Grapefruit Indel molecular marker, amplification primer and application of grapefruit Indel molecular marker in grapefruit variety identification

Abstract

The invention belongs to the technical field of molecular marker development and molecular detection, and particularly relates to a grapefruit Indel molecular marker, an amplification primer and application of the grapefruit Indel molecular marker in grapefruit variety identification. The grapefruit Indel molecular marker disclosed by the invention can be used for quickly and accurately distinguishing 'Dongzhi grapefruit' from other pomelo citrus varieties. The molecular marker and the molecular marker amplification primer provided by the invention can provide an effective method and thought for seedling identification work of the Dongzhi pomelo variety, and can be simply, conveniently and quickly applied to scientific research or production practice of related pomelo varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker development and molecular detection, and specifically relates to a grapefruit Indel molecular marker, an amplification primer and an application thereof in grapefruit variety identification. Background Art

[0002] Citrus grandis is an important part of citrus. It is widely planted in China and ranks first in the world in terms of output, especially traditional Chinese pomelo varieties with comprehensive characteristics such as 'Shatian pomelo', 'Guanxi honey pomelo' and 'Majia pomelo'. In recent years, the scale of pomelo planting in my country has continued to expand, but the varieties are numerous and chaotic, and the supporting technologies such as variety selection and improvement are still in a relatively early stage of development. The production structure and maturity structure are also unreasonable.

[0003] At present, in the research of variety identification of citrus plants, morphological identification or molecular marker identification is mainly used. Among them, morphological identification is to observe and analyze the external morphology of flowers, fruits, leaves, branches, thorns, etc., and establish a taxonomic system for citrus plants based on typical phenotypic characteristics. For example, Li Runtang et al. [Li Runtang, Zhang Yingnan, Tian Dalun. Study on Stomata of Citrus Leaves. Journal of Fruit Science, 2004, 21(5):419-424] observed the stomatal morphology of 9 citrus varieties and found that the stomatal characteristics of different strains were significantly different, which can be used as microscopic characteristics for the classification of citrus varieties, and revealed that 'Fructus Aurantii Immaturus' is distantly related to Citrus and Fortunella. Chen Peng [Chen Peng. Investigation of wild Kumquat germplasm resources and genetic diversity in China [D]. Huazhong Agricultural University, 2011] By comparing the phenotypic characteristics of the leaves and wings of the 'Kumquat', the appearance of the fruit and the embryonic characteristics of the seeds, it is shown that the types of Kumquat germplasm resources in my country are rich and diverse. It can be seen that morphological identification relies on appearance and some physiological characteristics for selection, but there are few morphological markers available, which are easily affected by the environment, and the morphological characteristics of the hybrid seedlings of pomelo are very similar, so accurate identification cannot be carried out in the early stage.

[0004] DNA molecular marker technology is a method of identifying organisms at the molecular level by using gene polymorphism at the DNA level. Compared with other markers, DNA molecular markers have a wide distribution range in biological tissues, strong polymorphism, and are less affected by environmental and time factors. They can quickly distinguish the authenticity of seedlings, and the identification results are more accurate. In the study of citrus genetic identification, the commonly used DNA molecular markers mainly include random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism markers (AFLP) and simple sequence repeats (SSR). Among them, RAPD is a molecular technology for polymorphic analysis of genomes based on PCR, but its amplification stability and repeatability are seriously defective; AFLP is often used to identify germline DNA fingerprints, genetic diversity of fruit tree varieties, etc., but it is prone to false positive fragments and low identification accuracy; SSR is a relatively widely used molecular marker technology. Its markers are distributed throughout the genome and have high polymorphism, but its marker band type needs to be distinguished by polyacrylamide gel electrophoresis. The operation process is cumbersome and involves some highly toxic reagents, so it is not suitable for safe and efficient identification.

[0005] In summary, the existing methods for identifying pomelo varieties and germplasm sources have certain defects, which limit the efficiency and accuracy of identifying the genetic background of pomelo varieties. Summary of the invention

[0006] The object of the present invention is to provide a grapefruit Indel molecular marker, an amplification primer and an application thereof in grapefruit variety identification. The grapefruit Indel molecular marker can be used for rapid and accurate identification of grapefruit varieties, especially for identification of 'Dongshi Zaoyou'.

[0007] The present invention provides a grapefruit Indel molecular marker, which is located at 38807805bp of the second chromosome of the 'Wanbaiyou' genome and has an insertion / deletion polymorphism of 143bp as shown in SEQ ID NO.1.

[0008] Preferably, the nucleotide sequence comprising the grapefruit Indel molecular marker is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0009] The present invention also provides amplification primers for grapefruit Indel molecular markers according to the above technical solution, and the nucleotide sequences of the forward primer and the reverse primer of the amplification primer are shown as SEQ ID NO.8 and SEQ ID NO.9 respectively.

[0010] The present invention also provides the use of the amplification primers described in the above technical solution in the preparation of grapefruit detection reagents, kits, genome chips or liquid phase probes.

[0011] The present invention also provides a grapefruit detection product, which includes the amplification primers described in the above technical solution.

[0012] Preferably, the types of the products include reagents, kits, genomic chips or liquid phase probes.

[0013] The present invention also provides the use of the grapefruit Indel molecular marker described in the above technical solution, the amplification primer described in the above technical solution or the grapefruit detection product described in the above technical solution in the identification or differentiation of grapefruit varieties.

[0014] Preferably, the application includes identification of 'Dongshi Zaoyou'.

[0015] The present invention also provides a method for identifying 'Dongshi Zaoyou' according to the above technical solution, comprising the following steps:

[0016] Amplify the genomic DNA of the grapefruit sample to be tested with the amplification primers to obtain a PCR amplification product;

[0017] Performing gel electrophoresis detection on the PCR amplification product to obtain gel electrophoresis amplification bands;

[0018] The result is determined based on the size of the amplified band in the gel electrophoresis:

[0019] When the gel electrophoresis amplification band is 343 bp, the grapefruit sample to be tested is 'Dongshi Zaoyou';

[0020] When the gel electrophoresis amplification band is 204 bp, the grapefruit sample to be tested is a variety other than 'Dongshi Zaoyou';

[0021] The amplification primers are the amplification primers described in the above technical solution.

[0022] Preferably, the PCR amplification system includes: 10.0 μL 2×Taq Mix, 0.5 μL forward primer with a concentration of 10 mmol / L, 0.5 μL reverse primer with a concentration of 10 mmol / L, 1.0 μL genomic DNA and 8.0 μL ddH2O.

[0023] The PCR amplification procedure includes pre-denaturation at 94° C. for 5 min; denaturation at 94° C. for 1 min, annealing at 55° C. for 30 s, extension at 72° C. for 1 min, 35 cycles; and final extension at 72° C. for 10 min.

[0024] Beneficial effects:

[0025] The present invention provides a grapefruit Indel molecular marker, which is located at the 38807805bp of the second chromosome of the 'Late White Pomelo' genome, and has an insertion / deletion polymorphism of 143bp as shown in SEQ ID NO.1. On this basis, the present invention also provides amplification primers for the grapefruit Indel molecular marker, and the grapefruit Indel molecular marker can be used to quickly and accurately distinguish 'Dongshi Zaoyou' from other grapefruit citrus varieties. The molecular marker and molecular marker amplification primer described in the present invention can provide an effective method and idea for the identification of seedlings of the 'Dongshi Zaoyou' variety, and can be easily and quickly applied to the scientific research or production practice of related grapefruit varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0027] Figure 1 Visualize the InDel03 mutation information using the IGV2.10.3 software in Example 1;

[0028] Figure 2 The results of InDel primer identification of 10 Citrus pomelo germplasms in Example 1;

[0029] Figure 3 The InDel03 mutation information is visualized by GeneDoc software in Example 1;

[0030] Figure 4 This is the result of InDel03 primer identification of 65 citrus pomelo germplasms in Example 2. DETAILED DESCRIPTION

[0031] The present invention provides a grapefruit Indel molecular marker, which is located at 38807805bp of the second chromosome of the 'Wanbaiyou' genome and has an insertion / deletion polymorphism of 143bp as shown in SEQ ID NO.1.

[0032] The nucleotide sequence shown in SEQ ID NO. 1 of the present invention is specifically: 5'-AGAAGTTAGAAATG TTTTGTGTTGCAATCCGTGTACTCTACATCTAGGAATAGATGATACTCTTTTC GCCACAAAATTTTATATAAATTTTTATATCATAATATAATTGGTTGAATGAAA CAAAAACACACCAAAAACTATGC-3'.

[0033] As an embodiment, the nucleotide sequence of the grapefruit Indel molecular marker of the present invention can be shown as SEQ ID NO.2 or SEQ ID NO.3; the nucleotide sequences shown in SEQ ID NO.2 or SEQ ID NO.3 are as follows, SEQ ID NO.2: 5'-AGATTACAATAACATTTCGCAGC TATATATGATTCATCACTTACCAATTTTTTTTTTTTTATTTCCTACTGTCGTCGTAATGTATCAGAAGTTAGAAATGTTTTGTGTTGCAATCCGTGTACTCTACATCTAGGAATAGATGATACTCTTTTCGCCACAAAATTTTATATAAATTTTTATATCATAATATAATTGGTTGAATGAAACAAAAACACACCAAAAACTATGCCCTTTTTTGGTAAATTAAAAAAAAATTATAACTTACTTCCGGTGTAACTTCGTTTTGTGTGATTTTTAGGAATTTTTTTTCATAATTTAATTAAAGCAATCGTTGGTTGGTTT-3'; NO.3: 5'-AGATTACAATAACATTTCGCAGCTATATTATA TGATTGATCTCTTACCAATTTATTTTTTTTATTTCCTACTGTCGTCGTAATGTATCCTTTTTTGGTAAATTAAAAAAAAAATTATAACTTACTTCGGTGTAACTTCGTTTTGTGTGTGATTTTTAGGAAATTTTTCATAATTTAATTAAAGCAATCGTTGGTTGGTTT-3'.

[0034] The present invention also provides amplification primers for grapefruit Indel molecular markers according to the above technical solution, and the nucleotide sequences of the forward primer and the reverse primer of the amplification primer are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively. The nucleotide sequences shown in SEQ ID NO.8 or SEQ ID NO.9 of the present invention are as follows, SEQ ID NO.8: 5'-AGATTACAATAACATTTCGCAGCT-3'; SEQ ID NO.9: 5'-AAACCAACCAACGATTGCTT-3'.

[0035] The present invention also provides the use of the amplification primers described in the above technical solution in the preparation of grapefruit detection reagents, kits, genome chips or liquid phase probes.

[0036] The present invention also provides a grapefruit detection product, which includes the amplification primers described in the above technical solution. As an embodiment, the product of the present invention can be a reagent, a kit, a genome chip or a liquid probe. In a specific embodiment, the product can be a kit, and the kit can also include a PCR amplification reagent.

[0037] The present invention also provides the use of the grapefruit Indel molecular marker described in the above technical solution, the amplification primer described in the above technical solution, or the grapefruit detection product described in the above technical solution in the identification or differentiation of grapefruit varieties. As an embodiment, the application of the present invention can be the identification of 'Dongshi Zaoyou'. As another embodiment, the identification of 'Dongshi Zaoyou' described in the present invention can be the identification of the authenticity of 'Dongshi Zaoyou' seedlings.

[0038] The present invention also provides a method for identifying 'Dongshi Zaoyou' according to the above technical solution, comprising the following steps:

[0039] Amplify the genomic DNA of the grapefruit sample to be tested with the amplification primers to obtain a PCR amplification product;

[0040] Performing gel electrophoresis detection on the PCR amplification product to obtain gel electrophoresis amplification bands;

[0041] The result is determined based on the size of the amplified band in the gel electrophoresis:

[0042] When the gel electrophoresis amplification band is 343 bp, the grapefruit sample to be tested is 'Dongshi Zaoyou';

[0043] When the gel electrophoresis amplification band is 204 bp, the grapefruit sample to be tested is a variety other than 'Dongshi Zaoyou';

[0044] The amplification primers are the amplification primers described in the above technical solution.

[0045] As an embodiment, the genomic DNA of the grapefruit sample to be tested in the present invention can be extracted from leaves, fruits or root tissues. The present invention has no special limitation on the method of extracting the genomic DNA, and the conventional genomic DNA extraction method in the art can be used.

[0046] As an embodiment, the PCR amplification system of the present invention can be: 10.0 μL 2×Taq Mix, 0.5 μL forward primer with a concentration of 10 mmol / L, 0.5 μL reverse primer with a concentration of 10 mmol / L, 1.0 μL genomic DNA and 8.0 μL ddH2O. The PCR amplification program can be 94°C pre-denaturation for 5 min; 94°C denaturation for 1 min, 55°C annealing for 30 s, 72°C extension for 1 min, 35 cycles; 72°C final extension for 10 min.

[0047] As an embodiment, the gel electrophoresis detection of the present invention may be agarose gel electrophoresis detection; as another embodiment, the agarose gel electrophoresis detection of the present invention may be 2.5% agarose gel electrophoresis detection.

[0048] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0049] Example 1

[0050] InDel primer design and screening of effective primers

[0051] 1. Material selection

[0052] Using 'Dongshi Zaoyou' and 64 varieties of citrus pomelo as test materials, the genomic DNA of citrus varieties was extracted by CTAB method, and the extracted 'Dongshi Zaoyou' DNA was purified to meet the quality requirements for resequencing. Among them, 'Dongshi Zaoyou' and 'Shatianyou' were from the pomelo experimental base of Yunnan Tropical Crop Science Research Institute, and other varieties were provided by Dr. Zhang Yingzi of the College of Horticulture and Forestry of Huazhong Agricultural University (Table 1).

[0053] Table 165 Summary of information on grapefruit varieties

[0054]

[0055]

[0056]

[0057] 2. InDel primer design and screening of effective primers

[0058] The genome of 'Wanbaiyou' was used as the reference genome (http: / / citrus.hzau.edu.cn / ), and bioinformatics methods were used to analyze the whole genome resequencing data of 'Dongshi Zaoyou'. FastQC software was used to perform quality control and filtering on the raw resequencing data, remove the adapter sequences and low-quality reads, and then the quality-controlled reads were aligned to the 'Wanbaiyou' genome using BWA software. GATK4.2.0 software was used to perform whole genome InDel variant site detection and gvcf file merging and filtering. The vcf files containing InDel information were sorted according to the InDel fragment size to determine the variant site information, and IGV2.10.3 software was used to further visualize and verify the variant information ( Figure 1 ),Depend on Figure 1 It was found that there was an insertion of a base fragment at 38807805 bp on the second chromosome of 'Dongshi Zaoyou'.

[0059] According to the above-mentioned genome variation sequence of 'Dongshi Zaoyou', 10 pairs of specific high-quality primer pairs were designed (Table 2), and then the effectiveness of the InDel marker primer pairs was screened.

[0060] Table 2 Information of InDel primers used for genetic identification of 'Dongshi Zaoyou'

[0061]

[0062]

[0063] PCR amplification was performed on the grapefruit varieties of 'Dongshi Zaoyou', 'Wanbaiyou', 'Shuimiyou', 'Yonghong Aiwanyou', 'Juhuaxinyou', 'Zaoshu Gaosuangxiangyou 4', 'Jinlanyou', 'Sanshubanyou', 'Cilixiangyou', and 'Wendanyou'. The amplified bands were detected by electrophoresis, and the high-quality specific difference InDel markers of 'Dongshi Zaoyou' were selected as candidate effective provenance identification primers. The specific operation steps are as follows:

[0064] The PCR reaction system was 20 μL, and the components were 10.0 μL 2×Taq Mix, 0.5 μL F (forward primer 10 mmol / L), 0.5 μL R (reverse primer 10 mmol / L), 1.0 μL DNA (template 300 ng / L), and 8.0 μL ddH2O.

[0065] The PCR reaction program was 94°C pre-denaturation for 5 min, 94°C denaturation for 1 min, 55°C annealing for 30 s, 72°C extension for 1 min, 35 cycles, 72°C final extension for 10 min, and storage at 4°C.

[0066] After amplification according to the above PCR reaction system and PCR reaction procedure, the PCR amplification product was electrophoresed in 2.5% agarose gel (0.5×TBE buffer) and visualized by Goldview (Guangzhou Jianyang Biotechnology Co., Ltd.) and the results were observed under the gel imaging system. The results are as follows: Figure 2 As shown, in Figure 2 In the table, M stands for Marker, and 1 to 10 respectively represent 'Dongshi Zaoyou', 'Wanbaiyou', 'Shuimiyou', 'Yonghong Aiwanyou', 'Juhuaxinyou', 'Early-ripening Gaosugar Fragrant Youme 4', 'Jinlanyou', 'Sanshubanyou', 'Cili Xiangyou', and 'Wendanyou'.

[0067] Depend on Figure 2 It can be concluded that InDel01 is a unique marker for 'Wendanyou', which is different from other varieties. InDel03 can significantly distinguish 'Dongshi Zaoyou' from the other 9 varieties. InDel02, InDel06 and InDel08 cannot be used as unique markers for 'Dongshi Zaoyou'. According to the test results, an effective primer pair InDel03 was finally determined to distinguish 'Dongshi Zaoyou' from 9 citrus pomelo varieties.

[0068] At the same time, the InDel03 site was cloned and sequenced. The specific operations are as follows:

[0069] The E. coli cloning strain was DH5α, purchased from Beijing TransGen Biotech Co., Ltd.; the blunt-end cloning vector pClone007 Blunt Simple Vector Kit was purchased from Beijing Tsingke Biotechnology Co., Ltd.

[0070] Specific primers SEQ ID NO.8 and SEQ ID NO.9 were designed using SEQ ID NO.2 or SEQ ID NO.3, and the mutation sites of 'Dongshi Zaoyou' and 'Guanxi Miyou' were amplified by PCR, and the PCR products were recovered and used. DNA recovery kit (Omega, USA) was used and the instructions of the kit were followed. The purified fragments were connected to the blunt-end cloning vector pClone007, and then transformed into Escherichia coli DH5α, cultured overnight at 37°C, and two single clones were picked from each culture dish transformed with SEQ ID NO.1. The size of the transformation product was amplified and detected using primers SEQ ID NO.8 and SEQ ID NO.9 corresponding to InDel03 in Table 2. After the size of the transformation product met the target band size, it was sent to Qingke Biotech for sequencing. The specific steps of TA cloning refer to the instructions of the Blunt Simple VectorKit kit for the blunt-end cloning vector pClone007. ClustalX software was used for sequence alignment of the variant sites, and GeneDoc software was used for visualization.

[0071] Depend on Figure 3 It can be concluded that by cloning the InDel03 mutation site of 'Dongshi Zaoyou' and 'Guanxi Miyou', it was found that 'Dongshi Zaoyou' had 143bp and 1bp fragment insertions and 3bp and 2bp deletion sequences at this site ( Figure 3 , where DSZ and GXMY represent 'Dongshi Zaoyou' and 'Guanxi Miyou', respectively). It can be seen that compared with other varieties, 'Dongshi Zaoyou' has a 143 bp sequence fragment inserted, and this feature can be used to distinguish 'Dongshi Zaoyou' from other pomelo varieties using the InDel03 primer pair.

[0072] Example 2

[0073] Verification of the InDel03 Primer Pair Specific to 'Dongshi Zaoyou'

[0074] To verify the validity of the selected InDel03 marker primer pair for 'Dongshi Zaoyou', the initial 10 pomelo materials were expanded to 65 pomelo varieties (Table 1) as a demonstration. PCR amplification was performed using InDel03 primers on 65 pomelo citrus materials including 'Dongshi Zaoyou'.

[0075] The specific steps are as follows:

[0076] According to Example 1, genomic DNA of 65 pomelo materials was extracted, and the results were tested by agarose gel electrophoresis. The concentration was tested by spectrophotometer and the DNA was diluted to 300 ng / μL for later use.

[0077] The PCR reaction system was 20 μL, and the components were 10.0 μL 2×TaqMix, 0.5 μL F (forward primer 10 mmol / L), 0.5 μL R (reverse primer 10 mmol / L), 1.0 μL DNA (template 300 ng / L), and 8.0 μL ddH2O.

[0078] The PCR reaction program was 94°C pre-denaturation for 5 min, 94°C denaturation for 1 min, 55°C annealing for 30 s, 72°C extension for 1 min, 35 cycles, 72°C final extension for 10 min, and storage at 4°C.

[0079] The amplified products were electrophoresed in 2.5% agarose gel (0.5×TBE buffer) and visualized using Goldview. Figure 4 As shown, M stands for Marker, DSZ stands for 'Dongshi Zaoyou', and the numbers: 2 to 65 represent a one-to-one correspondence with the pomelo varieties represented by the numbers in Table 1.

[0080] Depend on Figure 4 It can be concluded that the DSZ band amplified by the InDel03 marker primer of the present invention is 343 bp, while the amplified bands of other varieties are 204 bp, that is, the InDel03 marker primer of the present invention can distinguish 'Dongshi Zaoyou' from 64 citrus pomelo varieties.

[0081] It can be concluded from the above examples that the grapefruit Indel molecular markers of the present invention can be used to quickly and accurately identify grapefruit varieties, especially the 'Dongshi Zaoyou'.

[0082] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A grapefruit Indel molecular marker, characterized in that: The pomelo Indel molecular marker is located at 38807805 bp of the second chromosome of the 'Wanbaiyou' genome, and has an insertion / deletion polymorphism of 143 bp as shown in SEQ ID NO.

1.

2. The grapefruit Indel molecular marker according to claim 1, characterized in that: The nucleotide sequence containing the grapefruit Indel molecular marker is shown as SEQ ID NO.2 or SEQ ID NO.

3.

3. The amplification primers for grapefruit Indel molecular markers according to claim 1 or 2, characterized in that: The nucleotide sequences of the forward primer and the reverse primer of the amplification primer are shown in SEQ ID NO.8 and SEQ ID NO.9 respectively.

4. Use of the amplification primers according to claim 3 in the preparation of grapefruit detection reagents, kits, genome chips or liquid phase probes.

5. A grapefruit detection product, characterized in that: The grapefruit detection product comprises the amplification primer according to claim 3.

6. The grapefruit detection product according to claim 5, characterized in that: The types of products include reagents, kits, genomic chips or liquid phase probes.

7. Use of the grapefruit Indel molecular marker according to claim 1 or 2, the amplification primer according to claim 3, or the grapefruit detection product according to claim 5 or 6 in identifying or differentiating grapefruit varieties.

8. The use according to claim 7, characterized in that: The application includes the identification of 'Dongshi Zaoyou'.

9. A method for identifying 'Dongshi Zaoyou', characterized in that: The steps include: Amplify the genomic DNA of the grapefruit sample to be tested with the amplification primers to obtain a PCR amplification product; Performing gel electrophoresis detection on the PCR amplification product to obtain gel electrophoresis amplification bands; The result is determined based on the size of the amplified band in the gel electrophoresis: When the gel electrophoresis amplification band is 343 bp, the grapefruit sample to be tested is 'Dongshi Zaoyou'; When the gel electrophoresis amplification band is 204 bp, the grapefruit sample to be tested is a variety other than 'Dongshi Zaoyou'; The amplification primer is the amplification primer according to claim 3.

10. The method according to claim 9, characterized in that The PCR amplification system includes: 10.0 μL 2×TaqMix, 0.5 μL forward primer with a concentration of 10 mmol / L, 0.5 μL reverse primer with a concentration of 10 mmol / L, 1.0 μL genomic DNA and 8.0 μL ddH2O. The PCR amplification program includes 94°C pre-denaturation for 5 min; 94°C denaturation for 1 min, 55°C annealing for 30 s, 72°C extension for 1 min, 35 cycles; 72°C final extension for 10 min.

Images