PiRNA (piribose nucleic acid) marker for diagnosing and evaluating myocardial aging, kit and application of piRNA marker

Abstract

The invention discloses a piRNA marker for diagnosing and evaluating myocardial aging, a kit and application of the piRNA marker. The application of the miRNA marker comprises one or more of the following applications: A1) application in preparation of a product for diagnosing myocardial aging; a2) in preparation of products for screening myocardial aging; a3) in preparation of a product for treating myocardial aging; a4) in preparation of myocardial aging condition assessment products; a5) in preparation of products for identifying and distinguishing myocardial aging and other heart diseases; the piRNA marker is piR-hsa-014388, and the nucleotide sequence of the piRNA marker is as shown in SEQ ID No. 1. The expression quantity of the piRNA marker provided by the invention in the plasma of a myocardial aging patient is obviously increased compared with that of a healthy control person, which indicates that the piR-hsa-014388 has the potential to be used as the myocardial aging biomarker.

Description

Technical Field

[0001] The invention relates to a marker for diagnosing myocardial aging, specifically a piRNA marker, and also relates to a kit for detecting the piRNA marker and application thereof, belonging to the field of medical molecular diagnosis. Background Art

[0002] Cardiovascular disease is the leading cause of death among the elderly worldwide, and myocardial aging is a key factor. It not only increases the incidence of cardiovascular disease, but is also closely related to the high hospitalization rate, mortality rate and increased medical expenses of the elderly. The characteristics of myocardial aging are manifested at the histological and biochemical levels, including oxidative stress, protein misfolding, cell death and mitochondrial dysfunction. These changes lead to weakened heart pumping function and reduced myocardial compliance, which may eventually develop into heart failure. The aging process of cardiomyocytes involves multiple aspects such as autophagy, oxidative stress, epigenetic modification and chronic inflammation.

[0003] In clinical practice, improving the ability to diagnose myocardial aging at an early stage is crucial for the prevention and treatment of cardiovascular diseases. At present, echocardiography and electrophysiological testing are commonly used methods to evaluate cardiac function, but these methods can only be effectively detected after significant changes in cardiac structure and function have occurred, and early diagnosis cannot be achieved. Existing biomarkers, such as cardiac troponin (cTn), creatine kinase isoenzyme (BNP), and myoglobin (Myo), are mainly used to detect myocardial damage rather than myocardial aging, and have certain limitations, such as the inability to reflect changes in myocardial aging in a timely manner. Therefore, there is an urgent need to discover new biomarkers that can detect myocardial aging at an early stage in clinical practice.

[0004] PIWI-interacting RNAs (abbreviated as piRNAs) are a class of small non-coding RNAs first discovered in Drosophila germ cells. They contain 24 to 31 nucleotides and lack clear secondary structure motifs. They interact with PIWI proteins and participate in transposon silencing and gene expression regulation. The uniqueness of piRNAs is that they rely on RNA type III enzymes for processing to form functional small RNA molecules. Although the application of piRNAs as biomarkers in cancer prognosis assessment has been reported, there are relatively few studies on cardiovascular diseases, especially myocardial aging. The potential of piRNAs is that they may become sensitive and specific biomarkers for detecting myocardial aging, which can help evaluate different stages of myocardial aging. Summary of the invention

[0005] The primary technical problem to be solved by the present invention is to provide a new application of piRNA markers. The piRNA markers can not only be used to prepare substances for diagnosis, screening, disease assessment and differentiation of myocardial aging and other heart diseases, but also become new targets for the treatment of myocardial aging-related diseases.

[0006] Another technical problem to be solved by the present invention is to provide a kit for detecting the piRNA marker. The kit can be used for diagnosis, screening, disease assessment and differentiation of myocardial aging and other heart diseases.

[0007] The third technical problem to be solved by the present invention is to provide a primer for detecting the piRNA marker. The primer can be used for diagnosis, screening, disease assessment and differentiation of myocardial aging and other heart diseases.

[0008] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0009] According to a first aspect of an embodiment of the present invention, there is provided an application of a substance for detecting a piRNA marker, including one or more of the following applications:

[0010] A1) Application in the preparation of products for diagnosing myocardial aging;

[0011] A2) Application in the preparation of products for screening myocardial aging;

[0012] A3) Application in the preparation of products for treating myocardial aging;

[0013] A4) Application in the preparation of myocardial aging condition assessment products;

[0014] A5) Application in the preparation of products for identifying and distinguishing myocardial aging from other heart diseases;

[0015] The piRNA marker is piR-hsa-014388, and the nucleotide sequence is shown in SEQ ID No.1.

[0016] The "product" can be a product for diagnosing myocardial aging by detecting the expression level of p iR-hsa-014388 through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

[0017] In the above applications, piR-hsa-014388 expression was significantly upregulated in the plasma samples of patients with myocardial aging; the expression level of piR-hsa-014388 in healthy people was significantly lower than that in patients with myocardial aging.

[0018] Preferably, the substance is a reagent for detecting the expression level of piR-hsa-014388, or a reagent for specifically identifying piR-hsa-014388, or a reagent for detecting the content of piR-hsa-014388.

[0019] Preferably, the substance is a substance for detecting p iR-hsa-014388, specifically the following a), b) or c)

[0020] a) primers for detecting or specifically recognizing p iR-hsa-014388;

[0021] b) a reagent set containing the reagent described in a);

[0022] c) A kit containing a) or b).

[0023] Preferably, the primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0024] According to a second aspect of an embodiment of the present invention, a kit for detecting a piRNA marker is provided, the kit comprising one or more of the following applications:

[0025] A1) Application in the preparation of products for diagnosing myocardial aging;

[0026] A2) Application in the preparation of products for screening myocardial aging;

[0027] A3) Application in the preparation of products for treating myocardial aging;

[0028] A4) Application in the preparation of myocardial aging condition assessment products;

[0029] A5) Application in the preparation of products for identifying and distinguishing myocardial aging from other heart diseases;

[0030] The piRNA marker is piR-hsa-014388, and the nucleotide sequence is shown in SEQ ID No.1; the kit includes a reagent for detecting or specifically identifying piR-hsa-014388, or a reagent for detecting the expression level of piR-hsa-014388.

[0031] The kit provided by the present invention can be used to detect the expression of the p iR-hsa-014388 characteristic gene sequence shown in SEQ ID NO.1 in the peripheral blood of the subject, and then the probability of myocardial aging in the subject can be determined based on the information of up-regulation or down-regulation of the gene expression, thereby realizing the diagnosis of myocardial aging.

[0032] The kit provided by the present invention may include appropriate packaging and instructions for use in the method disclosed by the present invention. Preferably, the detection kit provided by the present invention is a nucleic acid detection kit, including reagents required for RNA extraction and real-time fluorescence quantitative PCR (qRT-PCR). The kit may further include appropriate buffer and polymerase, and may also include control primers and / or probes.

[0033] Preferably, the reagent for detecting or specifically identifying p iR-hsa-014388 is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0034] According to a third aspect of an embodiment of the present invention, a primer for detecting a piRNA marker is provided, wherein the primer comprises one or more of the following applications:

[0035] A1) Application in the preparation of products for diagnosing myocardial aging;

[0036] A2) Application in the preparation of products for screening myocardial aging;

[0037] A3) Application in the preparation of products for treating myocardial aging;

[0038] A4) Application in the preparation of myocardial aging condition assessment products;

[0039] A5) Application in the preparation of products for identifying and distinguishing myocardial aging from other heart diseases;

[0040] The primers are primers for detecting the expression level of p iR-hsa-014388 or specifically identifying p iR-hsa-014388.

[0041] Preferably, the primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0042] Compared with the prior art, the present invention has the following technical effects:

[0043] (1) The present invention found that piR-hsa-014388 has the potential to be a new biomarker for the diagnosis of myocardial aging. In clinical validation experiments, the piR-hsa-014388 content in the plasma of patients with myocardial aging was significantly increased compared with healthy controls. This finding suggests that piR-hsa-014388 may be a potential biomarker for identifying myocardial aging.

[0044] (2) The efficacy of piR-hsa-014388 in diagnosing myocardial aging was evaluated by receiver operating characteristic (ROC) curve analysis, showing good sensitivity and specificity, which indicates that piR-hsa-014388 has high diagnostic accuracy.

[0045] (3) The study also found that there was a positive correlation between the expression level of β-galactosidase, a marker of cardiomyocyte aging, and piR-hsa-014388. This result further confirmed the close connection between piR-hsa-014388 and cell aging and supported its potential as a biomarker for diagnosing cardiomyocyte aging.

[0046] (4) In clinical experiments, BNP, a common biomarker for myocardial aging and heart failure, was positively correlated with the expression of piR-hsa-014388. BNP is a peptide hormone synthesized by the heart when the ventricular wall is dilated or stretched, reflecting the compensatory function of the heart. The positive correlation between piR-hsa-014388 and BNP levels indicates that changes in piR-hsa-014388 plasma levels can reflect the severity of myocardial aging and help assess the condition of myocardial aging.

[0047] (5) In in vitro cellular experiments, AC16 cardiomyocytes treated with D-gal showed an increase in piR-hsa-014388 expression, indicating that piR-hsa-014388 levels increase during cardiomyocyte aging. This finding provides a cellular and molecular basis for piR-hsa-014388 as a diagnostic biomarker for cardiomyocyte aging. In a D-gal-induced cell aging model, aging was alleviated by knocking down piR-hsa-014388, which further proves that piR-hsa-014388 may become a diagnostic biomarker and therapeutic target for cardiomyocyte aging.

[0048] (6) The results of immunofluorescence experiments showed that after knocking down piR-hsa-014388, the expression of β-galactosidase (a marker protein for cell aging) in AC16 cardiomyocytes treated with D-gal decreased, and the fluorescence intensity weakened. This indicates that knocking down piR-hsa-014388 can reduce the degree of cell aging induced by D-gal, thereby exerting an anti-aging effect at the cellular level. These results further support the possibility of piR-hsa-014388 as a therapeutic target for myocardial aging. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 The volcano plot of piRNA expression differences between aged cardiomyocytes AC 16 and normal controls obtained by sequencing;

[0050] Figure 2 To determine the content of piR-hsa-014388 in the plasma of patients with myocardial aging and normal controls by qRT-PCR;

[0051] Figure 3 ROC curve for diagnosing myocardial aging patients with p iR-hsa-014388;

[0052] Figure 4 is the relationship between the positive ratio of senescence marker β-galactosidase and the expression level of p iR-hsa-014388 in cardiomyocytes induced by D-gal;

[0053] Figure 5 is the relationship between the patient's BNP and the expression level of p iR-hsa-014388;

[0054] Fig. 6A is a graph showing the expression of piR-hsa-014388 after AC 16 was transfected with piR-hsa-014388 small interfering RNA;

[0055] Figure 6B This is a graph of mRNA expression after AC16 was transfected with piR-hsa-014388 small interfering RNA;

[0056] Fig. 7A The expression of P21 mRNA in D-gal-induced cardiomyocytes after siRNA knockdown of piR-hsa-014388 in AC16;

[0057] Figure 7B The expression of IL-1β mRNA in cardiomyocytes induced by D-gal after siRNA knockdown of piR-hsa-014388 in AC16;

[0058] Figure 8 The expression levels of piR-hsa-014388 and BNP after AC16 was treated with D-gal for knockdown of piR-hsa-014388 and control group;

[0059] Fig. 9 Immunofluorescence was used to determine the expression of β-gal, a marker of cell senescence. DETAILED DESCRIPTION

[0060] The present invention is further described below in conjunction with specific examples. These examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions or according to the conditions recommended by the manufacturer. Unless otherwise defined, all professional and scientific terms used in the text have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described contents can be applied to the method provided by the present invention. The preferred implementation methods and materials described in the text are for demonstration purposes only.

[0061] The research and development process and ideas of the present invention: First, 3 naturally aged AC16 cardiomyocytes and 3 normal control cells were selected, total RNA was extracted from these cells, and sent to Guangzhou Epigenetics Company for piRNA sequencing. Through sequencing, piRNAs with significant differences in expression levels (Fold change ≥ 2.0, P value < 0.05) were screened. Subsequently, the qRT-PCR technology was used to determine the content of the top 10 piRNAs in the sequencing results in the patient's plasma, and the first piRNA with a significantly increased expression level, namely piR-hsa-014388, was selected for subsequent experiments. In order to further verify the association between the expression level of piR-hsa-014388 and myocardial aging, the inventors once again verified the expression level of piR-hsa-014388 in in vitro experiments through experiments at the cellular level to confirm its potential as a biomarker for myocardial aging. The specific experimental data are as follows:

[0062] Example 1 Screening and correlation study of myocardial aging piRNA markers

[0063] 1. Sample and Methods:

[0064] 1.1 Clinical samples:

[0065] Venous blood samples from two groups of people of different ages were collected from the General Hospital of the Chinese People's Liberation Army between 2020 and 2023. The first group included 50 patients aged between 60 and 90 years old with no record of hospitalization for heart disease, and the second group included 50 healthy subjects aged no more than 30 years old. These two groups of samples were defined as the aging group and the control group, respectively, for the purpose of subsequent experiments to determine the levels of piRNA in plasma. Through this grouping and sample collection, the aim is to explore the differences in piRNA levels in plasma of different age groups, and then evaluate the potential of piRNA as a biomarker of myocardial aging.

[0066] Inclusion criteria:

[0067] (1) Inpatients aged 60 years or younger and younger than 90 years;

[0068] (2) Healthy subjects aged ≤30 years old;

[0069] (3) Complete blood sample information is available.

[0070] Exclusion criteria: malignant tumors, severe liver and kidney dysfunction, severe autoimmune diseases, severe blood system diseases or other cardiovascular diseases such as coronary heart disease, valvular heart disease and cardiomyopathy.

[0071] 1.2 Methods:

[0072] 1.2.1 Plasma extraction: Human peripheral blood was collected using EDTA anticoagulant blood collection tubes, centrifuged at 2500 g for 15 min, and the upper plasma was collected into a 2 ml sterile tube and stored in a -80 °C refrigerator.

[0073] 1.2.2 RNA extraction and real-time fluorescence quantitative PCR (qRT-PCR):

[0074] Total RNA was extracted from AC16 using RNA Spectrum Total RNA Kit (DP419, TIANGEN, Beijing, China).

[0075] (1) RNA extraction

[0076] The extraction of tissue RNA from plasma samples followed the instructions for use of TRIZOL Reagent (Invitrogen). At the beginning of the operation, 1 ml of TRIZOL Reagent (Invitrogen) was added to the plasma, followed by 200 μL of chloroform, and the mixture was thoroughly mixed by shaking for 20 seconds. Next, the mixture was allowed to stand at room temperature for 10 minutes to promote phase separation, and then centrifuged at 13,000 rpm at 4°C for 15 minutes. After the supernatant was carefully aspirated, 800 μL of isopropanol was added, gently inverted to mix, and allowed to stand at -20°C for 1 hour to promote RNA precipitation. Centrifuged again at 13,000 rpm at 4°C for 15 minutes, and then the supernatant was discarded. The precipitate was gently washed with 1 ml of 75% ethanol, centrifuged at 13,000 rpm at 4°C for 5 minutes, and the supernatant was removed and the precipitate was blown dry. Finally, an appropriate amount of enzyme-free water was added and dissolved at 65°C for 10 minutes to detect the OD value and concentration of RNA. The obtained RNA samples were stored at -80°C for subsequent use.

[0077] (2) RNA reverse transcription to cDNA

[0078] 500 ng of RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara RR037A).

[0079] (3) Reverse transcription of piRNA:

[0080] Operate on ice, 20 μL per reaction system, as shown in Table 1:

[0081] Table 1

[0082]

[0083] (4) Reverse transcription of mRNA:

[0084] Operate on ice, 20 μL per reaction system, as shown in Table 2:

[0085] Table 2

[0086]

[0087] The reaction procedure was: 37°C for 45 min, 85°C for 5 min, and maintain at 4°C.

[0088] (5) qRT-PCR

[0089] According to the piRNAs primer design principles, piRNAs primer sequences were designed.

[0090] The cDNA obtained by reverse transcription reaction was diluted 1:10 and subjected to the following qRT-PCR reaction.

[0091] Operate on ice, 20 μL per reaction system, as shown in Table 3:

[0092] Table 3

[0093]

[0094] After the reaction solution is mixed, the Real-time PCR instrument reaction program is performed as follows:

[0095] Stage 1: 95°C for 2 minutes;

[0096] Stage 2: 35 cycles, each cycle consisting of 94°C for 5 seconds and 60°C for 1 minute;

[0097] Stage 3: 95℃ for 15 seconds, 60℃ for 1 minute, then back to 95℃ for 5 seconds.

[0098] GAPDH was used as an internal reference gene in the experiment to quantitatively analyze the relative levels of each mRNA, and the expression levels of these mRNAs were expressed by calculating the relative ratios.

[0099] 1.2.3piRNA sequencing analysis:

[0100] Three naturally aged AC16 cardiomyocytes and three normal control cells were selected, and their total RNA was extracted and sent to Guangzhou Epigenetics for piRNA sequencing. Through sequencing, piRNAs with significant expression differences (Fold change ≥ 2.0, P value < 0.05) were screened. Subsequently, the top 10 piRNA levels in the patient's plasma were measured using qRT-PCR technology, and the first piRNA with significantly increased expression, i.e., piR-hsa-014388, was selected for subsequent experiments. Figure 1 As shown in the figure, the volcano plot of the difference in piRNA expression between aged cardiomyocytes AC16 and normal control cells is presented; Table 4 lists the top 10 upregulated piRNAs in the sequencing results, among which piR-hsa-014388 was selected for further study due to its highest expression level.

[0101] Table 4 Top 10 upregulated piRNAs obtained from sequencing data

[0102]

[0103] 1.2.4ROC curve drawing:

[0104] The receiver operating characteristic (ROC) curve is a tool for displaying the performance of diagnostic markers by drawing a graph of true positive rate (sensitivity) versus false positive rate (1-specificity). The curve is calculated by a series of cutoff values ​​based on the measurement results of the test group and the control group, and the corresponding sensitivity and specificity are respectively calculated, and these calculated points are connected into a line on the coordinate graph to form a ROC curve. In the present invention, the 9.1.0 version of GraphPad Prism software is used to draw the ROC curve to evaluate the diagnostic ability of a specific biomarker to a disease.

[0105] 1.2.5 Statistical analysis:

[0106] For variables that conformed to normal distribution, t-test and analysis of variance were used; for variables that did not conform to normal distribution, Mann-Whitney U test and Kruskal-Wal lis test were used for analysis. All statistical analyses were performed using R software (version 3.4.2) and GraphPad Prism software (version 8.00). The results of biological replicates of the experiment were presented in the form of single data points on the bar graph. In terms of statistical significance, a P value of less than 0.05 was considered to indicate a significant difference.

[0107] 2. Verification results:

[0108] like Figure 2 As shown, the qRT-PCR method was used to determine the piR-hsa-014388 content in the plasma of patients with myocardial aging. The results showed that the expression of piR-hsa-014388 in the plasma of patients with myocardial aging was significantly higher than that in the plasma of healthy controls, indicating that piR-hsa-014388 is a potential biomarker for myocardial aging.

[0109] like Figure 3 As shown, piR-hsa-014388 showed excellent diagnostic performance in the diagnosis of myocardial aging. The curve details the relationship between sensitivity and specificity of piR-hsa-014388 as a biomarker, where sensitivity is expressed as the true positive rate and specificity is expressed by 1-specificity. The area under the curve (AUC) is a key indicator for measuring diagnostic efficacy. The AUC value of piR-hsa-014388 is close to 1, indicating that it has a high accuracy in distinguishing patients with myocardial aging from non-aging individuals.

[0110] Example 2: Further verification of the relationship between piR-hsa-014388 and myocardial aging using β-galactosidase staining experiments relation

[0111] 1. Experimental purpose:

[0112] After a limited number of divisions, normal cells stop dividing and irreversible growth arrest occurs. At this time, the cells enter a state of senescence, and the β-galactosidase associated with senescence is activated. β-galactosidase is a hydrolase in the cell lysosome, but the activity of this enzyme is upregulated in senescent cells. Based on this phenomenon and principle, with galactoside as a substrate, senescent cell-specific β-galactosidase catalyzes the substrate to produce a blue product, which is manifested as a blue deposit in the cell cytoplasm. Under an optical microscope, cells or tissues expressing β-galactosidase that have turned blue can be easily observed. The β-galactosidase staining experiment is the gold standard for determining whether cells are senescent in cell molecular experiments.

[0113] 2. Experimental methods:

[0114] In the experiment, the galactosidase staining kit (C0602) provided by Beyotime was used to stain AC16 cardiomyocytes to detect cell senescence. First, the cell culture medium cultured in the 6-well plate was aspirated and the cells were washed once with phosphate buffered saline (PBS). Then, 1 ml of β-galactosidase staining fixative was added to fix the cells at room temperature for 15 minutes. After fixation, the fixative was aspirated and the cells were washed again three times with PBS, each wash lasting 3 minutes. After PBS was aspirated, 1 ml of pre-prepared staining working solution was added to each well. The staining working solution was mixed with 10 μL of β-galactosidase staining solution a, 10 μL of β-galactosidase staining solution b, 930 μL of β-galactosidase staining solution c, and 50 μL of X-Gal solution. Subsequently, the 6-well plate was sealed with plastic wrap to prevent liquid evaporation and incubated overnight at 37°C. It should be noted that this incubation process should not be carried out in a carbon dioxide incubator. Finally, the staining results were observed by ordinary light microscopy.

[0115] 3. Statistical analysis methods:

[0116] Cells stained blue under an optical microscope were considered positive cells, and the number of positive cells per 100 cells was randomly selected to determine the positive cell ratio (%). The positive cell ratio of each sample was correlated with piR-hsa-014388.

[0117] 4. Experimental results:

[0118] like Figure 4 As shown in the figure, the expression levels of β-galactosidase, a senescence marker of cardiomyocytes, and piR-hsa-014388 have a good correlation, and the two are positively correlated. This shows that the relationship between piR-hsa-014388 and cell senescence is certain and has good diagnostic efficacy.

[0119] Example 3 Experiment on the relationship between BNP and piR-hsa-014388 expression

[0120] B-type natriuretic peptide (BNP) and its precursor N-terminal pro-B-type natriuretic peptide (NT-proBNP) are biomarkers of cardiac function and play a key role in the diagnosis, differential diagnosis, severity and prognosis of heart failure. In healthy adults, the normal concentration of BNP should be less than 100 ng / L. With age and decreased cardiac function, BNP levels will gradually increase, and levels above 100 ng / L are usually considered abnormal. According to the expert consensus of the American College of Cardiology (ACC) in 2004, when the BNP level is less than 100 ng / L, the possibility of heart failure is very small, and its negative predictive value is 90%; when the BNP level is higher than 500 ng / L, the possibility of heart failure is very high, and the positive predictive value is also 90%. Therefore, BNP levels within the normal range can help exclude the diagnosis of acute heart failure.

[0121] The distribution of BNP in the heart is mainly concentrated in the left and right atria, among which the BNP content in the right atrium is more than three times that in the left atrium. In contrast, the BNP content in the ventricles is less, because the BNP precursor is not stored in the ventricles. Only when the ventricular wall tension increases will it stimulate the high expression of the BNP gene, thereby rapidly synthesizing and secreting a large amount of BNP into the blood. In short, the increase in BNP levels in plasma reflects cardiac systolic or diastolic dysfunction, resulting in insufficient venous return to the heart, and the production of BNP when the ventricles are stretched, and this increase shows a dynamic change pattern.

[0122] Myocardial aging is a process in which the function and efficiency of the heart muscle gradually decline with age. This process may lead to weakened heart pumping function and poor blood circulation, which in turn increases the release of BNP. Therefore, BNP levels are an important indicator for assessing myocardial aging and heart failure risk.

[0123] Figure 5 The relationship between BNP and p iR-hsa-014388 expression in patient plasma is shown. Figure 5 It can be observed that BNP is positively correlated with the expression of p iR-hsa-014388. Since BNP is a hallmark protein of heart failure, the positive correlation between p iR-hsa-014388 and BNP levels indicates that changes in p iR-hsa-014388 levels in plasma can reflect the severity of the disease, which provides strong evidence for p iR-hsa-014388 as a potential biomarker for myocardial aging and heart failure risk assessment.

[0124] Example 4 In vitro experimental cell level verification of the relationship between the expression level of piR-hsa-014388 and myocardial aging

[0125] 1. Materials and Methods

[0126] 1.1 Cell culture:

[0127] The human cardiomyocyte cell line AC16 was obtained from Wuhan Pronocell Biotechnology Co., Ltd. The cell culture conditions were RPMI-1640 medium supplemented with 10% fetal bovine serum, and the culture process was carried out in a constant temperature incubator at 37°C and 5% carbon dioxide.

[0128] In the siRNA knockdown experiment, the siRNA used was purchased from Thermo Fisher Scientific. The experimental operation followed the instructions provided by the manufacturer. When the cells reached 70% confluence, siRNA was added to the culture system. After 24 hours of induction treatment, the knockdown effect of siRNA was quantitatively analyzed by qRT-PCR technology to evaluate the inhibitory efficiency of siRNA on target gene expression.

[0129] 1.2 Cell senescence induction treatment:

[0130] In the experiment, cardiomyocytes AC 16 were exposed to 10mM D-galactose (D-gal) to induce cellular senescence. As an effective inducer of aging models, D-galactose has a glycation effect that exceeds that of glucose and can trigger oxidative stress. At specific concentrations, D-galactose can induce cellular toxicity and aging characteristics, including increased levels of B-type natriuretic peptide (BNP) secreted by AC16 cardiomyocytes. After 24 hours of treatment, the expression levels of intracellular piRNAs and the concentration of BNP in the culture supernatant were measured by comparing the experimental group with the untreated control group cardiomyocytes.

[0131] 1.3 qRT-PCR method is the same as in Example 1.

[0132] 1.4 Determination of human plasma BNP:

[0133] When performing the enzyme-linked immunosorbent assay (ELISA) of human creatine kinase isoenzyme (BNP), the BNP ELISA kit (ZC-34224) provided by Zhuocai Biotechnology was used. The operation began by adding 100 μL of the standard or the sample to be tested to each well and equilibrating the kit at room temperature for 30 minutes. Subsequently, the required strips were taken out, and the remaining strips were sealed and returned to 4°C for storage. 50 μL of each standard of different concentrations was added to the standard well, 50 μL of the sample to be tested was added to the sample well, and nothing was added to the blank well. After that, 100 μL of the detection antibody labeled with horseradish peroxidase (HRP) was added to each well except the blank well, and covered with a sealing film and incubated at 37°C for 60 minutes. After incubation, the liquid in the well was discarded and patted dry with absorbent paper, and then each well was filled with washing solution (350 μL), left to stand for 1 minute, and then dried, and the washing was repeated 5 times. After washing, 50 μL of substrate A and B were added to each well, incubated at 37°C in the dark for 15 minutes, and then 50 μL of stop solution was added to each well, and the absorbance (OD) value of each well was measured at a wavelength of 450 nm within 15 minutes.

[0134] 1.5 Immunofluorescence staining of β-galactosidase experiment:

[0135] Cell fixation was performed by incubation at room temperature for 10 minutes with 4% paraformaldehyde, followed by washing the cells three times with pre-cooled phosphate buffered saline (PBS). To block nonspecific antibody binding, the cells were placed in a PBS-Tween20 (PBST) solution containing 1% bovine serum albumin (BSA) and incubated at room temperature for 30 minutes. Afterwards, the cells were incubated at 4°C for 6 hours with a specific β-galactosidase antibody from abcam (Cat. No. ab 136775). After the incubation, the antibody solution was poured out and the cells were washed three times with PBS for 5 minutes each. At room temperature, the cells were incubated with a fluorescently labeled secondary antibody provided by abcam (Cat. No. ab150113), which was pre-dissolved in a solution containing 1% BSA, incubated for 1 hour in the dark. After the incubation was completed, the secondary antibody solution was poured out and the cells were washed three times with PBS in the dark for 5 minutes each. Finally, the cell nuclei were stained with DAPI solution, and the fluorescence intensity of β-galactosidase was observed under a fluorescence microscope.

[0136] 2. Experimental results:

[0137] Fig. 6A It was shown that after AC16 cardiomyocytes were transfected with piR-hsa-014388 small interfering RNA (siRNA), the expression level of piR-hsa-014388 was significantly reduced. Figure 6BThe results showed that although the expression of piR-hsa-014388 was inhibited, the total amount of mRNA in the cells did not change, which confirmed the success of siRNA transfection and provided a reliable basis for subsequent experiments.

[0138] Fig. 7A and Figure 7B The expression of two senescence markers, P21 protein and IL-1β mRNA, in AC16 cardiomyocytes was described after piR-hsa-014388 was knocked down by siRNA. P21 is a marker protein for cell senescence, while IL-1β is associated with a secretory phenotype associated with cell senescence. The experimental results showed that after piR-hsa-014388 knockdown, the mRNA expression levels of both P21 and IL-1β were reduced, indicating that knockdown of piR-hsa-014388 can slow down the process of cell senescence, thus supporting the possibility that piR-hsa-014388 is a potential therapeutic target for cardiomyocyte senescence.

[0139] Figure 8 We further explored the expression changes of piR-hsa-014388 and B-type natriuretic peptide (BNP) in the D-galactose (D-gal)-induced aging model. D-gal is a known aging inducer that can cause upregulation of piR-hsa-014388 expression. The experiment observed that in cells where piR-hsa-014388 was knocked down, the expression level of BNP was reduced, which provides a cellular and molecular basis for piR-hsa-014388 as a diagnostic biomarker for myocardial aging.

[0140] Fig. 9 The expression of β-gal, a marker of cellular senescence, in AC16 cardiomyocytes of piR-hsa-014388 knockdown and control groups after D-gal treatment was determined by immunofluorescence experiments. Immunofluorescence experiments use the interaction between primary and secondary antibodies and substrates to observe the expression of related proteins in cells or tissues under a fluorescence microscope. The results showed that after knocking down piR-hsa-014388, the fluorescence intensity of β-gal was reduced, indicating that the expression of this protein in the cells was reduced. This result further confirmed that knocking down piR-hsa-014388 can reduce the degree of D-gal-induced cellular senescence, thereby supporting the potential of piR-hsa-014388 as a therapeutic target for myocardial aging at the cellular level.

[0141] Based on the above experimental results, piR-hsa-014388 has a significant correlation with the myocardial aging process and may become a new biological marker for myocardial aging. In the D-gal-induced myocardial cell aging model, the expression of piR-hsa-014388 was upregulated, and ROC curve analysis showed that it has a good ability to diagnose patients with myocardial aging. These findings indicate that piR-hsa-014388 may be involved in the induction of D-gal on myocardial cell aging. Therefore, piR-hsa-014388 is expected to become a new diagnostic biomarker and therapeutic target for myocardial aging.

[0142] Example 5 The present invention relates to sequences, primers and kit compositions

[0143] The myocardial aging marker piR-hsa-014388 provided by the present invention has a nucleotide sequence as shown in SEQ ID No.1.

[0144] SEQ ID No.1:TGGGTTGGCTGGTAAAGACAGGGGTAC

[0145] The primer pair for specifically recognizing piR-hsa-014388 provided by the present invention comprises an upstream primer as shown in SEQ ID No. 2 and a downstream primer as shown in SEQ ID No. 3:

[0146] SEQ ID No.2: GTCGTATCCAGTGCAGGGTCC

[0147] SEQ ID No.3: AACGATATGGGTTGGCTGGTAAAGAC

[0148] The kit provided by the present invention comprises:

[0149] 5x primer buffer, reaction enzyme combination I, Random 6mers, Oligo dT primer, RNase-free pure water, SYBR probe II (Tl i RNaseH Plus) (2x), PCR primer (F+R) (10uM), ROX Reference dye (50x).

Claims

1. An application of a substance for detecting piRNA markers, characterized in that Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing myocardial aging; A2) Application in the preparation of products for screening myocardial aging; A3) Application in the preparation of products for treating myocardial aging; A4) Application in the preparation of myocardial aging condition assessment products; A5) Application in the preparation of products for identifying and distinguishing myocardial aging from other heart diseases; The piRNA marker is piR-hsa-014388, and the nucleotide sequence is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The product is a product for diagnosing myocardial aging by detecting the expression level of piR-hsa-014388 through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

3. The use according to claim 1, characterized in that: The substance is a reagent for detecting the expression level of piR-hsa-014388, or a reagent for specifically identifying piR-hsa-014388, or a reagent for detecting the content of piR-hsa-014388.

4. The use according to claim 1, characterized in that: The substance is a substance for detecting piR-hsa-014388, including the following a), b) or c) a) primers for detecting or specifically recognizing piR-hsa-014388; b) a reagent set containing the reagent described in a); c) A kit containing a) or b).

5. The use according to claim 4, characterized in that: The primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

6. A kit for detecting piRNA markers, characterized in that Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing myocardial aging; A2) Application in the preparation of products for screening myocardial aging; A3) Application in the preparation of products for treating myocardial aging; A4) Application in the preparation of myocardial aging condition assessment products; A5) Application in the preparation of products for identifying and distinguishing myocardial aging from other heart diseases; The piRNA marker is piR-hsa-014388, and the nucleotide sequence is shown in SEQ ID No. 1; the kit includes a reagent for detecting or specifically identifying piR-hsa-014388, or a reagent for detecting the expression level of piR-hsa-014388.

7. The kit according to claim 6, characterized in that: The reagent for detecting or specifically identifying piR-hsa-014388 is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

8. A primer for detecting piRNA markers, characterized in that Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing myocardial aging; A2) Application in the preparation of products for screening myocardial aging; A3) Application in the preparation of products for treating myocardial aging; A4) Application in the preparation of myocardial aging condition assessment products; A5) Application in the preparation of products for identifying and distinguishing myocardial aging from other heart diseases; The primers are primers for detecting the expression level of piR-hsa-014388 or specifically identifying piR-hsa-014388, the piRNA marker is piR-hsa-014388, and the nucleotide sequence is shown in SEQ ID No.

1.

9. The primer according to claim 8, characterized in that: The primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

Images