A CpG adjuvant and its application

Abstract

The present invention relates to the field of vaccine technology. The present invention discloses a CpG adjuvant and an application thereof, which at least includes a sequence shown by KHS1-KHS6. The sequence of the present application can eliminate species specificity and can exert good immunostimulatory performance on both humans and mice; it can produce a strong synergistic effect with an aluminum adjuvant. In the application of Norovirus vaccine, the adjuvant effect significantly exceeds that of similar foreign sequences, producing unexpected effects, and has great promotion and application value.

Description

Technical Field

[0001] The present invention relates to the technical field of vaccines, and in particular to a CpG adjuvant and application thereof. Background Art

[0002] The statements in this section merely provide background information related to the present disclosure and may not constitute prior art.

[0003] At present, the vaccine adjuvants on the market in China are mainly aluminum adjuvants. Their safety and adjuvant effect are beyond doubt. They have been used for nearly a hundred years to assist various antigens to improve the immune effect and help people resist and prevent various diseases. However, aluminum adjuvants mainly stimulate the body to produce humoral immune responses, and have poor preventive effects on diseases that mainly rely on cellular immune responses. Therefore, it is necessary to develop new adjuvants that are safer, more efficient and biased towards cellular immunity.

[0004] With the development of recombinant protein technology and the maturity of subunit vaccine technology, a variety of new adjuvants have emerged to enhance the immune effect of antigens. In addition to aluminum adjuvants, the US FDA has approved a total of 6 new adjuvants, namely: MF59, AS01, AS03, AS04, CpG1018 and Matrix-M adjuvant for emergency use of the new crown; among them, CpG oligodeoxynucleotide (CpGODN, CpG oligodeoxynucleotide) is a newly discovered high-efficiency immune stimulant in recent years. It has been confirmed to be an agonist of TLR9, which mainly stimulates the body to produce Th1 type cell response immune response, can activate immune cells such as T cells, B cells, dendritic cells, stimulate the body to produce immune-related cytokines, and has a good adjuvant effect. In 2017, the U.S. FDA approved the marketing of Dynavax Technologies' world's first hepatitis B vaccine containing the CpG adjuvant CpG1018 (https: / / www.dynavax.com / product / heplisav-b / ). The safety, tolerability and good adjuvant effect of the CpG adjuvant have been confirmed by clinical trials and recognized by regulatory authorities. Dozens of clinical trials involving CpG adjuvants have been registered abroad (https: / / clinicaltrials.gov / ), involving diseases such as anthrax, influenza, COVID-19, hepatitis B, malaria, and tumors. The main sequences used are CpG1018 and CpG2006 (or CpG7909), and the core patents are all in the hands of foreign companies (Julia Scheiermann et al. Vaccine. 2014 November 12; 32(48): 6377–63892014). In China, two human vaccine clinical trials using CpG adjuvants have been accepted or approved (registration numbers CTR20233405 and CXSL2300409). Therefore, it is necessary to develop CpG adjuvant sequences with independent intellectual property rights as soon as possible. At the same time, CpG adjuvants have different adjuvant effects on different species of animals and different antigens. Developing CpG adjuvants for different diseases and overcoming species differences can greatly improve the efficiency of vaccine development and has broad application prospects and market demand. Summary of the invention

[0005] The purpose of the present invention is to provide a CpG adjuvant and its application in view of the species specificity problem of the current CpG adjuvant. The CpG adjuvant has a new CpG oligonucleotide sequence, overcomes the species effect of the CpG adjuvant, has a good stimulating effect on both mouse and human lymphocytes, has a significant synergistic effect when combined with an aluminum adjuvant, improves the immune effect of the antigen norovirus-like particle VLP, achieves a relatively balanced Th1 / Th2 cell response level, promotes the body to secrete specific antibody IgG2a, increases the specific blocking antibody titer in serum, and significantly improves the specific T cell response level.

[0006] The technical solution of the present invention is as follows:

[0007] In one aspect, the present invention provides a CpG adjuvant comprising at least one of the following CpG sequences:

[0008] KHS1: TCGGTCGTTCGGTCGTTCGTT;

[0009] KHS2: TATGTCGTTACGTTGTCGTTGGGGG;

[0010] KHS3: TCGTCGTTGTCGTTCGGGGG;

[0011] KHS4: TTGTCGTTGTCGTTCGTTGGGGG;

[0012] KHS5: TCGTTGTCGTTGTCGAACGTT;

[0013] KHS6: TGTCGTTCGAACGTTCGACGTT.

[0014] According to a preferred embodiment, the CpG sequence is further subjected to methoxy full-thio site modification.

[0015] According to a preferred embodiment, CpG sequences KHS2, KHS3 and KHS4 are added to the polyG tail.

[0016] Another aspect of the present invention provides a composite adjuvant, comprising the CpG adjuvant and aluminum adjuvant as described above, wherein the CpG adjuvant is 5-100 micrograms per dose, and the aluminum adjuvant is 50-500 micrograms per dose.

[0017] Another aspect of the present invention provides the use of the aforementioned CpG adjuvant and composite adjuvant in the preparation of vaccines.

[0018] Preferably, the vaccine is norovirus vaccine, anthrax vaccine, influenza vaccine, new crown vaccine, hepatitis B vaccine, malaria vaccine, rabies vaccine, pertussis vaccine, diphtheria vaccine, tetanus vaccine, herpes simplex vaccine, herpes zoster vaccine, tuberculosis vaccine, rotavirus vaccine, meningococcal vaccine, human papillomavirus vaccine, respiratory syncytial virus vaccine, hand, foot and mouth virus vaccine, metapneumovirus vaccine, etc.

[0019] Another aspect of the present invention provides a vaccine, comprising the CpG adjuvant and the aluminum adjuvant as described above, wherein the CpG adjuvant is 5 to 100 micrograms per dose, the aluminum adjuvant is 50 to 500 micrograms per dose, and further comprising an antigen in an amount of 0.5 to 40 micrograms per dose per valent antibody. The vaccine is a polypeptide vaccine, a recombinant protein vaccine, an inactivated vaccine or a subunit vaccine.

[0020] Preferably, the antigen is norovirus-like particle VLP (invention publication number CN115677838A), and subtypes include but are not limited to: GⅠ.1, GⅡ.2, GⅡ.3, GⅡ.4, GⅡ.6, GⅡ.17, etc.

[0021] The antigen is the original strain or variant strain of the virus; the antigen is a polypeptide, a combination of protein and active protein, an inactivated virus, etc. derived from the virus.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. A CpG adjuvant, the CpG sequence of which has a good stimulating effect on mouse spleen lymphocytes and human peripheral blood mononuclear cells PBMC, overcoming species specificity, and the stimulation index and key cytokine secretion level are higher than the negative control PBS group, and the stimulation effect is equivalent to that of the foreign sequence CpG2006, and the stimulation index and cytokine secretion level of some sequences are better than those of foreign sequences;

[0024] 2. A CpG adjuvant, which is the first to confirm that the combination of the CpG adjuvant and the aluminum adjuvant can significantly improve the humoral immunity level of the antigenic norovirus-like particles (VLPs), especially the CpG adjuvant designed in the present application, which improves the secretion levels of specific blocking antibodies, IgG2a and specific total antibodies IgG in serum; compared with the aluminum adjuvant group alone, it improves the IgG1 / IgG2a ratio and balances the Th2 / Th1 immune response; its effect is much higher than that of the single action;

[0025] 3. A CpG adjuvant. After immunizing mice with antigens, spleen lymphocytes were isolated for in vitro culture and antigen restimulation. The secretion levels of cytokines IFN-γ and IL-2 in the culture supernatant were measured. The study found that the antigen-specific T cell response level of the CpGKHS6+aluminum adjuvant group was significantly higher than that of the aluminum adjuvant group alone and the antigen group alone, and higher than that of the foreign adjuvant sequence CpG2006+aluminum adjuvant group, indicating that the combination of the independently designed CpG sequence and the aluminum adjuvant produces a significant synergistic effect in promoting immune response, and improves the level of specific T cell response produced by antigen stimulation. In the relevant applications of the present invention, the adjuvant effect is superior to the CpG2006 adjuvant sequence that is widely used in foreign clinical applications;

[0026] 4. A CpG adjuvant. The sequence designed by the present invention can exert an immunostimulatory effect on both mouse and human lymphocytes, overcoming the species-specific disadvantage of CpG adjuvant. It is also the first time that a composite adjuvant system consisting of CpG adjuvant and aluminum adjuvant is used to enhance the humoral and cellular immunity levels of Norovirus-like particles (VLPs), providing an important reference for clinical trials. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 In Example 1 of the present application, the MTT method was used to detect the in vitro stimulating proliferation effect of different CpG sequences on mouse spleen lymphocytes;

[0028] Figure 2 In Example 1 of the present application, the MTT method was used to detect the in vitro stimulation effect of different CpG sequences on human peripheral blood mononuclear cells PBMC;

[0029] Figure 3 21 days after mice were immunized with NoroVLP, mouse spleen lymphocytes were isolated for in vitro culture and antigen restimulation, and the stimulation supernatant was collected to detect the secretion of cytokine IL-2 by ELISA;

[0030] Figure 4 21 days after mice were immunized with NoroVLP, mouse spleen lymphocytes were isolated for in vitro culture and antigen restimulation, and the stimulation supernatant was collected to detect the secretion of cytokine IFN-γ by ELISA;

[0031] Figure 5 The secretion levels of serum specific antibody IgG at different times after mice were immunized with NoroVLP;

[0032] Figure 6 ELISA was used to detect the secretion of serum antibody subtypes IgG1 and IgG2a in mice 21 days and 35 days after immunization with NoroVLP;

[0033] Figure 7 Serum antibody subtype detection for mice 120 days after immunization with NoroVLP;

[0034] Figure 8 The specific blocking antibody titer in the sera of each group was detected 35 days after mice were immunized with NoroVLP. DETAILED DESCRIPTION

[0035] The specific embodiments listed in the present invention are only examples of the present invention, and the present invention is not limited to the specific embodiments described below. For those skilled in the art, any equivalent modifications and substitutions to the embodiments described below are also within the scope of the present invention. Therefore, the equal transformations and modifications made without departing from the spirit and scope of the present invention should be included in the scope of the present invention. If the specific conditions are not specified in the embodiments, they are carried out according to the conventional conditions or the conditions recommended by the manufacturer. If the manufacturers are not specified for all reagents or instruments, they are all conventional products that can be purchased commercially. In order to better illustrate the present invention, numerous specific details are given in the specific embodiments below. It should be understood by those skilled in the art that the present invention can also be implemented without certain specific details. In other embodiments, the methods, means, equipment and steps well known to those skilled in the art are not described in detail in order to highlight the purport of the present invention.

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art. Unless otherwise specified, the units used in this specification are all international standard units, and the numerical values ​​and numerical ranges appearing in the present invention should be understood to include the inevitable systematic errors in industrial production.

[0037] The data were analyzed by One-way ANOVA using SPSS software. * indicates significant difference, P<0.05; ** indicates extremely significant difference, P<0.001.

[0038] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0039] Example 1 Design of CpG adjuvant sequence and in vitro activity verification experiment

[0040] 1.1 Design and synthesis of CpG adjuvant sequences

[0041] CpG adjuvant generally refers to an oligodeoxynucleotide sequence CpG ODN containing cytosine-guanine. It was originally discovered in bacteria and is a non-methylated deoxynucleotide fragment. As an external signal molecule, it is recognized by toll-like receptor 9 in mammalian immune cells, producing a strong immunostimulatory effect, prompting the body to produce a series of immune responses, and can simultaneously activate innate and acquired immune pathways.

[0042] To stabilize the CpG sequence, all synthesized sequences were fully thiolated, and polyG tails were added to KHS2 / KHS3 / KHS4 to further improve sequence stability. The sequences used were commissioned to Anhui General Biotechnology for synthesis, and after synthesis, they were purified by HPLC and the endotoxin content was tested. The sequences used are shown in the table below:

[0043] Table 1. Sequences used in the development of CpG adjuvants

[0044]

[0045] 1.2 Comparison of the in vitro stimulatory effects of different CpG adjuvant sequences on mouse splenic lymphocytes

[0046] (1) Main experimental reagents:

[0047] RPMI 1640 medium, from Shanghai Yisheng Biotechnology Co., Ltd., catalog number 41402ES76;

[0048] Fetal bovine serum, from Gibco, catalog number A5669801;

[0049] Penicillin-streptomycin dual antibody, from Gibco, catalog number 15140-122;

[0050] MTT kit, from Shanghai Yisheng Biotechnology Co., Ltd., catalog number 40206ES80;

[0051] Red blood cell lysis buffer, from Shanghai Yisheng Biotechnology Co., Ltd., catalog number 40401ES76;

[0052] Phosphate buffered saline (PBS) was obtained from Wuhan Biosense Biotechnology Co., Ltd., catalog number PB180327;

[0053] Trypan blue solution was from Beijing Solebow Technology Co., Ltd., catalog number C0040.

[0054] (2) Experimental animals:

[0055] 6-8 week old SPF grade Balb / c mice were obtained from Beijing Weitonglihua Experimental Animal Technology Co., Ltd., certificate number: 511215600003615.

[0056] (3) Experimental methods:

[0057] The mice were killed by dislocating the neck and then soaked in alcohol for disinfection. The spleen of the mice was separated under sterile conditions. The spleen was fully ground and broken using a syringe plunger and a cell screen (40 μm pore size). 10 ml of sterile PBS was added to rinse the spleen, so that the lymphocytes were washed to the bottom of the 50 ml centrifuge tube. The lymphocytes were centrifuged to the bottom using a low-temperature centrifuge at a speed of 2000 rpm for 5 min. The supernatant PBS was discarded, 10 ml of red blood cell lysis buffer was added, and the mixture was gently shaken for 1 min to completely lyse the red blood cells. The supernatant PBS was discarded, and PBS was added to gently blow the cells at the bottom to resuspend them and wash the lymphocytes once. After centrifugation, the PBS was discarded. Finally, 10 ml of 1640 culture medium containing 10% fetal bovine serum and 1% double antibody was added to resuspend the cells. After further dilution, the cell concentration was adjusted to 1~3*10 6 Pieces / ml.

[0058] Lymphocytes were plated on a 96-well plate at 100 μl / well, with 3 replicates per group. CpG stock solutions in each group were diluted with PBS to a concentration of 100 μg / ml, and added to cells at a final concentration of 10 μg / ml or 20 μg / ml. The wells with only culture medium but no cells were used as blank groups, and the group with only lymphocytes and PBS was used as the control group. After the lymphocytes were cultured in a 37°C incubator for 48-72 hours, the 96-well plate was taken out, 10 μl of MTT was added to each well and incubated at 37°C for another 2-4 hours. According to the color change of each well, 100 μl / well of formazan solution was added to terminate the reaction, and the absorbance value of each well was read at 570 nm using an ELISA reader to determine the level of lymphocyte proliferation after CpG stimulation. The stimulation index (SI) of each group was calculated according to the absorbance value using the following formula:

[0059] Stimulation index SI=(OD value of experimental well-OD value of blank well) / (OD value of PBS well-OD value of blank well).

[0060] (4) Experimental results:

[0061] The experimental results are as follows Figure 1 As shown in the figure, the 6 designed CpG sequences all had significant stimulatory effects on mouse spleen lymphocytes, and the stimulation index was similar to that of the foreign sequence CpG2006, and significantly higher than that of the negative control PBS group; among them, CpGKHS3 showed a certain dose dependence, and the stimulation index was significantly higher than that of CpG2006 after the concentration increased from 10μg / ml to 20μg / ml. The above results show that the 6 designed CpG sequences can promote the proliferation of mouse spleen lymphocytes in vitro and have significant immunostimulatory effects.

[0062] 1.3 Comparison of the stimulatory effects of different CpG adjuvant sequences on human peripheral blood mononuclear cells (PBMCs)

[0063] (1) Main experimental reagents:

[0064] Lymphocyte separation medium, Tianjin Haoyang Biological Products Co., Ltd., catalog number LTS10771;

[0065] RPMI 1640 medium, from Shanghai Yisheng Biotechnology Co., Ltd., catalog number 41402ES76;

[0066] Fetal bovine serum, from Gibco, catalog number A5669801;

[0067] Penicillin-streptomycin dual antibody, from Gibco, catalog number 15140-122;

[0068] MTT kit, from Shanghai Yisheng Biotechnology Co., Ltd., catalog number 40206ES80;

[0069] Phosphate buffered saline (PBS) was obtained from Wuhan Biosense Biotechnology Co., Ltd., catalog number PB180327;

[0070] Trypan blue solution, from Beijing Solebow Technology Co., Ltd., catalog number C0040;

[0071] Human IL-6 cytokine detection kit, from Shenzhen Dakoway Biotechnology Co., Ltd., catalog number 1110602;

[0072] Human IFN-γ cytokine detection kit, from Shenzhen Dakoway Biotechnology Co., Ltd., catalog number 1110003;

[0073] Human IFN-α cytokine detection kit, from Shenzhen Dakoway Biotechnology Co., Ltd., catalog number 1110013.

[0074] (2) Experimental methods:

[0075] Human peripheral blood mononuclear cells (PBMCs) mainly contain lymphocytes, dendritic cells, monocytes, etc. They are the main source of peripheral immune cells and can be used to conveniently obtain relevant immune cells for adjuvant function verification. CpG adjuvants, as immune stimulants, can not only stimulate the proliferation of immune cells, but also promote the release of immune-related cytokines and enhance the immune effect.

[0076] Use sodium heparin anticoagulation tubes to collect 40-60ml peripheral blood from healthy volunteers, draw 5ml of fresh anticoagulated blood and slowly add it to a 15ml centrifuge tube containing 4ml lymphocyte separation solution, set the centrifuge parameters as follows: temperature 20℃, speed 600g, centrifugation time 25min. After centrifugation, draw the middle white lymphocyte layer into a new centrifuge tube, wash it with PBS, centrifuge parameters are the same as before, discard PBS after centrifugation, add 1640 culture medium to resuspend the cells, and adjust the cell density to 1~3*10 6 / ml, 100μl / well was spread on a 96-well plate, CpG sequences were added according to the 1.2 scheme, and a control group and a blank group were set up. The subsequent operation of the MTT experiment was the same as the mouse lymphocyte stimulation experiment steps. The stimulation index was calculated according to the OD value, and the stimulation effect of each group of CpG sequences on human lymphocytes was analyzed. The MTT method was used to detect the in vitro stimulation effect of different CpG sequences on human peripheral blood mononuclear cells PBMC, CpG2006 was used as a positive control, and the PBS group was used as a negative control.

[0077] (3) Experimental results:

[0078] The experimental results are as follows Figure 2 As shown, the designed 6 CpG sequences KHS1~KHS6 all had good immunostimulatory effects on human PBMC cells and promoted the proliferation of lymphocytes in vitro. The stimulation index was higher than that of the negative control PBS group and reached the level of the positive sequence CpG2006.

[0079] Take the same fresh anticoagulated blood, centrifuge and separate the lymphocytes, and adjust the cell density to 6*10 6 / ml, the cells were plated on another 24-well plate, and stimulated in vitro with CpG sequences (CpG concentration 10μg / ml) in the same way as above. The stimulation time was about 72h, and the supernatant of PBMC cells after stimulation was collected, centrifuged at 3000rpm for 10min, and the supernatant was frozen at -20℃ for later use. The expression levels of cytokines IFN-γ, IL-6 and IFN-α were subsequently detected by ELISA. The results of the detection of three cytokines in the culture supernatant after CpG adjuvant stimulation of human PBMC cells are as follows in Table 2:

[0080] Table 2. Cytokine secretion in the supernatant after stimulation of human PBMC cells with different CpG sequences

[0081]

[0082] ELISA results showed that KHS1~KHS6 can promote the release of IL-6, a core inflammatory factor in lymphocyte proliferation; KHS3 has a significant effect on human lymphocyte immunostimulation, and the levels of interferon IFN-α and IFN-γ released after stimulation are higher than those of the positive sequence CpG2006. The cytokine IFN-α released by CpGKHS6 after stimulating human PBMC is also significantly higher than that of the negative PBS group and the positive sequence group.

[0083] In summary, the in vitro stimulation experiment of CpG adjuvant confirmed that the six independently designed CpG sequences have good immunostimulatory effects on mouse lymphocytes and human PBMC cells. They can not only significantly promote the proliferation of lymphocytes cultured in vitro, but also promote the release of key cytokines in the immune pathway. At the same time, it also overcomes the species specificity of CpG adjuvant. In particular, sequences KHS3 and KHS6 have excellent immunostimulatory effects, and some indicators are better than those of foreign sequences. It can be inferred that the CpG adjuvant can also exert a good adjuvant effect in mice and humans, thereby improving the antigen immune effect.

[0084] Example 2: Animal Experimental Verification of CpG Sequence as Norovirus Vaccine Adjuvant

[0085] 2.1 Main experimental reagents:

[0086] RPMI 1640 medium, from Shanghai Yisheng Biotechnology Co., Ltd., catalog number 41402ES76;

[0087] Fetal bovine serum, from Gibco, catalog number A5669801; penicillin-streptomycin double antibody, from Gibco, catalog number 15140-122;

[0088] Red blood cell lysis buffer, from Shanghai Yisheng Biotechnology Co., Ltd., catalog number 40401ES76;

[0089] Sterile phosphate buffered saline (PBS) was obtained from Wuhan Biosus Biotechnology Co., Ltd., catalog number PB180327;

[0090] Trypan blue solution, from Beijing Solebow Technology Co., Ltd., catalog number C0040;

[0091] Antigen Norovirus-like particle VLP GⅡ.3, from the Norovirus Project Group of Chengdu Kanghua Biological Products Co., Ltd., batch number 202401;

[0092] Aluminum hydroxide adjuvant, from CRODA, catalog number Vac-alu-250; CpGKHS6, independently designed, synthesized by Anhui General Biotechnology Co., Ltd.;

[0093] CpG2006, from reference, synthesized by Anhui General Biotechnology Co., Ltd.;

[0094] Mouse cytokine IL-2 ELISA detection kit, from Shenzhen Dakoway Biotechnology Co., Ltd., catalog number 1210202;

[0095] Mouse cytokine IFN-γ ELISA detection kit, from Shenzhen Dakoway Biotechnology Co., Ltd., catalog number 121002;

[0096] HRP-labeled goat anti-mouse IgG, from abcam, catalog number Ab6789;

[0097] HRP-labeled goat anti-mouse IgG1, from abcam, catalog number Ab97240;

[0098] HRP-labeled goat anti-mouse IgG2a, from abcam, catalog number Ab9245;

[0099] ELISA plate, from Corning, catalog number 9018; TMB colorimetric solution, from Seracare, catalog number 5120-0074.

[0100] 2.2 Experimental Animals:

[0101] A total of 56 6-8 week old SPF grade Balb / c female mice weighing 18-22 g were obtained from Beijing Weitonglihua Experimental Animal Technology Co., Ltd., with a certificate number of 511215600003615. After grouping according to the protocol, 4 mice per cage were kept in a standard experimental animal room with constant temperature and humidity, with free access to water and food.

[0102] 2.3 Experimental methods:

[0103] (1) Experimental design:

[0104] In order to verify the adjuvant effect of the self-designed CpG sequence, based on the previous cell experiment results, KHS6 was selected as the CpG adjuvant for animal experiments, and the VLP protein of our company's Noru project group (invention publication number CN115677838A) was used as the antigen, PBS was used as the blank group, and CpG2006 was used as the positive control group to compare the levels of humoral and cellular responses in mice after immunization. The injection volume for each mouse was 0.1 ml, and 50 μl was injected intramuscularly in each left and right hind legs. The details of the experimental groups are shown in Table 3:

[0105] Table 3. Animal experiment groups and immunization conditions

[0106]

[0107] The immunization route was hind leg muscle injection. Each group was immunized twice, one basic immunization, followed by a booster immunization, with an interval of 14 days. The dosage of the required components for each group was calculated based on the concentrations of antigen VLP, CpG mother solution and aluminum adjuvant. 1 ml of vaccine for each group C1 to C7 was prepared in a clean workbench, mixed thoroughly with a vortex oscillator and stored at 4°C for standby use. The vaccine was transported to the animal room for animal immunization within 1 hour. The dosage of each component in the experimental group was: antigen VLP 5μg / mouse, CpG 20μg / mouse, and aluminum hydroxide adjuvant 250μg / mouse.

[0108] At different time points after immunization (21d / 35d / 56d / 120d), 5 mice were taken from each group for blood sampling through the jugular vein and serum was separated. The serum expression levels of specific blocking antibodies, total antibody IgG and antibody subtypes (IgG1, IgG2a) were detected by ELISA. 21 days after immunization, three mice were taken from each group to isolate spleen lymphocytes for in vitro culture and restimulation with antigen VLP. The expression levels of cytokines IL-2 and INF-γ in the supernatant after stimulation were detected, and the level of antigen-specific T cell response was analyzed to verify the CpG adjuvant effect.

[0109] (2) Cytokine detection method (cellular immunity level)

[0110] 21 days after the first immunization of the animals, three mice were taken from each group, and the mice were killed by dislocating the neck and then soaked in alcohol for disinfection. The spleen of the mice was separated under sterile conditions, and the spleen was fully ground and broken using a syringe plunger and a cell screen (40 μm pore size). 10 ml of sterile PBS was added to rinse, and the lymphocytes were washed to the bottom of a 50 ml centrifuge tube; the lymphocytes were centrifuged to the bottom using a low-temperature centrifuge, the centrifugal speed was 2000 rpm, and the centrifugation time was 5 min; the supernatant PBS was discarded, 10 ml of red blood cell lysis buffer was added, and the mixture was gently shaken for 1 min to completely lyse the red blood cells, and centrifuged again with the same centrifugation parameters as before; the red blood cell lysis buffer was discarded, and PBS was added to gently blow the cells at the bottom to resuspend them and wash the lymphocytes once, and the PBS was discarded after centrifugation; finally, 10 ml of 1640 culture medium containing 10% fetal bovine serum and 1% double antibody was added to resuspend the cells, and the cell concentration was adjusted to 1*10 after cell sampling and counting. 7 Pieces / ml.

[0111] Lymphocytes were plated on a 96-well plate at 100 μl / well, with 3 replicates per group. Antigen VLPs were added to cells in each group for restimulation, with a stimulation concentration of 10 μg / ml. The lymphocytes were cultured in a 37°C incubator for 24 hours, and the supernatant was collected and centrifuged at 2000 rpm for 5 minutes. Cell debris was discarded, and the supernatant was used for cytokine detection. According to the instructions for the cytokine ELISA kit of Shenzhen Dakoway, the steps are briefly described as follows:

[0112] a. Prepare the standard with the concentrations of 0, 7.8, 15.6, 31.3, 62.5, 125, 250 and 500 pg / ml using the sample diluent, add the sample and standard at 100 μl / well, then add 50 μl / well of biotin-labeled antibody, cover with sealing film, and incubate at 37°C for 90 min;

[0113] b. Wash the plate. Remove the liquid in the wells, add 300 μl / well of washing buffer, remove the washing buffer and dry on filter paper, repeat the washing 4 times;

[0114] c. Add enzyme. Add HRP-labeled streptavidin-HRP at 100 μl / well, cover with sealing film, and incubate at 37°C for 30 min;

[0115] d. Wash the plate. Repeat step 2 for 4 times;

[0116] e. Color development. Add 100 μl TMB color development solution to each well and develop at 37°C for 5-30 min. Add 100 μl / well of stop solution to terminate the reaction based on the color.

[0117] f. Read the plate. Immediately after the assay is terminated, use an ELISA reader to read the absorbance of each well at a wavelength of 450 nm, and calculate the cytokine concentration of each group based on the standard curve.

[0118] (3) Specific antibody IgG and antibody subtype detection method (humoral immunity level)

[0119] 21 days, 35 days, 56 days and 120 days after the mice were immunized, 100-200 μl of blood was collected from the jugular vein with a syringe, and the serum was separated after centrifugation at 5000 rpm for 15 min for the detection of antibody IgG and antibody subtype IgG1 and IgG2a. The antibody detection method is as follows:

[0120] a. Dilute the antigen VLP to 1 μg / ml with DPBS, add 100 μl / well to the ELISA plate, and coat overnight at 4°C;

[0121] b. Take out the coated ELISA plate and wash it three times with PBS solution containing 0.05% Tween-20, 300μl / well of washing solution; discard the washing solution, add PBS blocking solution containing 5% skimmed milk powder, 100μl / well, and seal the plate at 37℃ for 1.5h;

[0122] c. Discard the blocking solution, wash the plate 3 times, dilute the mouse serum at 1:10000 and add it to the ELISA plate, 100 μl / well, cover the plate with a sealing film, and incubate at 37°C for 2 hours;

[0123] d. Discard the serum diluent, wash the plate three times, pat dry on absorbent paper, add HRP-labeled IgG, IgG1 or IgG2a (1:10,000 dilution), cover with a sealer, and incubate at 37°C for 1 hour;

[0124] e. Discard the HRP-labeled secondary antibody, wash the plate 5 times, add TMB color developing solution, 100 μl / well, and develop color for 8 minutes;

[0125] f. Add 2M sulfuric acid stop solution and read the absorbance at 450nm after termination.

[0126] (4) Determination of blocking antibody titer in mouse serum

[0127] a. Coating: Dilute mucin (Yuanye Biotechnology, Product No. S12066) with PBS to a final concentration of 20 μg / ml of coating working solution, add 100 μl to each well of a 96-well plate, seal the plate, and place it in a refrigerator at 2-8°C for 16-22 hours.

[0128] b. Wash the plate. Discard the liquid in the wells, add 300μl of washing solution to each well, and wash 4 times. Add 200μl of blocking solution to each well, and incubate at 25℃ for 60±10min. After blocking, discard the liquid in the wells and wash the plate 4 times.

[0129] c. Serum dilution: Dilute the mouse serum to be tested with PBS, 2-fold dilution (the sample dilution factor can be adjusted according to actual conditions), and dilute into at least 4 gradients (serum reference dilution factors: 100, 200, 400, 800, 1600, 3200).

[0130] d. VLP dilution. Dilute VLP with PBS to a concentration of 0.3 μg / ml, mix 60 μl of diluted serum with an equal volume of the corresponding VLP dilution solution (reference dilution multiples of serum after mixing: 200, 400, 800, 1600, 3200, 6400), seal the plate with a sealing film, and incubate at 25°C for 90±10 min. Add 100 μl of each mixed and incubated sample to the sealed 96-well plate. Seal the plate with a sealing film and incubate at 25°C for 90±10 min.

[0131] e. Wash the plate. Remove the sealing film, discard the liquid in the wells, add 300 μl of washing solution to each well, and wash 4 times. Tap the plate on absorbent paper to thoroughly remove the residual liquid in the wells.

[0132] f. Rabbit polyclonal antibody incubation. Dilute the rabbit polyclonal antibody 1000 times with PBS, add 100 μl of the prepared rabbit polyclonal antibody working solution to the corresponding wells, seal the plate with a sealing film and incubate at 25°C for 60±5 minutes. Then wash the plate, discard the liquid in the wells, add 300 μl of washing solution to each well, and wash 4 times.

[0133] g. Preparation of HRP-labeled goat anti-rabbit IgG working solution. Dilute HRP-labeled goat anti-rabbit IgG 5000 times with PBS. Add 100 μl of the prepared IgG working solution to the corresponding well plate, seal the plate with a sealing film and incubate at 25°C for 60±5 minutes. Wash the plate 4 times after completion.

[0134] h. Color development: Add 100 μl of TMB color developer to each well and incubate for 5-20 minutes in the dark.

[0135] i. Stop color development. Add 50 μl of stop solution to each well to stop color development, and use a microplate reader to detect the absorbance at a wavelength of 450 nm. Use 1 / 2 of the negative control mean as the Y value for calculation, and the calculated value is the blocking titer BT50. The 50% blocking titer (BT50) is defined as the maximum serum dilution factor that can block 50% of the binding of VLPs to the receptor.

[0136] 2.4 Experimental results:

[0137] (1) If Figure 3 , Figure 4 As shown, 21 days after NoroVLP immunization, mouse spleen lymphocytes were isolated for in vitro culture and antigen restimulation, and it was found that the secretion of cytokines IL-2 and IFN-γ in the composite adjuvant group composed of CpGKHS6 and aluminum adjuvant was the highest, which was higher than that in the no adjuvant group and the aluminum adjuvant group alone, indicating that CpG adjuvant and aluminum adjuvant produced significant synergistic effects, and promoted the occurrence of Th1 type cellular immune response after antigen immunization; at the same time, compared with the composite adjuvant group composed of the foreign sequence CpG2006+aluminum adjuvant, the secretion of the two cytokines was significantly higher than that of the foreign sequence (P<0.05), indicating that the independently designed CpG sequence has a significant adjuvant effect in mice, which is superior to similar sequences in the field and produces unexpected immune stimulation effects.

[0138] (2) If Figure 5 As shown, the secretion level of specific antibody IgG in mouse serum was detected at different times after antigen VLP immunization, and it was found that the combination of CpGKHS6 and aluminum adjuvant had a significant synergistic effect, and the level of specific antibody stimulated by the body was significantly higher than that of the no adjuvant or aluminum adjuvant group, indicating that the independently designed CpG adjuvant has a significant effect on the humoral immune response of mice; Figure 6 The test results of specific antibody subtypes IgG1 and IgG2a found that the IgG2a expression level of the group with added CpG and aluminum adjuvant was significantly higher than that of the group with only added aluminum adjuvant, and the IgG1 / IgG2a ratio was lower, indicating that CpGKHS6, like CpG2006, successfully activated the Th1 type cellular immune response and produced a more balanced Th1 / Th2 immune response.

[0139] (3) Figure 7The results showed that the secretion levels of serum specific antibody subtypes decreased 120 days after mice were immunized with NoroVLP, but the IgG2a level in the CpG+aluminum adjuvant group was still significantly higher than that in the no adjuvant group or the aluminum adjuvant group alone, indicating that mice immunized with the composite adjuvant still retained a certain level of Th1 cell memory ability four months later.

[0140] (4) Figure 8 The results of mouse serum blocking antibody titer test showed that the adjuvant effect of the CpGKHS6+aluminum adjuvant combination was obvious, and the specific blocking antibody titer produced was significantly higher than that of the no adjuvant or aluminum adjuvant group; and was significantly higher than that of the CpG2006+aluminum adjuvant group, about twice that of the CpG2006+aluminum adjuvant group.

[0141] 2.5 Experimental conclusion:

[0142] In vivo immunization experiments on mice confirmed that the independently designed CpG adjuvant KHS6 has a good immune stimulation effect, and has a significant synergistic effect when combined with aluminum adjuvant. It can significantly improve the humoral response and cellular response levels of the recombinant Norovirus VLP vaccine, increase the expression levels of specific antibodies IgG and IgG2a, produce higher serum blocking antibody titers, and produce a more balanced Th1 / Th2 type cellular immune response, exerting an excellent adjuvant effect and having obvious clinical application value.

[0143] The above-mentioned embodiments only express the specific implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the protection scope of the present application. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the technical solution concept of the present application, and these all belong to the protection scope of the present application.

Claims

1. A CpG adjuvant, characterized in that Includes at least one of the following CpG sequences: KHS1: TCGGTCGTTCGGTCGTTCGTT; KHS2: TATGTCGTTACGTTGTCGTTGGGGG; KHS4: TTGTCGTTGTCGTTCGTTGGGGG; KHS5: TCGTTGTCGTTGTCGAACGTT; KHS6: TGTCGTTCGAACGTTCGACGTT.

2. A CpG adjuvant according to claim 1, characterized in that The CpG sequence was also modified with methoxy all-sulfo sites.

3. A composite adjuvant, characterized in that It comprises a CpG adjuvant and an aluminum adjuvant as described in any one of claims 1 to 2, wherein the CpG adjuvant is 5 to 100 micrograms per dose, and the aluminum adjuvant is 50 to 500 micrograms per dose.

4. A composite adjuvant according to claim 3, characterized in that, The aluminum adjuvant is: aluminum hydroxide adjuvant or aluminum phosphate adjuvant.

5. Use of a CpG adjuvant as claimed in any one of claims 1 to 2 or a composite adjuvant as claimed in claim 3 or 4 in the preparation of a vaccine.

6. A vaccine, characterized in that It comprises a composite adjuvant as claimed in claim 3 or 4, and also comprises an antigen in an amount of 0.5 to 40 micrograms per dose.

7. A vaccine according to claim 6, characterized in that The antigen is Norovirus-like particle VLP, and the subtypes include: GⅠ.1, GⅡ.2, GⅡ.3, GⅡ.4, GⅡ.6 or GⅡ.17.

Images