An internal reference gene of emblica fruit at different developmental stages and its detection primers and application

Abstract

The present invention discloses an internal reference gene of a fruit of Phyllanthus emblica at different developmental stages, a detection primer and an application thereof, wherein the internal reference gene is PeSTRG.26181.1.p1, and its nucleotide sequence is shown in SEQ ID NO.13. The present invention preliminarily screens out 13 candidate internal reference genes through transcriptome sequencing data, and then screens out the internal reference gene PeSTRG.26181.1.p1 most stably expressed in Phyllanthus emblica fruit from the 13 candidate internal reference genes based on five internal reference gene stability evaluation software. The present invention also provides real-time fluorescence quantitative PCR detection primers for the internal reference gene, and the primer sequences are shown in SEQ ID NOs.38 and 39. The internal reference gene and the detection primer can be used in the real-time fluorescence quantitative expression analysis of Phyllanthus emblica functional genes, which can significantly improve the specificity, stability and accuracy of functional gene expression data, and provide strong support for the expression analysis of Phyllanthus emblica functional genes.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to an internal reference gene of emblica emblica fruits at different developmental stages and a special detection primer and application thereof. Background Art

[0002] Phyllanthus emblica L. is a perennial deciduous small tree belonging to the genus Phyllanthus in the Euphorbiaceae family. Its fruit contains 12 vitamins, 16 minerals, and 18 amino acids. The nutrients are comprehensive and rich in content. It also contains bioactive ingredients such as phenolic acids, flavonoids, and tannins, which have pharmacological effects of anti-oxidation, hypoglycemic, antibacterial, anti-inflammatory, immune regulation, and liver protection. The fruit of Phyllanthus emblica is rich in nutrients, has high medicinal value, and has a unique sweet flavor. It is now widely used in food, medicine, daily chemicals and other fields. At the same time, the plant of Phyllanthus emblica is drought-resistant and grows well on barren wasteland and slopes. It is one of the preferred tree species for tropical and subtropical ecological restoration. The fruit is the main part of Phyllanthus emblica, and its fruiting period is about 6 months (24 weeks after flowering). During the ripening process of Phyllanthus emblica, the phenotypic traits and quality traits of the fruit will change. With the deepening of research on genetic improvement of Phyllanthus emblica, the use of molecular biology technology to explore the expression patterns of genes related to fruit ripening in Phyllanthus emblica has become an important part of the improvement of important traits and directed genetic breeding of Phyllanthus emblica.

[0003] Real-time fluorescence quantitative PCR technology (RT-qPCR technology) is a detection technology used to evaluate the expression level of the target gene. However, factors such as RNA quality, reverse transcription efficiency, and experimental operation errors can affect the final results of RT-qPCR. The internal reference gene has the characteristics of being able to stably express in different tissues, growth periods, and growth conditions of plants. If the internal reference gene is used to proofread the RT-qPCR results, the error of the expression level of the target gene can be effectively reduced, thereby improving the accuracy of the test. At present, suitable internal reference genes have been identified for a variety of plants. When using RT-qPCR technology to evaluate the expression pattern of genes related to the ripening of emblica fruit, it is necessary to screen out the internal reference genes that are stably expressed in emblica fruit. For example, the GASA gene belongs to the cysteine-rich small peptide family. It was originally discovered in Arabidopsis thaliana and is a gibberellin regulatory gene in Arabidopsis thaliana, affecting hormone-related physiological processes and biochemical reactions. The GASA gene is widely present in plants and can regulate fruit growth and development, and participate in plant hormone signal transmission and biological and abiotic stress responses.

[0004] Commonly used reference genes mainly include actin gene (ACT), transcription elongation factor gene (EF1α), α-tubulin and β-tubulin genes (TUA, TUB), 18S ribosomal RNA (18S rRNA), 3-phosphoglyceraldehyde dehydrogenase gene (GAPDH) and polyubiquitinase gene (UBQ). Ideal reference genes should be stably expressed under specific experimental conditions. Related studies have shown that most commonly used reference genes are not stably expressed in different developmental stages, different tissues and organs, and different experimental conditions. Before RT-qPCR analysis under specific experimental conditions, in order to accurately quantify the expression level of the target gene, it is necessary to screen out suitable reference genes. At present, there is no report on the systematic screening and verification of reference genes in Phyllanthus emblica. Summary of the invention

[0005] The invention aims to provide an internal reference gene of emblica fruit at different developmental stages and a detection primer thereof, which can be used for the detection of the internal reference gene of emblica and the fluorescence quantitative expression analysis of functional genes.

[0006] In order to achieve the above object, the present invention provides an internal reference gene of fruits of Phyllanthus emblica at different developmental stages, the internal reference gene is PeSTRG.26181.1.p1, and its nucleotide sequence is shown in SEQ ID NO.13, wherein the fruits of Phyllanthus emblica at different developmental stages are fruits of 0 to 26 weeks after flowering of Phyllanthus emblica. The internal reference gene provided by the present invention can be used for real-time fluorescence quantification and expression analysis in Phyllanthus emblica gene research.

[0007] The present invention also provides a detection primer for the above-mentioned internal reference gene, and the nucleotide sequence of the detection primer is shown in SEQ ID NOs. 38 and 39.

[0008] The present invention also provides an internal reference detection kit for fruits of Phyllanthus emblica at different developmental stages, the kit comprising detection primers whose nucleotide sequences are shown as SEQ ID NOs. 38 and 39.

[0009] The present invention also provides an internal reference detection method for the fruit of Phyllanthus emblica, which specifically comprises performing PCR amplification on the extracted Phyllanthus emblica genome sample using detection primers with nucleotide sequences such as those shown in SEQ ID NOs. 38 and 39.

[0010] The technical solution of the present invention has the following advantages:

[0011] The present invention screens out candidate internal reference genes stably expressed in Phyllanthus emblica for the first time through a large amount of data analysis and a strict internal reference gene screening procedure, and screens out the internal reference gene PeSTRG.26181.1.p1 most stably expressed in Phyllanthus emblica fruits at different developmental stages from the candidate internal references, which can be applied to the expression analysis of the nutritional quality or other functional genes of Phyllanthus emblica fruits at different maturity stages, significantly improving the specificity, stability and accuracy of the functional gene expression analysis data, and providing strong support for the expression analysis of the functional genes in Phyllanthus emblica.

[0012] The invention also provides a group of detection primers specially used for detecting internal reference genes of emblica fruit, which can assist gene expression and function analysis through fluorescence quantification in the study of emblica gene function, and has high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the growth status of the emblica fruit of two varieties at different developmental stages in Experimental Example 1 of the present invention.

[0014] Figure 2 This is a graph showing primer specificity analysis of RT-qPCR amplification based on 13 candidate internal reference genes in Experimental Example 2 of the present invention.

[0015] Figure 3 This is a heat map of the expression levels of the candidate internal reference genes established in Experimental Example 3 of the present invention.

[0016] Figure 4 This is the expression level range result of the 13 internal reference genes established in Experimental Example 3 of the present invention.

[0017] Figure 5 This is the expression stability analysis result of the 13 candidate reference genes established in Experimental Example 3 of the present invention based on RefFinder analysis.

[0018] Figure 6 The expression stability analysis results of the 13 candidate internal reference genes established in Experimental Example 3 of the present invention based on BestKeeper analysis.

[0019] Figure 7 This is the expression stability analysis result of the 13 candidate reference genes established in Experimental Example 3 of the present invention based on Delta CT analysis.

[0020] Figure 8 This is the expression stability analysis result of the 13 candidate reference genes established in Experimental Example 3 of the present invention based on NormFinder analysis.

[0021] Fig. 9 This is the expression stability analysis result of the 13 candidate internal reference genes established in Experimental Example 3 of the present invention based on geNorm analysis.

[0022] Fig.10 This is the stability verification result of the gene PeSTRG.4700.1.p1 based on the transcriptome level and two candidate internal reference genes in Experimental Example 4 of the present invention. DETAILED DESCRIPTION

[0023] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] Note: The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0025] Experimental Example 1 Screening of candidate reference genes in fruits of Phyllanthus emblica at different developmental stages

[0026] 1. Experimental Materials and Transcriptome Sequencing

[0027] The present invention uses the emblica germplasm resources (YGZ400, YGZ16-18) planted in the National Dry-hot Zone Characteristic Crop Germplasm Resource Nursery of the Institute of Tropical Ecological Agriculture of Yunnan Academy of Agricultural Sciences as materials, collects emblica fruit samples 6 to 26 weeks after flowering, and takes samples every 2 weeks, for a total of 11 periods. Three biological replicates are set for each resource in each sampling period. The growth conditions of emblica fruits of two varieties at different developmental stages are shown in Figure 2. Figure 1 After being collected and quick-frozen in liquid nitrogen, samples of Phyllanthus emblica fruits at 6, 10, 18, and 26 weeks after flowering (recorded as 6, 10, 18, and 26 WAF) were selected for transcriptome sequencing, and the remaining samples were transferred to a -80°C refrigerator for storage.

[0028] 2. Screening of candidate reference genes

[0029] Based on the transcriptome data obtained by sequencing, the mean value (Mean) and coefficient of variation (CV) of each gene transcript were calculated. In the above transcriptome data, according to the standard screening, the commonly used reference genes ACT (At3g46010, XM_012232381.1), TUB (XM_012218098.1), EF1α (At5g60390, XM_012226913.1), UBQ (At5g42300, At3g52560, etc., see Table 1 for details), GAPDH (XM_012231954.1), 60S (AT4G36130), PP2A (X97913), etc. in Euphorbiaceae and model plant Arabidopsis were found. According to the standards of Mean>30 and CV<0.3 of gene expression amount, the above reference genes were screened, and 13 candidate reference genes that were expressed and stably expressed in fruits at different developmental stages were obtained. The information of the candidate reference genes and their nucleotide sequences is shown in Table 1 below.

[0030] Table 1 Information of candidate reference genes

[0031]

[0032] Experimental Example 2 Determination of internal reference genes in fruits of Phyllanthus emblica at different developmental stages

[0033] 1. Total RNA Extraction and cDNA Synthesis

[0034] The samples stored in Experimental Example 1 were ground in liquid nitrogen, and RNA in the fruit samples of Phyllanthus emblica was extracted by a modified hot boric acid method, and the purity and concentration of RNA were detected by agarose gel electrophoresis and a nucleic acid protein concentration meter. According to the instructions of the Takara PrimeScript FAST RT reagent Kit with gDNA Eraser, the RNA samples of Phyllanthus emblica were reverse transcribed into cDNA and stored at -20°C for later use.

[0035] 2. Primer Design

[0036] Based on the 13 internal reference genes obtained in the above-mentioned Experimental Example 1, Beacon Designer 8 software was used to design specific primers corresponding to the 13 internal reference genes. The designed primers were scored with a melting temperature (Tm) of 60±1°C, a primer length of 18 to 21 bp, and an amplification length of 80 to 150 bp as the standards, and the primers with high scores were selected for synthesis. The primer sequences are shown in Table 2 below.

[0037] Table 2 Specific primer information

[0038]

[0039] 3. RT-qPCR reaction

[0040] After mixing the cDNA samples obtained by reverse transcription, dilute them into 4 0 , 4 -1 , 4 -2 , 4 -3 , 4 -4 There were 5 concentration gradients in total. The above dilutions were used as templates. The RT-qPCR reaction system was prepared on ice using a real-time fluorescence quantitative PCR detection kit (Takara TB Green Premix ExTaqTMⅡFAST qPCR Kit). The reaction system was: 1 μL sample solution, 1 μL forward primer, 1 μL reverse primer, 12.5 μL TB green premix, 9.5 μL sterile enzyme-free water, mixed and centrifuged, and then placed on a real-time fluorescence quantitative PCR instrument for reaction. Three biological replicates were set for each sample. The RT-qPCR operation program was 95°C pre-denaturation for 30 seconds, 95°C for 5 seconds, 60°C for 30 seconds, and then slowly heated from 65°C to 97°C to obtain the Cq value and melting curve of gene expression data.

[0041] 4. Primer Validation Analysis

[0042] The logarithmic values ​​of the five concentration gradients of the cDNA solution were used as the horizontal axis and the Cq value was used as the vertical axis to draw a standard curve in Excel software to obtain the correlation coefficient (R 2 ), the amplification efficiency (E value) of the internal reference gene was calculated by linear regression equation, E = (10 -1 / K –1)×100%, where K is the slope of the standard curve. The results are shown in Table 3. The E value of amplification primers with good specificity should be between 90% and 110%, and the correlation coefficient R 2 >0.99. As shown in the table, all 13 pairs of amplification primers have good specificity.

[0043] Table 313 Primer validation analysis results

[0044]

[0045] At the same time, the RT-qPCR melting curve of the candidate internal reference gene was obtained as follows Figure 2 As shown, red indicates high transcription levels and green indicates low transcription levels. Figure 2 It can be seen that the melting curves of the 13 candidate internal reference genes were all single-peaked, overlapping, without impurity peaks, without primer dimers, without nonspecific amplification, and with good repeatability, indicating that the above primers are reasonably designed with good specificity and can be used for RT-qPCR detection of emblica fruit.

[0046] Experimental Example 3 Stability analysis of internal reference genes

[0047] 1. Analysis of internal reference gene expression

[0048] A heat map was constructed based on the transcriptome data of the 13 selected candidate internal reference genes in the fruits of Phyllanthus emblica at different developmental stages. Figure 3 As shown by Figure 3 It can be seen that the 13 reference genes can be expressed in the fruits of Phyllanthus emblica at different developmental stages, and the fluctuation of each reference gene between different samples is small. Among them, the transcription levels of genes such as PeChr22G009860.1 and PeChr26G003160.2 are low, and the gene expression is low; the transcription levels of genes such as PeSTRG.1197.1.p1, PeSTRG.12624.p1 and PeSTRG.26181.1.p1 are high, and the gene expression is high.

[0049] Using cDNA of emblica YGZ400 and YGZ16-18 fruits at different developmental stages as templates, qRT-PCR detection was performed using the 13 candidate internal reference gene detection primers in Table 2 as primers to obtain the Cq values ​​of the 13 candidate internal reference genes. The expression level range of the internal reference genes was obtained as follows: Figure 4 As shown in Figure 2, a good reference gene Cq value should be between 15 and 30. Figure 4 It can be seen that all internal reference genes meet the basic requirements for standardized use and can be stably expressed. The average Cq values ​​of PeSTRG.12624.p1 and PeSTRG.26181.1.p1 are small, and the expression level is high; the average Cq value of PeChr22G009860.1 gene is large, and the expression level is low, which is consistent with the transcriptome sequencing results.

[0050] 2. Evaluation of the stability of internal reference genes

[0051] RefFinder, BestKeeper, Delta CT, NormFinder and geNorm software were used to analyze the expression stability of 13 candidate reference genes in the fruits of Phyllanthus emblica at different developmental stages. The results were as follows: Figure 5-Figure 9 The smaller the analysis value obtained, the better the expression stability of the internal reference gene. Figure 5-Figure 9 It can be seen that the comprehensive stability of the internal reference gene PeSTRG.26181.1.p1 is the strongest, followed by the PeChr26G003160.2 gene, and the stability of the PeSTRG.1197.1.p1 and PeSTRG.17299.1.p1 genes is poor. Therefore, the gene PeSTRG.26181.1.p1 is selected as the internal reference gene of the fruit of Phyllanthus emblica at different developmental stages. The nucleotide sequence of the gene is shown in SEQ ID NO.13.

[0052] Experimental Example 4 Verification of the stability of internal reference gene expression

[0053] The most stably expressed internal reference gene PeSTRG.26181.1.p1 and the least stably expressed internal reference gene PeSTRG.1197.1.p1 were selected for stability verification. The verified gene was PeSTRG.4700.1.p1, the nucleotide sequence of which is shown in SEQ ID NO.40. The detection primer sequence of the gene PeSTRG.4700.1.p1 was designed as follows:

[0054] PeSTRG.4700.1.p1-F(SEQ ID NO.41):

[0055] TTCATTGCTTCACTTCTCATC

[0056] PeSTRG.4700.1.p1-R(SEQ ID NO.42):

[0057] AGGAAGAGGTTTATCTTTGGA

[0058] Among them, the PeSTRG.4700.1.p1 gene is a homologous gene of the GASA gene (At4g09600), which is closely related to fruit development and maturation and abiotic stress. According to the transcriptome sequencing results, the expression level of the PeSTRG.4700.1.p1 gene in the fruits of Phyllanthus emblica at different developmental stages showed an increasing trend with the extension of the developmental period, and reached the highest level 18 weeks after flowering. In addition, the expression level of the PeSTRG.4700.1.p1 gene in YGZ16-18 was higher than that in YGZ400. The RT-qPCR data corrected with the internal reference gene were compared with the transcriptome measurement data (TPM). The results are as follows Fig.10 Show, among which, Fig.10A is the expression level based on the transcriptome, B is the expression level based on the internal reference gene PeSTRG.26181.1.p1, and C is the expression level based on the internal reference gene PeSTRG.1197.1.p1. The results of qRT-PCR analysis showed that after calibration using PeSTRG.26181.1.p1 as the internal reference gene, the expression trend of the PeSTRG.4700.1.p1 gene was consistent with the expression pattern of the transcriptome, that is, the expression level of the PeSTRG.4700.1.p1 gene was the lowest 6 weeks after flowering. , showing an increasing trend with the extension of the growth period, and the expression level of PeSTRG.4700.1.p1 gene in YGZ16-18 was higher than that in YGZ400 in the four growth periods; however, when PeSTRG.1197.1.p1 was used as the internal reference gene for calibration, there was no difference in the expression level of PeSTRG.4700.1.p1 gene between YGZ16-18 and YGZ400 6 weeks after flowering, and the expression level of YGZ400 decreased 18 weeks after flowering, indicating that the accuracy of gene expression was not high.

[0059] In summary, it can be determined that the PeSTRG.26181.1.p1 gene can be used as an internal reference gene for quantitative expression analysis of Phyllanthus emblica fruit, and can be applied to fluorescence quantification and expression analysis of Phyllanthus emblica genes. It can significantly improve the specificity, stability and accuracy of functional gene expression analysis data, provide strong support for the functional gene expression analysis of Phyllanthus emblica, and has specific potential application significance.

[0060] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. An internal reference gene for fruits of Phyllanthus emblica at different developmental stages, characterized in that: The internal reference gene is PeSTRG.26181.1.p1, and its nucleotide sequence is shown in SEQ ID NO.

13.

2. Application of the internal reference gene as claimed in claim 1 in real-time fluorescence quantification and expression analysis in Phyllanthus emblica gene research.

3. A detection primer for the internal reference gene as claimed in claim 1, characterized in that: The nucleotide sequences of the detection primers are shown in SEQ ID NOs. 38 and 39.

4. An internal reference detection kit for fruits of Phyllanthus emblica at different developmental stages, characterized in that: The kit comprises detection primers whose nucleotide sequences are shown as SEQ ID NOs. 38 and 39.

5. A method for detecting an internal reference of emblica fruit, characterized in that: The extracted Phyllanthus emblica genome sample was amplified by PCR using detection primers whose nucleotide sequences are shown in SEQ ID NOs. 38 and 39.

Images