GhCKI gene promoter deletion fragment related to male sterility character of cotton and application of GhCKI gene promoter deletion fragment

Abstract

The invention provides a GhCKI gene promoter deletion fragment related to the male sterility character of cotton and application of the GhCKI gene promoter deletion fragment, and belongs to the technical field of plant genetic engineering. The invention provides a GhCKI gene promoter deletion fragment related to the male fertility character of cotton, and the nucleotide sequence of the GhCKI gene promoter deletion fragment is 5 '-atagt-3'. According to the invention, the CRISPR / Cas9 technology is utilized to modify the GhCKI gene promoter, and the cotton male sterile line without the deletion fragment of the GhCKI gene promoter is created, so that the problems of unstable fertility and low abortion rate of the existing cotton male sterile line can be effectively solved. The cotton male sterile line created on the basis of the GhCKI gene promoter deletion fragment is extremely high in abortion rate, and important technical support is provided for cotton cross breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a GhCKI gene promoter deletion fragment related to cotton male sterility traits and an application thereof. Background Art

[0002] Cotton is an important economic crop in my country with good hybrid vigor. Utilizing hybrid vigor can significantly improve cotton yield, stress resistance, fiber quality, etc., and improve the agronomic traits of cotton. There are three methods and approaches in cotton hybrid seed production, namely the three-line method through the male sterility characteristics of cells, the two-line method using male sterility characteristics, and artificial pollination. The use of male sterile lines to breed hybrids eliminates the step of artificial emasculation and greatly reduces labor costs. Therefore, it is extremely necessary to create a male sterile line with stable and reliable fertility for cotton hybrid breeding. However, there are still some problems with the existing cotton male sterile lines, such as unstable fertility and low abortion rate. Summary of the invention

[0003] The purpose of the present invention is to provide a GhCKI gene promoter deletion fragment related to the male sterility trait of cotton and an application thereof, and the GhCKI gene promoter is modified by using CRISPR / Cas9 technology, and the created cotton male sterile line lacking the GhCKI gene promoter deletion fragment has the advantages of stable fertility and high abortion rate.

[0004] The invention provides a GhCKI gene promoter deletion fragment related to the male fertility trait of cotton, and the nucleotide sequence is: 5'-atagtt-3'.

[0005] The present invention also provides the use of the GhCKI gene promoter deletion fragment described in the above scheme as a molecular marker in any of the following:

[0006] 1) Create male sterile cotton lines;

[0007] 2) Detecting or assisting in detecting the male fertility of cotton, or preparing a product for detecting whether the cotton to be tested is male sterile cotton;

[0008] 3) Detecting whether the cotton to be tested is a male sterile line, or preparing a product for detecting whether the cotton to be tested is a male sterile line;

[0009] 4) Detecting whether the cotton to be tested is a male sterile line or whether the cotton to be tested can be used as a male sterile line, or preparing a product for detecting whether the cotton to be tested is a male sterile line or whether the cotton to be tested can be used as a male sterile line.

[0010] The present invention also provides a method for detecting the GhCKI gene promoter deletion fragment described in the above scheme in any of the following applications:

[0011] 1) Create male sterile cotton lines;

[0012] 2) Detecting or assisting in detecting the male fertility of cotton, or preparing a product for detecting whether the cotton to be tested is male sterile cotton;

[0013] 3) Detecting whether the cotton to be tested is a male sterile line, or preparing a product for detecting whether the cotton to be tested is a male sterile line;

[0014] 4) Detecting whether the cotton to be tested is a male sterile line or whether the cotton to be tested can be used as a male sterile line, or preparing a product for detecting whether the cotton to be tested is a male sterile line or whether the cotton to be tested can be used as a male sterile line.

[0015] The present invention also provides a GhCKI gene promoter mutant related to the male fertility trait of cotton, and the nucleotide sequence is shown in SEQ ID NO.2 to SEQ ID NO.4.

[0016] The present invention also provides an sgRNA for inhibiting the expression of the GhCKI gene promoter deletion fragment described in the above scheme, and the nucleotide sequence is shown in SEQ ID NO.5.

[0017] The present invention also provides a recombinant expression vector, which uses the CRISPR / Cas9 vector as a backbone plasmid and is inserted with the sgRNA described in the above scheme.

[0018] The present invention also provides a method for constructing the recombinant expression vector described in the above scheme, and the sgRNA described in the above scheme is connected to the CRISPR / Cas9 vector by means of a polycistronic tRNA-gRNA to obtain the recombinant expression vector.

[0019] The present invention also provides the use of the biological material for negatively regulating the GhCKI gene promoter deletion fragment described in the above scheme, the GhCKI gene promoter mutant, the sgRNA, the recombinant expression vector or the recombinant expression vector constructed by the construction method in creating cotton male sterile lines and / or cotton hybrid breeding.

[0020] The present invention also provides a method for creating a cotton male sterile line, comprising the following steps:

[0021] The recombinant expression vector described in the above scheme or the recombinant expression vector constructed by the construction method is transformed into the target cotton plant by genetic transformation to obtain a cotton male sterile line.

[0022] The present invention also provides a method for detecting or assisting in detecting the male fertility of cotton to be tested, comprising the following steps:

[0023] A1. Detecting whether the genome of the cotton to be tested contains the GhCKI gene promoter deletion fragment described in the above scheme;

[0024] A2. According to the detection result of step A1, the male fertility of the cotton to be tested is determined according to the following standards: if the genome of the cotton to be tested does not contain the GhCKI gene promoter deletion fragment, the cotton to be tested is male sterile; if the genome of the cotton to be tested contains the GhCKI gene promoter deletion fragment, the cotton to be tested is male fertile.

[0025] The present invention provides a GhCKI gene promoter deletion fragment related to the male fertility trait of cotton, and the nucleotide sequence is: 5'-atagtt-3'. The GhCKI gene promoter deletion fragment of the present invention is a TATAbox fragment in the GhCKI gene promoter region, and a cotton male sterile line can be created by knocking out the fragment. The present invention uses CRISPR / Cas9 technology to transform the GhCKI gene promoter, and creates a cotton male sterile line that lacks the GhCKI gene promoter deletion fragment described in the above scheme, which can effectively solve the problems of unstable fertility and low abortion rate in the existing cotton male sterile line. The present invention can effectively inhibit the expression of the GhCKI gene by accurately editing the TATAbox fragment in the GhCKI gene promoter region, ensuring the fertility stability of the male sterile line. Secondly, the deletion of the TATAbox fragment in the GhCKI gene promoter region of the present invention can lead to a significant reduction in the expression level of the GhCKI gene, thereby increasing the abortion rate of the male sterile line and reducing the need for artificial assisted emasculation. In addition, the male sterile line created by the present invention is controlled by a single gene, has a simple genetic background, and is convenient for genetic improvement and hybrid breeding. In summary, the cotton male sterile line created by the present invention based on the GhCKI gene promoter deletion fragment has a very high abortion rate, providing important technical support for cotton hybrid breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0027] Figure 1 This is a schematic diagram of positive detection after the recombinant plasmid is electrotransformed into Agrobacterium GV3101 in Example 2;

[0028] Figure 2 This is a schematic diagram of the positive detection of Cas9 protein in a single plant of the T0 generation in Example 4;

[0029] Figure 3 This is a schematic diagram of PCR amplification of the target site for Hi-Tom sequencing of the T0 generation in Example 5;

[0030] Figure 4 Schematic diagram of editing the GhCKI gene promoter of a single plant in Example 5.

[0031] Figure 5 It is the phenotype diagram of anther and pollen activity of a single plant in the T0 generation in Example 4; wherein A is the anther of a single plant of the wild type (WT), and B, C, and D are the anthers of a single plant of the GhCKI allelic sterile genotype; a, b, c, and d are the TTC staining diagrams of pollen activity of WT and GhCKI allelic sterile genotypes, respectively; DETAILED DESCRIPTION

[0032] The invention provides a GhCKI gene promoter deletion fragment related to the male fertility trait of cotton, and the nucleotide sequence is: 5'-atagtt-3'.

[0033] In the present invention, the original nucleotide sequence (1 kb) of the GhCKI gene promoter is shown in SEQ ID NO.1, specifically:

[0034] 5'-TTTTATAATTATAAAATGTAATTATTAGTCTAATAATTTATTTTTTTAAT-3'。

[0035] In the present invention, the GhCKI gene promoter deletion fragment is a DNA fragment on chromosome A07 of the cotton genome, and the accession number of the genome is: ASM698074v1.

[0036] The GhCKI gene promoter deletion fragment of the present invention is a TATA box fragment in the GhCKI gene promoter region, and a cotton male sterile line can be created by knocking out the fragment. The male sterile line created by the present invention has a very high abortion rate, providing important technical support for cotton hybrid breeding.

[0037] The present invention also provides the use of the GhCKI gene promoter deletion fragment described in the above scheme as a molecular marker in any of the following: 1) creating a cotton male sterile line; 2) detecting or assisting in detecting the male fertility of cotton, or preparing a product for detecting whether the cotton to be tested is a male sterile line; 3) detecting whether the cotton to be tested is a male sterile line, or preparing a product for detecting whether the cotton to be tested is a male sterile line; 4) detecting whether the cotton to be tested is a male sterile line or whether the cotton to be tested can be used as a male sterile line, or preparing a product for detecting whether the cotton to be tested is a male sterile line or whether the cotton to be tested can be used as a male sterile line.

[0038] In the present invention, the male fertility preferably includes male fertility under high temperature; the high temperature condition is preferably a daytime temperature greater than 35°C and a nighttime temperature greater than 28°C.

[0039] The present invention also provides the use of a substance for detecting the GhCKI gene promoter deletion fragment described in the above scheme in any of the following: 1) creating a cotton male sterile line; 2) detecting or assisting in detecting the male fertility of cotton, or preparing a product for detecting whether the cotton to be tested is a male sterile line; 3) detecting whether the cotton to be tested is a male sterile line, or preparing a product for detecting whether the cotton to be tested is a male sterile line; 4) detecting whether the cotton to be tested is a male sterile line or whether the cotton to be tested can be used as a male sterile line, or preparing a product for detecting whether the cotton to be tested is a male sterile line or whether the cotton to be tested can be used as a male sterile line.

[0040] In the present invention, the substance for detecting the GhCKI gene promoter deletion fragment described in the above scheme includes a primer set; the primer set includes a first primer set, a second primer set and a third primer set; the first primer set includes a forward primer P6 with a nucleotide sequence as shown in SEQ ID NO.12 and a reverse primer P7 with a nucleotide sequence as shown in SEQ ID NO.13; the second primer set includes a forward primer P8 with a nucleotide sequence as shown in SEQ ID NO.14 and a reverse primer P9 with a nucleotide sequence as shown in SEQ ID NO.15; the third primer set includes a forward primer P10 with a nucleotide sequence as shown in SEQ ID NO.16 and a reverse primer P11 with a nucleotide sequence as shown in SEQ ID NO.17.

[0041] The invention also provides a GhCKI gene promoter mutant related to the male fertility trait of cotton.

[0042] The present invention produces three promoters of GhCKI sterile genotypes, all of which have the same base fragment deletion, and the same base deletion fragment is specifically: 5'-ATAGTT-3'; the three promoters of GhCKI sterile genotypes are collectively referred to as GhCKI-proA.

[0043] The nucleotide sequence corresponding to the GhCKI-proA is shown in SEQ ID NO.2 to SEQ ID NO.4; the nucleotide sequence shown in SEQ ID NO.2 is specifically:

[0044] 5'-TTTTATAATTATAAAATGTAATTATTAGTCTAATAATTTATTTTTTTAATTTACTCTATGGTGTTTAAACATACTTCTAATGAATACAACTTTTAATTTAAATTCAAGCCCTTTGAATATTAAAATTTAATGAAAGTTCCTTTAATAATAATTATAAATTTTAAAGCAAACAAGGCAAAAATTTGAAATTAAAACAGAAAGACTAAATTTTCAATGATCCGAAAGATATAGGGACTCGGAGAAAAATAAACCTTTTTCCTTAGAGGAACCTTCGCATCCCTTACACGCTTAGTAAAAACGCGTGGCTAACCCATTCCCATCTCTCTCCTCTCTCTTTCTCGCCAAAGAATTTTATTTTATTAATATTAAAAAATAAAACAAGAATTAGAATTTAGAAAAAGCTAAGGAAAAAAAGAGAGAGACCCAAACATCATTCAATTAAGGAAAAAAAAAAAAAGCACACACATCCATCTCCGTCGTTTAAAGCAAGTTTTTAATTTTTTTTCTTTGCTTCGATACGATCAAATCATCAGAGTGGCAAACTTTTTTTTTTTTTTGCTTTTTTAAGAGATTGAAAATTAAGCTAATTTTTTTGGTTTTTTTTAGATAGTGATAGGAAAAAAAAGTAGAATTATGATTTCGTAGCTACTTTTCCTTCTTCTTCTTTTCTTTCTTCTTCGCATTTAGATTAACCTAACCTAACCCTAGGTTTTTTTTTTGGTGTTCTTGTTAATTTTGTATTTGTTTGTGGTTTAAGGTAAAAGACGCAATTCTAGTTTTTTTCTCCCTTCTTTTATTTTATTTTTTTAAAAGATTTTTTTACTTGATTGATCATCTGGATGTTTATGGGTTGTCGGTGCGGTTGATTTGAAGTTTAGTGTCGCCGTATAATTTCCTCGCTTATTTAACGTGAGGGATTTTTTTTCTAAATTAGGGTTTCGGTTTAGGGTTGTGAATTTCCTTTTTTTTTTAGTTACTTATTTGAAGTTGATTG-3'.

[0045] The nucleotide sequence shown in SEQ ID NO.3 is specifically:

[0046] 5'-TTTTATAATTATAAAATGTAATTATTAGTCTAATAATTTATTTTTTTAAT -3'。

[0047] The nucleotide sequence shown in SEQ ID NO.4 is specifically:

[0048] 5'-TTTTATAATTATAAAATGTAATTATTAGTCTAATAATTTATTTTTTTAAT-3'。

[0049] The present invention also provides an sgRNA for inhibiting the expression of the GhCKI gene promoter deletion fragment described in the above scheme, and the nucleotide sequence is shown in SEQ ID NO.5, specifically: 5'-TAGGGTTTCGGTTATAGTTTAGG-3'.

[0050] In the present invention, the sgRNA is the target sequence of the GhCKI gene promoter deletion fragment.

[0051] The present invention also provides a recombinant expression vector, which uses the CRISPR / Cas9 vector as a backbone plasmid and is inserted with the sgRNA described in the above scheme.

[0052] The present invention also provides a method for constructing the recombinant expression vector described in the above scheme, and the sgRNA described in the above scheme is connected to the CRISPR / Cas9 vector by means of a polycistronic tRNA-gRNA to obtain the recombinant expression vector.

[0053] In the present invention, the connection method preferably includes a PCR amplification method. The nucleotide sequences of the forward primer P1 and the reverse primer P2 of the connection primers are preferably as shown in SEQ ID NO.6 and SEQ ID NO.7 respectively; in the present invention, the nucleotide sequence shown in SEQ ID NO.6 is specifically: 5'-aagcatcagatgggcaAACAAAGCACCAGTGGTCTAG-3'; the nucleotide sequence shown in SEQ ID NO.7 is specifically: 5'-TTCTAGCTCTAAAACAAACTATAACCGAAACCCTATGCACCAGCCGGGA AT-3'. In the present invention, the CRISPR / Cas9 vector preferably includes pRGEB32-GhU6.7-NPTⅡ (provided by the cotton genetic improvement team of Huazhong Agricultural University, Wang, P., Zhang, J., Sun, L., Ma, Y., Xu, J., Liang, S., Deng, J. et al. (2018) High efficiency multisites genome editing in allotetraploid cotton (Gossypium hirsutum) using CRISPR / Cas9 system. Plant Biotechnol. J. 16, 137-150.).

[0054] The present invention also provides the use of the biological material for negatively regulating the GhCKI gene promoter deletion fragment described in the above scheme, the GhCKI gene promoter mutant, the sgRNA, the recombinant expression vector or the recombinant expression vector constructed by the construction method in creating cotton male sterile lines and / or cotton hybrid breeding.

[0055] In the present invention, the biomaterial preferably includes sgRNA that inhibits the expression of the GhCKI gene and / or a recombinant expression vector constructed by the sgRNA.

[0056] In the present invention, the negative regulation preferably includes: knocking out the GhCKI gene promoter deletion fragment in the target cotton plant by using the CRISPR / Cas9 system; the nucleotide sequence of the sgRNA used for the knockout is shown in SEQ ID NO.3.

[0057] The present invention also provides a method for creating a cotton male sterile line, comprising the following steps:

[0058] The recombinant expression vector described in the above scheme or the recombinant expression vector constructed by the construction method is transformed into the target cotton plant by genetic transformation to obtain a cotton male sterile line.

[0059] The method and key parameters for constructing the recombinant expression vector of the present invention have been described in the above technical scheme and will not be described in detail. The method of genetic modification of the present invention preferably includes but is not limited to Agrobacterium-mediated method. The present invention does not specifically limit the specific steps of genetic modification, and the steps of conventional genetic modification in the art can be used.

[0060] The method of the present invention can be used to obtain cotton male sterile line mutants. In addition, through high-throughput sequencing of transgenic T0 generation plants, it was found that the GhCKI gene promoter produced multiple editing types, and through observation of the T0 generation, it was known that the mutant had an obvious sterile phenotype.

[0061] In the present invention, the target cotton preferably includes Upland cotton Jin668.

[0062] The present invention also provides a method for detecting or assisting in detecting the male fertility of a cotton plant to be tested, comprising the following steps: A1. detecting whether the genome of the cotton plant to be tested contains the GhCKI gene promoter deletion fragment described in the above scheme; A2. determining the male fertility of the cotton plant to be tested according to the following standards based on the detection result of step A1: if the genome of the cotton plant to be tested does not contain the GhCKI gene promoter deletion fragment, the cotton plant to be tested is male sterile; if the genome of the cotton plant to be tested contains the GhCKI gene promoter deletion fragment, the cotton plant to be tested is male fertile.

[0063] In the present invention, the reagent used to detect whether the genome of the cotton to be tested contains the GhCKI gene promoter deletion fragment described in the above scheme includes a primer set, and the primer set includes the forward primer P6 and reverse primer P7, forward primer P8 and reverse primer P9, forward primer P10 and reverse primer P11 described in the above scheme.

[0064] To further illustrate the present invention, the GhCKI gene promoter deletion fragment related to cotton male sterility trait and its application provided by the present invention are described in detail below in conjunction with the drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0065] Example 1 CRISPR / Cas9 vector construction

[0066] Table 1 Design of sgRNA

[0067] Gene sgRNA sequence and PAM site G JZ TAGGGTTTCGGTTATAGTTTAGG(SEQ ID NO.5)

[0068] Note: The bases in bold in Table 1 are PAM (protospacer adjacent motifs).

[0069] The sgRNA was concatenated with tRNA and gRNA (Wang, P., Zhang, J., Sun, L., Ma, Y., Xu, J., Liang, S., Deng, J. et al. (2018) High efficient multisites genome editing in allotetraploid cotton (Gossypium hirsutum) using CRISPR / Cas9 system. Plant Biotechnol. J. 16, 137-150.) by PCR method, and then constructed into the CRISPR / Cas9 vector by one-step cloning method.

[0070] The following primers were designed with sequences from 5' to 3':

[0071] Forward primer P1: 5′-aagcatcagatgggcaAACAAAGCACCAGTGGTCTAG-3′ (SE Q ID NO. 6);

[0072] Reverse primer P2: 5'-TTCTAGCTCTAAAACCGCGTTTTTACTAAGCGTGTTGC ACCAGCCGGGAAT-3' (SEQ ID NO. 7);

[0073] Steps:

[0074] (1) PCR amplification, using primers P1 and P2 to connect tRNA, sgRNA, and gRNA. The PCR reaction system is shown in Table 2.

[0075] Table 2 PCR reaction system

[0076] Reactants volume Buffer 2μL dNTP(10mM) 0.4μL Forward primer P1 (10 μM) 0.2μL Reverse primer P2 (10 μM) 0.2μL TaqEnzyme 0.2μL Template PGTR 1μL <![CDATA[ddH2O]]> 16.μL Total volume 20μL

[0077] PCR conditions: 95°C for 5 min, 95°C for 30 sec, 56°C for 30 sec, 72°C for 20 sec, for a total of 34 cycles, 72°C for 5 min, and the obtained PCR product was stored at 4°C.

[0078] (2) Vector digestion (BsaI was purchased from Beijing NEB Company, catalog number: R3733L). The digestion system is shown in Table 3.

[0079] Table 3 Enzyme digestion system

[0080] Reactants Volume / Mass pRGEB32-GhU6.7-NPT2 plasmid 10 μg 10XcutsmartBuffer 10μL BsaI enzyme (10U / μL) 4.0μL <![CDATA[ddH2O]]> Up to 100 μL

[0081] Incubate at 37°C for 5 h to obtain the restriction digestion vector.

[0082] (3) Infusion connection (ClonExpress Entry Step Cloning Kit purchased from Nanjing Novogene Biotechnology Co., Ltd.)

[0083] Table 4 Connection system

[0084]

[0085] Incubate at 37°C for 30 min and place on ice for 5 min to obtain the ligated vector.

[0086] (4) The ligated vector was transformed into GV3101 Agrobacterium competent cells, and the kanamycin + rifampicin resistance was screened. PCR positive identification was performed, and U6-7 F was used as the forward primer for sequencing, and the reverse primer P3 of the gene was used for reverse sequencing. The positive test result was as follows Figure 1 As shown. There is a band near 250bp, indicating a positive result.

[0087] U6-7 F:5'-TGTGCCACTCCAAAGACATCAG-3'(SEQ ID NO.8)

[0088] Reverse primer P3: 5'-TTCTAGCTCTAAAACGCATCTTCAGCAGACGTCCA-3' (SEQ ID NO. 9).

[0089] Example 2

[0090] Transforming cotton using the CRISPR-Cas9 system

[0091] The constructed vector is introduced into cotton host cells through Agrobacterium-mediated transformation. The specific transformation steps are as follows:

[0092] (1) Select full and healthy seeds of upland cotton Jin668, peel off the seed coat, soak them in 0.1% HgCl2 for 10 min, wash them with sterile water for 3 times, inoculate the sterilized cotton seeds on a sterile seedling germination medium, and culture them in a 28°C incubator in the dark for 4 to 6 days;

[0093] (2) Take the hypocotyls of sterile seedlings, cut them into small segments of 0.5 to 0.8 cm, and inoculate them into a suspension of Agrobacterium activated medium with an OD value of 0.5. After infection for 10 minutes, use sterile filter paper to absorb the suspension on the surface of the hypocotyls;

[0094] (3) Inoculate the hypocotyls in co-culture medium and co-culture at 21°C for 48 hours; transfer to selection medium and subculture once every month until embryonic callus is obtained; transfer the embryonic callus to differentiation medium to obtain a large number of embryoids;

[0095] (4) The obtained embryoids are transferred to embryo germination and seedling culture medium until transgenic plant seedlings are obtained.

[0096] Transformation medium composition and preparation method:

[0097] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 5 g / L sodium chloride, 10 g / L agar (solid).

[0098] Sterile seedling culture medium: 25 mL MS culture medium, 15 g / L glucose, 2.5 g / L Phytagel; pH value is 6.1-6.2.

[0099] Co-culture medium (1L): 50mL MS macro 50mL, 10mL trace, 10mL iron salt 10mL, inositol 10mL, ammonium nitrate 10mL, 1mL L-Gly, 1mL B5 organic matter, 2,4-D1mL, 0.2mL KT, magnesium chloride hexahydrate 0.9-1.0g, 30g grape, Phytagel 2.6g; pH value is 5.85-5.95.

[0100] 2,4-D screening medium (1L): 50mLMS macro 50mL, 10mL trace, 10mL iron salt 10mL, inositol 10mL, ammonium nitrate 10mL, 1mL L-Gly, 1mLB5 organic matter, 2,4-D1mL, 0.2mLKT, magnesium chloride hexahydrate 0.9~1.0g, 30g grape, Phytagel 2.6g, kanamycin 50mg / L, cephalosporin 400mg / L; pH value is 5.85~5.95.

[0101] Differentiation medium (1L): 50mL MS macro, 10mL micro, 10mL iron salt, 10mL inositol, 50mL potassium nitrate, 1mL L-Gly, 1mL B5 organic matter, 1mL IBA, 0.3mL KT, 1g glutamine, 0.5g asparagine, 30g glucose, 2.6g Phytagel; pH value is 6.1-6.2.

[0102] Rooting medium (1L): 25mL MS macro, 5mL micro, 5mL iron salt, 10mL inositol, 1mL L-Gly, 1mL B5 organic matter, 15g glucose, 2.6g Phytagel; pH value is 5.90-5.95;

[0103] Example 3

[0104] Molecular and editing detection of regenerated plants

[0105] After the transformation process of Example 2, regenerated plants were obtained, and DNA was extracted from the obtained regenerated plants using a plant DNA rapid extraction kit from Magen Biotechnology Co., Ltd. The specific extraction steps are as follows.

[0106] (1) Place the young cotton leaves to be extracted (0.1 g) into a 2 mL centrifuge tube and store it in liquid nitrogen for a short time. During extraction, place the centrifuge tube on ice, quickly add steel beads and 400 μL DNA extraction buffer, balance the sample and place it in a grinder, grind at 60 Hz for 60 s, add 400 μL DNA extraction buffer after grinding, and grind for another 10 s. At this time, open the water bath, adjust the water temperature to 65 °C, and preheat BufferPAL;

[0107] (2) Centrifuge the polished sample at 12000 r / min for 18 min and discard the supernatant;

[0108] (3) Immediately add 700 μL of Buffer PAL preheated to 65°C to the sample, vortex vigorously to fully disperse the sample, and place in a 65°C water bath for 40 min, gently inverting every 10 to 20 min. After the water bath is completed, centrifuge at 12,000 rpm for 10 min.

[0109] (4) Aspirate the supernatant into a new 2 mL centrifuge tube, add 700 μL of phenol-chloroform (Tris-phenol:chloroform = 1:1, mix and let stand overnight before use), gently extract and shake for 20 min, and centrifuge at 12000 r / min for 8 min;

[0110] (5) Aspirate the supernatant into a new 2 mL centrifuge tube, add an equal volume of chloroform, gently extract and shake for 20 min, and centrifuge at 12000 r / min for 8 min;

[0111] (6) Aspirate the supernatant into a new 2 mL centrifuge tube, add 700 μL of Buffer GWP to the supernatant, and mix by inverting 10 to 15 times;

[0112] (7) Place the DNA column in a collection tube, transfer half of the mixed solution to the column, and centrifuge at 12,000 rpm for 1 min.

[0113] (8) Discard the filtrate and put the column back into the collection tube, transfer the remaining mixed solution to the column, and centrifuge at 12000r / min for 1min;

[0114] (9) Discard the filtrate and return the column to the collection tube. Add 500 μL of Buffer PW1 to the column and centrifuge at 12,000 rpm for 1 min.

[0115] (10) Discard the filtrate and return the column to the collection tube. Add 500 μL of Buffer PW2 to the column and centrifuge at 12,000 rpm for 1 min.

[0116] (11) Repeat step 10;

[0117] (12) Discard the filtrate and return the column to the collection tube. Centrifuge at 12,000 rpm for 2 min to remove the residual ethanol in the column.

[0118] (13) Transfer the column to a new 1.5 mL centrifuge tube, add 50 μL of Buffer AE preheated to 65 °C to the center of the column membrane, let stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 1 min;

[0119] (14) Discard the DNA binding column, take 1 μL of the extracted DNA and dilute it ten-fold for electrophoresis, take 1 μL and measure the concentration using NanoDrop 2000, and store the remaining DNA at -20°C for subsequent experiments.

[0120] After DNA extraction, forward primer P4 and reverse primer P5 were used to detect Cas9 protein. Figure 2 This is a schematic diagram of Cas9 protein positive detection. The relevant primer sequences used for amplification are as follows:

[0121] Forward primer P4: 5'-GCTACGCCGGCTACATTGAC-3' (SEQ ID NO. 10);

[0122] Reverse primer P5: 5'-CGTTGGGCAGGTTCTTATCG-3' (SEQ ID NO.11)

[0123] After testing the transgenic plants for vector positivity, we need to further determine the specific editing status of the transgenic plants. Therefore, we designed primers to amplify the flanking sequences of sgRNA, and the products were sequenced using high-throughput sequencing. The relevant primer sequences for amplification are as follows:

[0124] Forward primer P6: 5'-GACgcctagTTCTCCCTTCTTTTATTTTA-3' (SEQ ID NO. 12);

[0125] Reverse primer P7: 5'-GACacgtcaACAAGGTTCCATCAATCAAC-3' (SEQ ID NO. 13);

[0126] Forward primer P8: 5′-GACgcgctaTTCTCCCTTCTTTTATTTTA-3′ (SEQ ID NO. 14);

[0127] Reverse primer P9: 5'-GACaccatgACAAGGTTCCATCAATCAAC-3' (SEQ ID NO. 15);

[0128] Forward primer P10: 5′-GACgcggatTTCTCCCTTCTTTTATTTTA-3′ (SEQ ID NO. 16);

[0129] Reverse primer P11: 5'-GACacgagcACAAGGTTCCATCAATCAAC-3' (SEQ ID NO. 17).

[0130] Table 5 Amplification system (primers P6 and P7)

[0131]

[0132]

[0133] Table 6 Amplification system (primers P8 and P9)

[0134] Reactants volume Buffer 2μL dNTP(10mM) 0.4μL Mutant DNA 1μL Forward primer P8 (10 μM) 0.2μL Reverse primer P9 (10 μM) 0.2μL TaqEnzyme 0.2μL <![CDATA[ddH2O]]> 16μL Total volume 20μL

[0135] Table 7 Amplification system (primers P10 and P11)

[0136] Reactants volume Buffer 2μL Mutant DNA 1μL dNTP(10mM) 0.4μL Forward primer P10 (10 μM) 0.2μL Reverse primer P11 (10 μM) 0.2μL TaqEnzyme 0.2μL <![CDATA[ddH2O]]> 16μL Total volume 20μL

[0137] PCR conditions: 95°C for 5 min, 95°C for 30 sec, 56°C for 30 sec, 72°C for 20 sec, for a total of 34 cycles, 72°C for 5 min, and the obtained PCR product was stored at 4°C.

[0138] Figure 3 It is the result of PCR product amplification of Hi-Tom sequencing target site. Figure 4 The editing status of the GhCKI gene promoter in T0 generation plants is shown, all of which contain the same type of base deletion (deletion of 6 bases).

[0139] Example 4

[0140] Phenotypic investigation

[0141] After determining the specific editing situation in the GhCKI promoter knockout mutant, the male fertility of the knockout mutant was examined.

[0142] Figure 5 The sterile phenotype of the regenerated plants is shown in Figure 2. Figure 5 It can be seen that at room temperature, the anther dehiscence of WT (Jin668) was normal, and the pollen vitality was very good as determined by TTC staining; however, the anther dehiscence of the regenerated individual plants was abnormal, and the pollen vitality was very low as determined by TTC staining.

[0143] From the above, we can see that deliberately editing the nucleotide sequence on the GhCKI promoter: 5'-atagtt-3' can create stable cotton sterile materials.

[0144] The specific steps for TTC pollen viability staining observation are as follows:

[0145] Take 8 grams of TTC (2,3,5-triphenyltetrazolium chloride, molecular weight 334.8) and dissolve it in 1L phosphate buffer (26.6g of dipotassium hydrogen phosphate trihydrate, 10.2g of dipotassium hydrogen phosphate) to prepare a 2% working solution, and store it at 4°C in the dark. When using, divide it into 2mL centrifuge tubes, insert the anthers, react at room temperature for 30 minutes, then take it out and observe it under a microscope.

[0146] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A GhCKI gene promoter deletion fragment associated with cotton male fertility traits, characterized in that: The nucleotide sequence is: 5'-atagtt-3'.

2. Use of the GhCKI gene promoter deletion fragment according to claim 1 as a molecular marker in any of the following: 1) Create male sterile cotton lines; 2) Detecting or assisting in detecting the male fertility of cotton, or preparing a product for detecting whether the cotton to be tested is male sterile cotton; 3) Detecting whether the cotton to be tested is a male sterile line, or preparing a product for detecting whether the cotton to be tested is a male sterile line; 4) Detecting whether the cotton to be tested is a male sterile line and whether the cotton to be tested can be used as a male sterile line, or preparing a product for detecting whether the cotton to be tested is a male sterile line and whether the cotton to be tested can be used as a male sterile line.

3. Use of the method for detecting the GhCKI gene promoter deletion fragment according to claim 1 in any of the following: 1) Create male sterile cotton lines; 2) Detecting or assisting in detecting the male fertility of cotton, or preparing a product for detecting whether the cotton to be tested is male sterile cotton; 3) Detecting whether the cotton to be tested is a male sterile line, or preparing a product for detecting whether the cotton to be tested is a male sterile line; 4) Detecting whether the cotton to be tested is a male sterile line and whether the cotton to be tested can be used as a male sterile line, or preparing a product for detecting whether the cotton to be tested is a male sterile line and whether the cotton to be tested can be used as a male sterile line.

4. A GhCKI gene promoter mutant associated with cotton male fertility traits, characterized in that: The nucleotide sequences are shown in SEQ ID NO.2 to SEQ ID NO.

4.

5. An sgRNA for inhibiting the expression of the GhCKI gene promoter deletion fragment according to claim 1, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

5.

6. A recombinant expression vector, characterized in that: The CRISPR / Cas9 vector is used as a backbone plasmid, and the sgRNA described in claim 4 is inserted.

7. The method for constructing the recombinant expression vector according to claim 6, characterized in that: The sgRNA according to claim 5 is connected to the CRISPR / Cas9 vector by means of a polycistronic tRNA-gRNA to obtain the recombinant expression vector.

8. Use of the biological material for negatively regulating the GhCKI gene promoter deletion fragment according to claim 1, the GhCKI gene promoter mutant according to claim 4, the sgRNA according to claim 5, the recombinant expression vector according to claim 6, or the recombinant expression vector constructed by the construction method according to claim 7 in creating cotton male sterile lines and / or cotton hybrid breeding.

9. A method for creating a cotton male sterile line, characterized in that: The following steps are involved: The recombinant expression vector according to claim 6 or the recombinant expression vector constructed by the construction method according to claim 7 is transformed into a target cotton plant by genetic transformation to obtain a cotton male sterile line.

10. A method for detecting or assisting in detecting the male fertility of cotton to be tested, characterized in that: The steps include: A1. Detecting whether the cotton genome to be tested contains the GhCKI gene promoter deletion fragment according to claim 1; A2. According to the detection result of step A1, the male fertility of the cotton to be tested is determined according to the following standards: if the genome of the cotton to be tested does not contain the GhCKI gene promoter deletion fragment, the cotton to be tested is male sterile; if the genome of the cotton to be tested contains the GhCKI gene promoter deletion fragment, the cotton to be tested is male fertile.

Images