Specific composition, kit and detection method

Abstract

The invention discloses a specific composition, a kit and a detection method, a specific primer group is designed and obtained, the identification accuracy of bacillus cereus, bacillus thuringiensis and bacillus mycoides can be remarkably improved through the primer group, and the detection time is shortened to 6 hours from 3-10 days required in the prior art. According to the detection method, the bacillus cereus, the bacillus thuringiensis and the bacillus mycoides in the food can be rapidly identified, so that the food-borne pathogenic bacterium bacillus cereus can be better distinguished from the three bacteria with extremely high homology, and technical support is provided for a supervision department to detect the food-borne pathogenic bacteria.

Description

Technical Field

[0001] The present invention relates to the technical field of food detection, and relates to a specific composition, a kit and a detection method, and in particular to a specific composition, a kit and a detection method for rapidly detecting Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides in food. Background Art

[0002] Bacillus cereus is a Gram-positive conditional pathogen in a narrow sense. The common clinical manifestations of Bacillus cereus infection are vomiting or diarrhea-type digestive system poisoning, but it may also cause more serious diseases such as meningitis, prosthetic valve endocarditis and aortic abscess, and even death. Bacillus thuringiensis is widely used as a biopesticide due to its good insecticide effect. Recent studies have shown that Bacillus thuringiensis has a relatively ideal control effect on a variety of pests, especially nematodes, insects, mites, etc. There are fewer studies on Bacillus mycoides, which are mainly used for soil remediation and enhancing mouse immunity. The results of homology analysis of the genomes of the three target bacteria showed that they have extremely high DNA homology and similar biochemical characteristics, but Bacillus cereus (Bc) is considered a pathogenic bacterium, and Bacillus thuringiensis (Bt) is widely used as a beneficial biopesticide. Therefore, it is very necessary to establish a rapid and accurate detection method to distinguish these three bacteria, especially Bacillus cereus (Bc).

[0003] At present, the national standard GB 4789.14-2014 mainly uses biochemical culture methods to identify Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides. Although this method can intuitively and clearly observe the various characteristics of the bacteria, it has low technical requirements and low costs, but this method is time-consuming and labor-intensive, and requires the isolation, cultivation and identification of strains. The process may take several days to several weeks, and the sensitivity is low. It is difficult to detect low concentrations of Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides. It is highly subjective, and the identification of colony morphology depends on the operator's experience, which poses a risk of misjudgment. Summary of the invention

[0004] In view of the above-mentioned deficiencies in the prior art, the object of the present invention is to provide a specific composition, a kit and a detection method, specifically a specific composition, a kit and a detection method that can quickly detect Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides in food, so as to solve the problems that the prior art identification of Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides is time-consuming, has low sensitivity, is highly subjective, and relies too much on the operator's experience, resulting in the risk of misjudgment.

[0005] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0006] A specific composition, which can be used to detect Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides in food; the specific composition comprises a plurality of primers and probes;

[0007] When the target strain is Bacillus cereus,

[0008] The sequence of the forward primer gyrB-F was: GTAAATTAGCTGATTGCTCTTCGAAA;

[0009] The sequence of the backward primer gyrB-R is: CGATCGCGTCCTTGTTTTG;

[0010] The sequence of probe gyrB-P is: HEX-TTACATCGTAGAGGGTGACTC-TAMRAR;

[0011] When the target strain is Bacillus thuringiensis,

[0012] The sequence of the forward primer cry-F was: GATTCATGCGGCAGATAAACGT;

[0013] The sequence of the backward primer cry-R was: TTCTTCAAAAATAGCCGCATTG;

[0014] The sequence of the probe cry-P is: FAM-CTTATCTGCCTGAGCTGTCTGTGATTCCG-TAMRAR;

[0015] When the target strain is Bacillus mycoides,

[0016] The sequence of the forward primer N451-2-F was: AGGCGTCATGAAACCAATTCC;

[0017] The sequence of the backward primer N451-2-R was: CCAGGAGCAGCACAACTATCAG;

[0018] The sequence of probe N451-2-P is: ROX-TTCAAAGCGTTGATATTGATACG-Eclipse.

[0019] Preferably, the specific composition can be used alone to detect one target strain; or can be used simultaneously to detect 1 to 3 target strains.

[0020] The present invention provides a kit, which includes the above-mentioned specific composition, specifically: includes all the above-mentioned specific compositions; or includes at least one primer and probe corresponding to the above-mentioned target strain.

[0021] Preferably, in the amplification system of the kit, the concentration of the forward primer is 0.04-0.2 μmol / L, the concentration of the backward primer is 0.04-0.2 μmol / L, and the concentration of the probe is 0.04-0.2 μmol / L; the concentration of the target bacterial DNA template is 0.00004-4 ng / μL; the specific composition and the target bacterial DNA template, as well as the fluorescent quantitative amplification premix and double distilled water are configured into a 25 μL reaction system. Here, the concentration of primers and probes refers to the concentration of a single primer and a single probe in the entire amplification system. In actual use, the amplification system in the kit can be prepared in advance for subsequent detection and use, and the concentration of each primer and probe can be prepared to meet the above range.

[0022] The present invention provides a method for rapidly detecting Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides in food, which specifically comprises the following steps:

[0023] Step 1: Extract DNA template from the sample to be tested;

[0024] Step 2: Place the DNA template extracted in step 1 into the above kit for amplification;

[0025] Step 3: The real-time fluorescence detection system records the change in the fluorescence signal intensity of the amplified product obtained in step 2, obtains a fluorescence curve, determines the Ct value of the amplification cycle number required to reach the set threshold within the set time, and determines whether the sample to be tested contains Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides.

[0026] Preferably, in the amplification system of the kit, the concentration of the forward primer is 0.04-0.2 μmol / L, the concentration of the backward primer is 0.04-0.2 μmol / L, and the concentration of the probe is 0.04-0.2 μmol / L; the concentration of the target bacterial DNA template is 0.00004-4 ng / μL; the specific composition and the target bacterial DNA template, as well as the fluorescent quantitative amplification premix and double distilled water are configured into a 25 μL reaction system. Here, the concentration of the forward primer and the backward primer is the concentration of a single forward primer or a single backward primer in the amplification system, and the concentration of the probe is the concentration of a single needle in the amplification system.

[0027] Preferably, in step 2, the reaction conditions of the amplification treatment are as follows:

[0028] 94.0℃ for 30s; 94.0℃ for 5s, 60.0℃ for 30s; this treatment sequence is considered as 1 cycle, and this cycle is repeated 40 times.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The present invention designs and obtains a specific primer set, which can significantly improve the accuracy of identifying Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides, and shorten the detection time from 3-10 days required by the prior art to 6 hours. The detection method of the present invention can quickly identify Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides in food, thereby better distinguishing the foodborne pathogen Bacillus cereus from the three bacteria with extremely high homology, and providing technical support for regulatory authorities to detect foodborne pathogens. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The figure is a result of a specific experiment of the specific composition of the present invention; wherein, 1 is Bacillus cereus CICC 21261, 2 is Bacillus thuringiensis CICC22945, 3 is Bacillus mycoides CICC 21473; 4 is the other 20 non-target bacteria, which are: Salmonella enteritidis CICC 21482, Staphylococcus epidermidis CICC 10294, Listeria monocytogenes ATCC 19115, Vibrio parahaemolyticus CICC 21617, Pseudomonas aeruginosa ATCC 27583, Pseudomonas putida CICC20576, Streptococcus faecalis ATCC 29212, Clostridium perfringens ATCC 13124, Clostridium sporogenes CICC 10385, Bacillus megaterium CICC 23035, Escherichia coli ATCC 25922, Cronobacter CICC 21544, Bacillus subtilis CICC10275, Shigella flexneri CICC 21534, Streptococcus thermophilus CICC 6038, Aspergillus niger CICC2487, Candida albicans CICC 32380, Beta-hemolytic Streptococcus CICC 10373, Clostridium difficile CICC 25028, Staphylococcus aureus CICC21600.

[0032] Figure 2 The results of the experiment using the composition in the method of the present invention with different concentrations of Bacillus cereus liquid are shown in FIG. 5 , wherein 5 is 1.3×10 5 CFU / mL, 6 is 1.3×10 4 CFU / mL, 7 is 1.3×10 3 CFU / mL, 8 is 1.3×10 2 CFU / mL, 9 is 1.3×10 1 CFU / mL.

[0033] Figure 3 The results of the experiment using the composition in the method of the present invention with different concentrations of Bacillus thuringiensis liquid are shown in FIG. 1 , wherein 10 is 1.3×10 5 CFU / mL, 11 is 1.3×10 4CFU / mL, 12 is 1.3×10 3 CFU / mL, 13 is 1.3×10 2 CFU / mL, 14 is 1.3×10 1 CFU / mL.

[0034] Figure 4 The results of the experiment using the composition in the method of the present invention with different concentrations of Bacillus mycoides liquid are shown in FIG. 15, wherein 1.3×10 5 CFU / mL, 16 is 1.3×10 4 CFU / mL, 17 is 1.3×10 3 CFU / mL, 18 is 1.3×10 2 CFU / mL, 19 is 1.3×10 1 CFU / mL. DETAILED DESCRIPTION

[0035] The present invention will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the present invention belong to the scope of protection of the present invention.

[0036] Unless otherwise indicated in specific cases in the present invention, the numerical ranges listed herein include the upper and lower limits, and all integers and fractions within the range, and are not limited to the specific values ​​listed when defining the range.

[0037] 1. A specific composition

[0038] The specific composition of the present invention can be used to detect Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides in food; the specific composition includes a plurality of primers and probes; specifically as shown in Table 1 below:

[0039] Table 1

[0040]

[0041] 2. A test kit

[0042] The kit of the present invention comprises the above-mentioned specific composition.

[0043] In some embodiments, in the amplification system of the kit, the concentration of the forward primer is 0.04-0.2μmol / L, the concentration of the backward primer is 0.04-0.2μmol / L, the concentration of the probe is 0.04-0.2μmol / L; the concentration of the target bacterial DNA template is 0.00004-4ng / μL; the specific composition and the target bacterial DNA template, as well as the fluorescent quantitative amplification premix and double distilled water are configured into a 25μL reaction system. When studying the amplification system, it was found that if the concentration of each primer and probe in the amplification system is lower than the minimum value of the above range, then in the final image, the curves of the three target bacteria will be the same as Figure 1 Like curve 4 in , they are all flat straight lines, and it is difficult to distinguish the three target bacteria, which also shows that the three target bacteria have not been effectively amplified; however, if the concentration of each primer and probe in the amplification system is higher than the highest value in the above range, non-specific curves will appear in the three target bacteria curves. At this time, although the three target bacteria can be amplified, they are difficult to distinguish from each other. Among them, the concentrations of a single forward primer, a single backward primer, and a single probe can be the same or different, and the concentration of each component can be controlled within the above range. Therefore, the concentration of the forward primer can be 0.04 μmol / L, 0.07 μmol / L, 0.1 μmol / L, 0.15 μmol / L, 0.2 μmol / L, etc., and all ranges and subranges between the above values; the concentration of the backward primer can be 0.04 μmol / L, 0.05 μmol / L, 0.06 μmol / L, 0.08 μmol / L, 0.09 μmol / L, 0.1 μmol / L, 0.13 μmol / L, 0.17 μmol / L, 0.2 μmol / L, etc., and all ranges and subranges between the above values. All ranges and sub-ranges; the concentration of the probe is 0.04 μmol / L, 0.07 μmol / L, 0.1 μmol / L, 0.15 μmol / L, 0.2 μmol / L, etc., and all ranges and sub-ranges between the above values; the concentration of the target bacterial DNA template is 0.00004 ng / μL, 0.0001 ng / μL, 0.001 ng / μL, 0.01 ng / μL, 0.1 ng / μL, 1 ng / μL, 2 ng / μL, 3 ng / μL, 4 ng / μL, etc., and all ranges and sub-ranges between the above values. It should be understood that in the embodiments, any of the above ranges can be combined with any other ranges.

[0044] 3. A method for rapid detection of Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides in food

[0045] Step 1: Extracting DNA template from the sample to be tested. The DNA template is extracted from the sample to be tested using existing technology.

[0046] Step 2: Place the DNA template extracted in step 1 into the above kit for amplification;

[0047] Step 3: The real-time fluorescence detection system records the change in the fluorescence signal intensity of the amplified product obtained in step 2, obtains the fluorescence curve, determines the Ct value of the amplification cycle number required to reach the set threshold within the set time, and determines whether the sample to be tested contains the target bacteria.

[0048] In some embodiments, in the amplification system of the kit, the concentration of the forward primer is 0.04-0.2 μmol / L, the concentration of the backward primer is 0.04-0.2 μmol / L, and the concentration of the probe is 0.04-0.2 μmol / L; the concentration of the target bacterial DNA template is 0.00004-4 ng / μL; the specific composition and the target bacterial DNA template, as well as the fluorescent quantitative amplification premix and double distilled water are configured into a 25 μL reaction system. In actual use, the concentration of primers and probes refers to the concentration of a single primer and a single probe in the entire amplification system. The amplification system in the kit can be prepared in advance for subsequent detection and use, and the concentrations of a single forward primer, a single backward primer, and a single probe can be the same or different. After preparation, the concentration of each primer and probe meets the above range. Therefore, the concentration of the forward primer can be 0.04 μmol / L, 0.07 μmol / L, 0.1 μmol / L, 0.15 μmol / L, 0.2 μmol / L, etc., and all ranges and subranges between the above values; the concentration of the backward primer can be 0.04 μmol / L, 0.05 μmol / L, 0.06 μmol / L, 0.08 μmol / L, 0.09 μmol / L, 0.1 μmol / L, 0.13 μmol / L, 0.17 μmol / L, 0.2 μmol / L, etc., and all ranges and subranges between the above values. All ranges and sub-ranges; the concentration of the probe is 0.04 μmol / L, 0.07 μmol / L, 0.1 μmol / L, 0.15 μmol / L, 0.2 μmol / L, etc., and all ranges and sub-ranges between the above values; the concentration of the target bacterial DNA template is 0.00004 ng / μL, 0.0001 ng / μL, 0.001 ng / μL, 0.01 ng / μL, 0.1 ng / μL, 1 ng / μL, 2 ng / μL, 3 ng / μL, 4 ng / μL, etc., and all ranges and sub-ranges between the above values. It should be understood that in the embodiments, any of the above ranges can be combined with any other ranges.

[0049] In some embodiments, the reaction conditions of the amplification process are as follows:

[0050] The treatment was carried out in the order of 94.0°C for 30 s, 94.0°C for 5 s, and 60.0°C for 30 s, which was regarded as one cycle, and this cycle treatment was performed 40 times.

[0051] 4. Examples and Comparative Examples

[0052] 1. Primer set specificity experiment

[0053] DNA of standard strains of Salmonella, Staphylococcus aureus, Listeria monocytogenes, Bacillus thuringiensis and Bacillus cereus were used as templates respectively, and added into 25 μL of the qPCR amplification reaction system adopted by the present invention for amplification.

[0054] The qPCR reaction system is: the amount of the forward primer added is 0.5 μL, the amount of the backward primer added is 0.5 μL, the amount of the probe added is 0.5 μL, the concentration of the DNA template of the target strain is 10 ng / μL 2 μL, Mix 12.5 μL, ddH2O 9 μL. Here, the primers and the probe of the present invention are added to the qPCR reaction system at the same time for amplification.

[0055] The amplification reaction conditions were: 94.0°C for 30 s; 94.0°C for 5 s, 60.0°C for 30 s, for 40 cycles.

[0056] The real-time fluorescence detection system records the change in the fluorescence signal intensity of the amplified product, obtains the fluorescence curve, determines the Ct value of the amplification cycle number required to reach the set threshold within the set time, and judges whether the amplification is successful.

[0057] from Figure 1 It can be seen that the results show that the specific primer set of the present invention can specifically amplify the target strains Bacillus cereus CICC 21261, Bacillus thuringiensis CICC22945, and Bacillus mycoides CICC 21473; and cannot specifically amplify non-target strains such as Staphylococcus aureus, Staphylococcus aureus, Listeria monocytogenes, etc. The primer set can specifically amplify Bacillus cereus, Bacillus thuringiensis, and Bacillus mycoides at the same time, and Bacillus cereus, Bacillus thuringiensis, and Bacillus mycoides can be clearly identified from the results without interference between them.

[0058] 2. DNA concentration sensitivity experiment

[0059] Use 2 μL of bacterial solution with a concentration of (1.3×10 6 , 1.3×10 5 , 1.3×10 4 , 1.3×10 3 , 1.3×10 2 , 1.3×101 CFU / mL) of the target bacteria liquid was directly used as the sample, and 12.5 μL of Mix and 9 μL of ddH2O were added to prepare a 25 μL qPCR reaction system, which was used to determine the minimum detection concentration of the target bacteria when the method of the present invention was used to detect the sample to be tested.

[0060] The amplification reaction conditions were: 94.0°C for 30 s; 94.0°C for 5 s, 60.0°C for 30 s, for 40 cycles.

[0061] The real-time fluorescence detection system records the change in the fluorescence signal intensity of the amplified product, obtains the fluorescence curve, determines the Ct value of the amplification cycle number required to reach the set threshold within the set time, and judges whether the amplification is successful.

[0062] The results showed that the concentration of the target bacteria solution was 1.3×10 2 ~1.3×10 6 CFU / mL can specifically amplify Bacillus cereus, Bacillus thuringiensis, and Bacillus mycoides; when the bacterial solution concentration is lower than 1.3×10 1 CFU / mL, although the fluorescence curves of the three target bacteria can be detected, the CT value of Bacillus mycoides is greater than 35.0 (CT value ≤ 35.0 is considered detected), which indicates that Bacillus mycoides cannot be specifically amplified. Therefore, the sensitivity of the detection method of the present invention is: 1.3×10 2 When the method of the present invention detects the target bacteria in the sample to be tested, it means that the content of the target bacteria in the sample to be tested is at least 1.3×10 2 CFU / mL and above.

[0063] 3. Comparison of simulation results of actual sample testing

[0064] 50 commercial samples of fermented bean curd, milk powder, fermented black beans, milk, etc. were randomly selected from supermarkets and wholesale markets, and the national standard GB 4789.14-2014 and the detection method of the present invention were used to detect Bacillus cereus, Bacillus thuringiensis, and Bacillus mycoides in the samples. In order to ensure a certain detection rate, 21 samples were artificially contaminated with target bacteria.

[0065] The results show that when testing samples contaminated by human beings, the results of the two methods are completely consistent (see Table 2); when testing natural samples that are not contaminated by human beings, the detection method of the present invention detects 3 Bc and 2 Bt, while the national standard method only detects 2 Bc and 2 Bt. It can be seen that, in general, the overall detection rate of the detection method of the present invention is comparable to that of the national standard method, and is reliable, and even slightly higher than that of the national standard method (see Table 3); at the same time, the use of the primer set and detection method of the present invention can greatly shorten the detection time, especially compared with the national standard method, the detection time can be significantly shortened to 6h, and the operation is simple, which is convenient for practical detection applications.

[0066] Table 2

[0067]

[0068] Note: + detected; - not detected; the three samples with added target bacteria were a rice product, a fermented bean curd product, and a pork product; Bc represents Bacillus cereus, Bt represents Bacillus thuringiensis, and Bm represents Bacillus mycoides.

[0069] Table 3

[0070]

[0071] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the technical solution. Those skilled in the art should understand that those modifications or equivalent substitutions of the technical solution of the present invention that do not depart from the purpose and scope of the technical solution should be included in the scope of the claims of the present invention.

Claims

1. A specific composition, characterized in that: The specific composition can be used to detect Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides in food; the specific composition comprises a plurality of primers and a plurality of probes; When the target strain is Bacillus cereus, The sequence of the forward primer gyrB-F was: GTAAATTAGCTGATTGCTCTTCGAAA; The sequence of the backward primer gyrB-R is: CGATCGCGTCCTTGTTTTG; The sequence of probe gyrB-P is: HEX-TTACATCGTAGAGGGTGACTC-TAMRAR; When the target strain is Bacillus thuringiensis, The sequence of the forward primer cry-F was: GATTCATGCGGCAGATAAACGT; The sequence of the backward primer cry-R was: TTCTTCAAAAATAGCCGCATTG; The sequence of the probe cry-P is: FAM-CTTATCTGCCTGAGCTGTCTGTGATTCCG-TAMRAR; When the target strain is Bacillus mycoides, The sequence of the forward primer N451-2-F was: AGGCGTCATGAAACCAATTCC; The sequence of the backward primer N451-2-R was: CCAGGAGCAGCACAACTATCAG; The sequence of probe N451-2-P is: ROX-TTCAAAGCGTTGATATTGATACG-Eclipse.

2. The specific composition according to claim 1, characterized in that: The specific composition can be used alone to detect one target strain, or can be used to detect 1 to 3 target strains at the same time.

3. A kit, characterized in that: The kit comprises the specific composition according to claim 1.

4. The kit according to claim 3, characterized in that: In the amplification system of the kit, the concentration of the forward primer is 0.04-0.2 μmol / L, the concentration of the backward primer is 0.04-0.2 μmol / L, and the concentration of the probe is 0.04-0.2 μmol / L; the concentration of the target bacterial DNA template is 0.00004-4 ng / μL; the specific composition and the target bacterial DNA template, as well as the fluorescent quantitative amplification premix and double distilled water are configured into a 25 μL reaction system.

5. A method for rapid detection of Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides in food, characterized in that: The specific steps include: Step 1: Extract DNA template from the sample to be tested; Step 2: placing the DNA template extracted in step 1 into the kit of claim 3 for amplification; Step 3: The real-time fluorescence detection system records the change in the fluorescence signal intensity of the amplified product obtained in step 2, obtains a fluorescence curve, determines the Ct value of the amplification cycle number required to reach the set threshold within the set time, and determines whether the sample to be tested contains Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides.

6. The method according to claim 5, characterized in that: In the amplification system of the kit, the concentration of the forward primer is 0.04-0.2 μmol / L, the concentration of the backward primer is 0.04-0.2 μmol / L, and the concentration of the probe is 0.04-0.2 μmol / L; the concentration of the target bacterial DNA template is 0.00004-4 ng / μL; the specific composition and the target bacterial DNA template, as well as the fluorescent quantitative amplification premix and double distilled water are configured into a 25 μL reaction system.

7. The method according to claim 5, characterized in that: In step 2, the reaction conditions of the amplification process are as follows: Keep at 94.0℃ for 30s; keep at 94.0℃ for 5s, keep at 60.0℃ for 30s; cycle 40 times.

Images