culture medium is changed every day.

[0047] The above absorbent sponge was soaked with distilled water every three days.

[0048] The above-mentioned antibiotics may be penicillin, streptomycin, amphotericin and griseofulvin.

[0049] The reserved volume in the culture dish facilitates the culture matrix in the culture dish to dissolve oxygen in the air, providing enough oxygen for the hatching of the embryo. The culture matrix is ​​filtered artificial seawater containing antibiotics. The specific preparation method of the culture matrix is: the artificial seawater is filtered through a diaphragm vacuum pump, the pore size of the filter membrane in the diaphragm vacuum pump is 0.02 microns, and the volume percentage of the antibiotics is 0.0015%. Before use, the culture matrix in the glass bottle is gently shaken to dissolve the oxygen in the air into the culture matrix to achieve the purpose of pre-oxygenation.

[0050] 3. Larval stage Transfer the Hawaiian shrimp larvae obtained in 2 to a beaker through a filtration device, and then transfer the Hawaiian shrimp larvae in the beaker to a new breeding box. The breeding method is the same as "1. Mating". After 7-8 weeks of breeding and reaching sexual maturity, the breeding and reproduction can be carried out according to 1 and 2.

[0051] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Use of a molecular marker for sex identification of Hawaiian shrimp or a substance for detecting the molecular marker for sex identification of Hawaiian shrimp in identifying or assisting in identifying the sex of Hawaiian shrimp, wherein the molecular marker for sex identification of Hawaiian shrimp is a DNA fragment having a nucleotide sequence of positions 27-318 of SEQ ID No.

1.

2. Use of a substance for detecting whether the genome of a Hawaiian shrimp contains a DNA fragment with nucleotides at positions 27-318 of SEQ ID No. 1 in identifying or assisting in identifying the sex of a Hawaiian shrimp.

3. The use according to claim 1 or 2, characterized in that: The material contains PCR primers for amplifying a DNA fragment of the Hawaiian shrimp genome containing the Hawaiian shrimp sex identification molecular marker.

4. The use according to claim 3, characterized in that: The PCR primers are a primer pair, which consists of a forward primer and a reverse primer. The forward primer is a single-stranded DNA with a nucleotide sequence of SEQ ID No.2, and the reverse primer is a single-stranded DNA with a nucleotide sequence of SEQ ID No.

3.

5. A method for identifying or assisting in identifying the sex of Hawaiian gammarus, characterized in that: The method comprises the following steps: (1) using the genomic DNA of the Hawaiian shrimp to be identified as a template, and performing PCR amplification using any one of the PCR primers described in claim 3 or 4 to obtain a PCR product; (2) Identifying the sex of the Hawaiian shrimp based on whether the PCR product contains the Hawaiian shrimp sex identification molecular marker described in claim 1.

6. A method for identifying or assisting in identifying the sex of Hawaiian gammarus, characterized in that: The method comprises the following steps: (1) using the genomic DNA of the Hawaiian shrimp to be identified as a template, and performing PCR amplification using any one of the PCR primers described in claim 3 or 4 to obtain a PCR product; (2) The sex of the Hawaiian shrimp is identified based on whether the PCR product contains a specific DNA fragment, wherein the size of the specific DNA fragment is 292 bp.

7. The method according to claim 5 or 6, characterized in that: The PCR product contains the Hawaiian shrimp sex identification molecular marker or contains a DNA fragment with a size of 292 bp, and the Hawaiian shrimp to be identified is or is a candidate for a male Hawaiian shrimp. The PCR product does not contain the Hawaiian shrimp sex identification molecular marker or does not contain a DNA fragment with a size of 292 bp, and the Hawaiian shrimp to be identified is or is a candidate for a female Hawaiian shrimp.

8. A DNA molecule, characterized in that The DNA molecule is a Hawaiian hook sex identification molecular marker whose nucleotide sequence is positions 27-318 of SEQ ID No.

1.

9. Application of the DNA with the nucleotide sequence of positions 27-318 of SEQ ID No. 1 in the analysis of Hawaiian shrimp germplasm resources or molecular marker-assisted breeding.

10. Use of the PCR primers according to claim 3 or 4 in the analysis of Hawaiian shrimp germplasm resources or molecular marker-assisted breeding.

Images