Application of BnaGSTU11 gene in regulation and control of sclerotinia rot resistance of brassica napus

Abstract

According to the application of the BnaGSTU11 gene in regulating and controlling the sclerotinia rot resistance of brassica napus, the amino acid sequence is as shown in SEQ ID NO: 2. According to the invention, a gene BnaGSTU11 for coding glutathione S-transferase is separated and cloned from brassica napus, and protease coded by the gene can enhance the sclerotinia rot resistance of the brassica napus by removing active oxygen and free radicals. The discovery of the sclerotiniose-resistant gene BnaGSTU11 provides a new genetic resource for cultivating a new sclerotiniose-resistant rape germplasm, and also provides a new thought for mining sclerotiniose-resistant genes of other crops.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and particularly relates to application of the BnaGSTU11 gene in regulating the resistance of Brassica napus to sclerotinia sclerotiorum. Background Art

[0002] Brassica napus L. is one of the most important oil crops in the world and belongs to the genus Brassica in the family Cruciferae. It is not only the main source of edible oil, but also plays a pivotal role in chemical industry and energy.

[0003] Sclerotinia sclerotiorum is a typical necrotrophic pathogen. Sclerotinia disease is caused by Sclerotinia sclerotiorum. It has no host specificity and infects more than 400 plant species including rapeseed, mainly herbaceous plants (Boland, GJRHall, Index of plant hosts of Sclerotinia sclerotiorum. Canadian Journal of Plant Pathology, 1994. 16(2): p.93-108.). Airborne ascospores are the key to the development of Sclerotinia sclerotiorum (Clarkson, JP, L. Fawcett, SG Anthony C. Young, A model for Sclerotinia sclerotiorum infection and disease development in lettuce, based on the effects of temperature, relative humidity and ascospore density. PLoS ONE, 2014. 9 (4): p. e94049.). The main attachment point of ascospores of Sclerotinia sclerotiorum is the petals of rapeseed, and the petals act as secondary media to mediate the invasion of Sclerotinia sclerotiorum into other tissues of rapeseed, causing cell damage by producing oxalic acid and cell wall degrading enzymes, and causing severe Sclerotinia sclerotiorum (Hegedus, DD SRRimmer, Sclerotinia sclerotiorum: when "to be or not to be" a pathogen? FEMS Microbiol Lett, 2005. 251 (2): p. 177-84.). Sclerotinia sclerotiorum is extremely destructive to rapeseed, seriously affecting the yield and quality of rapeseed.

[0004] During plant growth and development, plants need to constantly adapt to changes in the external environment. When changes in the external environment threaten plant growth, plants will initiate appropriate signal cascades, activate the body's defense response mechanism, and protect themselves from damage. The enhanced expression of GSTs can be considered a marker of stress response preparation (Moreira, DC, DP Paula M. Hermes-Lima, Changes in metabolism and antioxidant systems during tropical diapause in the sunflower caterpillar Chlosyne lacinia (Lepidoptera: Nymphalidae). Insect Biochemistry and Molecular Biology, 2021. 134.). Among them, the GSTU gene is specifically present in plants. Studies have shown that GSTU is widely involved in the response of plants to adversity. At the same time, GSTU also responds to plant stress and disease resistance in other plants. In wheat, TaGSTU6 can enhance wheat tolerance to powdery mildew (Wang, Q., J. Guo, P. Jin, M. Guo, J. Guo, P. Cheng, Q. Li B. Wang, Glutathione S-transferase interactions enhance wheat resistance to powdery mildew but not wheat stripe rust. Plant Physiology, 2022. 190 (2): p. 1418-1439.), in cassava (Manihot esculenta carantz), the transcription factor MeLSD3 can form a complex with nuclear factors YC15, YA2 / 4, and YB18, activate the expression of downstream MeGSTU37 and MeGSTU39, and enhance cassava's tolerance to oxidative stress (Zeng, H., H. Xu, H. Wang, H. Chen, G. Wang, Y. Bai, Y. Wei H. Shi, LSD3 mediates the oxidative stress response through fine-tuning APX2 activity and the NF-YC15-GSTs module in cassava.ThePlant Journal,2022.110(5):p.1447-1461.)

[0005] At present, there are no literature or patent reports on the function of BnaGSTU11 in Brassica napus to resist sclerotinia. Studies have found that after rapeseed was inoculated with Sclerotinia sclerotiorum, the expression level of BnaGSTU11 was significantly increased, and the resistance to sclerotinia of transgenic Brassica napus overexpressing BnaGSTU11 was significantly enhanced. Traditional breeding methods can effectively obtain rapeseed resistant to sclerotinia, but the cycle is long. Using transgenic technology to increase the expression of the endogenous gene BnaGSTU11 in Brassica napus, enhance the resistance to sclerotinia of Brassica napus and increase the yield, thereby obtaining new germplasm of rapeseed resistant to sclerotinia has a bright prospect. Summary of the invention

[0006] Technical problem to be solved: The present invention provides an application of the BnaGSTU11 gene in regulating the resistance of Brassica napus to sclerotinia sclerotinia. By overexpressing BnaGSTU11 in Brassica napus, the resistance of Brassica napus to sclerotinia sclerotinia can be improved, providing genetic resources for creating new germplasm of rapeseed that is resistant to sclerotinia sclerotinia.

[0007] Technical solution: A Brassica napus protein, the amino acid sequence of which is shown in SEQ ID NO: 2.

[0008] The nucleic acid molecule encoding the Brassica napus protein has a nucleic acid sequence as shown in SEQ ID NO: 1.

[0009] An expression vector containing the above nucleic acid sequence.

[0010] The above expression vector is a plasmid, a phage or a virus.

[0011] A host cell containing the above expression vector.

[0012] The host cell is Escherichia coli, yeast or plant cell.

[0013] Application of the above-mentioned Brassica napus protein in regulating the resistance of Brassica napus to Sclerotinia sclerotiorum.

[0014] A mutant of the gene sequence encoding the Brassica napus protein, wherein the protein encoded by the mutant gene has at least 80% sequence homology with the amino acid sequence shown in SEQ ID NO: 2 and retains the function of regulating Brassica napus sclerotinia.

[0015] A method for improving the resistance of Brassica napus to bacterial sclerotinia comprises transferring the above nucleic acid molecule into Brassica napus for over-expression.

[0016] The specific steps are as follows: (1) cloning the DNA fragment shown in SEQ ID NO:1 from Darmor, and connecting it to an expression vector to form a recombinant expression vector; (2) using the electroporation method to transform the plasmid carrying the recombinant expression vector into Agrobacterium GV3101; and transforming the Agrobacterium carrying the recombinant vector plasmid into Brassica napus by the Agrobacterium transformation method to obtain transgenic plants.

[0017] Beneficial effects: (1) The present invention isolates and clones a gene BnaGSTU11 encoding glutathione S-transferase from Brassica napus. The protease encoded by the gene can enhance the resistance of Brassica napus to sclerotinia by removing active oxygen and free radicals. The discovery of the sclerotinia resistance gene BnaGSTU11 provides a new genetic resource for cultivating new rapeseed germplasm resistant to sclerotinia, and also provides a new idea for the mining of sclerotinia resistance genes of other crops. (2) The recombinant overexpression vector containing the above gene coding sequence is transformed into Agrobacterium tumefaciens GV3101 by electroporation. (3) The Agrobacterium containing the recombinant overexpression vector containing the above gene coding sequence is transformed into Brassica napus by Agrobacterium infection to obtain a strain with overexpression of BnaGSTU11. Compared with the non-transgenic strain, overexpression of BnaGSTU11 can enhance the resistance of Brassica napus to sclerotinia, providing raw materials for the study of the disease resistance function of the BnaGSTU11 gene. (4) The present invention has fully proved that BnaGSTU11 is involved in the resistance to Sclerotinia sclerotinia of Brassica napus through a series of studies on the overexpression strain of BnaGSTU11, and clarified that BnaGSTU11 has important biological significance in the disease resistance process of Brassica napus. (5) The mining of Sclerotinia sclerotinia resistance genes of Brassica napus has always been the research focus of rapeseed researchers. The development and utilization of the resistance gene BnaGSTU11 will greatly promote the research on Sclerotinia sclerotinia resistance of Brassica napus, and also provide theoretical guidance for mining the Sclerotinia sclerotinia resistance genes of other crops and exploring the molecular mechanism of resistance to Sclerotinia sclerotinia. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the specific implementation scheme and technical solution of the present invention, the specific implementation scheme is briefly introduced below.

[0019] Sequence Listing SEQ ID NO: 1 is the gene coding sequence of BnaGSTU11 in rapeseed Darmor;

[0020] Sequence Listing SEQ ID NO: 2 is the amino acid sequence of BnaGSTU11 cloned from Brassica napus Darmor;

[0021] Figure 1The expression level of BnaGSTU11 (BnaCnng49200D) changed at 0h, 3h, 6h, 9h, and 12h after inoculation of Sclerotinia sclerotiorum;

[0022] Figure 2 Schematic diagram of the construction of BnaGSTU11 overexpression vector;

[0023] Figure 3 Schematic diagram of Agrobacterium-mediated genetic transformation of Brassica napus hypocotyls;

[0024] Figure 4 The expression of BnaGSTU11 in BnaGSTU11 overexpressing plants. In the figure, J9712 is the wild-type control, and the others are BnaGSTU11 transgenic overexpressing lines;

[0025] Figure 5 T 1 Figure 1. The true leaf inoculation of transgenic overexpressing Brassica napus strains. Phenotypic identification of Sclerotinia sclerotiorum resistance in BnaGSTU11 overexpressing transgenic Brassica napus. In the figure, J9712 is a wild-type control, and the others are BnaGSTU11 overexpressing transgenic strains.

[0026] Figure 6 T 1 Statistics of the area of ​​fungal lesions on the true leaves of transgenic overexpression lines of Brassica napus. Specific implementation plan

[0027] In order to enable those skilled in the art to better understand the technical solution of the present invention, the specific implementation scheme of the present invention is now described in detail. This detailed description should not be understood as a limitation of the present invention, but should be understood as a clearer, complete and detailed explanation of the technical level of the present invention. Without violating the scope and spirit of the present invention, those skilled in the art may make improvements to the specific implementation scheme of the present invention for multiple applications. All other embodiments obtained by those skilled in the art without making creative work are within the scope of protection of the present invention.

[0028] Example 1: qRT-PCR analysis of the expression of BnaGSTU11 before and after inoculation with Sclerotinia sclerotiorum

[0029] (1) Inoculation of leaves of Brassica napus J9712

[0030] Leaves of Brassica napus J9712 in the four-leaf, one-heart growth period were taken for inoculation with Sclerotinia sclerotiorum. Before the treatment, the plants were taken care of normally to avoid other stresses. Samples were collected 0h, 3h, 6h, 9h, and 12h after inoculation.

[0031] (2) Extraction of total RNA from Brassica napus

[0032] The total RNA of the leaves was extracted using RNA isolater Total RNA Extraction Reagent (provided by Nanjing Novozyme Biotechnology Co., Ltd.) after 0h, 3h, 6h, 9h, and 12h of treatment with Sclerotinia sclerotiorum in step (1).

[0033] (3) Real-time quantitative PCR

[0034] The reverse transcription reagent used was HiScript IIQ Select RT Super Mix for qPCR (+gDNA wiper) kit (provided by Nanjing Novozyme Biotechnology Co., Ltd.), and the fluorescence quantitative reagent used was 2×Q3 SYBR qPCR Mastermix (Universal) (provided by Yangzhou Qingke Biotechnology Co., Ltd.). The rapeseed housekeeping genes BnaActin7 and BnaUBC9 were used as internal references:

[0035] BnaActin7-F:AAGTACTCTTCCAGCCGTCGC;

[0036] BnaActin7-R:ATCTGTTGGAAAGTGCTGAGGG;

[0037] BnaUBQ9-F:TCCATCCGACAGCCCTTACTCT;

[0038] BnaUBQ9-R:ACACTTTGGTCCTAAAAGCCACC;

[0039] The BnaGSTU11 primer sequence is:

[0040] GSTU11-qPCR-F:CCATCCTTCCCTCAGACCCA;

[0041] GSTU11-qPCR-R:CTTTTGCTACCGCCACTCCA;

[0042] This pair of primers is a fluorescent quantitative PCR specific primer designed for the coding sequence of BnaGSTU11. The fluorescent quantitative reaction system is 10 μL: containing 5 μL of SYBR Mix, 0.2 μL of each forward and reverse primer (10 μmol / L), ddH 2 O 2.6μL and template cDNA 2μL. Amplification conditions were 95℃30sec, cycle reaction: 95℃10sec, 60℃30sec, a total of 40 cycles. Melting curve: The instrument default melting curve acquisition program was used. Each sample was repeated at least three times. After the reaction was completed, the dynamic expression changes of BnaGSTU11 before and after inoculation with Sclerotinia sclerotiorum were calculated. Figure 1 shown.

[0043] Example 2: Isolation and cloning of the BnaGSTU11 coding sequence

[0044] (1) RNA extraction and cDNA synthesis

[0045] Darmor of Brassica napus was used as the experimental material, and the growth conditions were 22±2℃, 70% humidity, and a photoperiod of 16h light and 8h dark. The total RNA of rapeseed leaves was extracted according to the instructions of RNA isolater Total RNA Extraction Reagent (provided by Nanjing Novozyme Biotechnology Co., Ltd.). The cDNA was synthesized using the HiScriptⅢ1st Strand cDNA Synthesis Kit (+gDNA wiper) (provided by Nanjing Novozyme Biotechnology Co., Ltd.). The rapeseed genome database BnTIR ( http: / / yanglab.hzau.edu.cn / BnTIR / ) Search the BnaGSTU11 coding sequence and design primers:

[0046] GSTU11-1-F:AACCAGCCAAAAGTGTAATGGG;

[0047] GSTU11-1-R:GTCCGTGCCTTTAAATTAGCCG;

[0048] The cDNA of Brassica napus Darmor was used as a template and PCR amplification was performed using a high-fidelity enzyme. The PCR amplification conditions were: 95°C for 3 min, 95°C for 15 sec, 58°C for 15 sec, 72°C for 1 min, for a total of 35 cycles, 72°C for 5 min, and 25°C for 5 min. After the PCR reaction was completed, the reaction product was subjected to 1% agarose gel electrophoresis and the agarose gel with a single band was recovered.

[0049] (2) Connection

[0050] The recovery of the target fragment was performed by referring to the gel recovery kit provided by Yangzhou Wanhe Biotechnology Co., Ltd. The connection system between the target fragment and the TA cloning vector of the 5min TA / Blunt-Zero Cloning Kit (provided by Nanjing Novozyme Biotechnology Co., Ltd.) was: 4.5μL target fragment. 0.5μL TA cloning vector was connected at 25°C for 30min. The connection product was transformed into DH5α Escherichia coli competent cells by heat shock method, and the bacterial solution was spread on LB solid medium containing 1000mg / L kana antibiotic after centrifugation. After culturing in a 37°C incubator for 12-16h, a single clone was picked for bacterial solution PCR, and the positive clone bacterial solution was sent to Yangzhou Qingke Biotechnology Co., Ltd. for sequencing, and the correctly sequenced bacterial solution was named BnaGSTU11-CDS.

[0051] Example 3: Obtaining transgenic plants overexpressing BnaGSTU11

[0052] (1) Construction of BnaGSTU11 overexpression vector

[0053] Restriction sites (SpeI and AscI) and homology arms were added to both ends of the cloning amplification primer, and the primer was named: GSTU11-PMDC83-F: AGGACCTCGACTCTAGAACTAGTATGGGTCTAATCAGTGAAG;

[0054] GSTU11-PMDC83-R:GGCCCCCCCTCGAGGCGCGCCTCATTTAAAGATTGAAG.

[0055] The CDS sequence of BnaGSTU11 containing restriction sites and homology arms was obtained by PCR amplification. The pMDC83 empty vector was double-digested, and the two were cut and recovered using a gel recovery kit (provided by Yangzhou Wanhe Biotechnology Co., Ltd.). The pMDC83 empty vector recovered from the gel and the cDNA fragment of BnaGSTU11 containing restriction sites and homology arms were connected using the Clone Express II One Step Cloning Kit (provided by Nanjing Novozyme Biotechnology Co., Ltd.), transformed into Escherichia coli, and plated, cultured in a 37°C incubator for 12-16 hours, and a single clone was picked for bacterial liquid PCR. The obtained positive clone was sent to Yangzhou Qingke Biotechnology Co., Ltd. for sequencing, and the bacterial liquid with successful sequencing was named pMDC83-BnaGSTU11.

[0056] (2) Genetic transformation of rapeseed

[0057] The genetic transformation method of Brassica napus was slightly improved on the basis of the transformation method of the State Key Laboratory of Crop Genetic Improvement of Huazhong Agricultural University. Through the hypocotyl infection method, the plasmid containing the recombinant vector pMDC83-BnaGSTU11 was transformed into Agrobacterium GV3101, and the hypocotyl of Brassica napus J9712 was used as the recipient for Agrobacterium infection. Transgenic plants were obtained through screening and differentiation. The specific steps are as follows:

[0058] (a) The plasmid containing the recombinant vector pMDC83-BnaGSTU11 was transferred into Agrobacterium tumefaciens GV3101 by electroporation. The specific steps are as follows: take 100 μL of Agrobacterium competent cells, add 1.5-2.5 μL of recombinant plasmid, mix the two and add them to the electroporation cup, cap the electroporation cup and put it into the electroporation instrument for electroporation, immediately add 500 μL of non-resistant LB liquid culture medium to culture Agrobacterium after electroporation, blow and wash evenly, and draw 30-50 μL of the mixed bacterial solution and apply it on the LB solid culture medium containing kana and Rif antibiotics. The culture medium was placed in an incubator at 28°C for 36-48 hours, and a single clone was picked for bacterial solution PCR identification. 50% glycerol was added to the positive bacterial solution at a ratio of 1:1 to preserve the bacteria, and stored at -80°C for subsequent genetic transformation.

[0059] (b) Seed sterilization

[0060] Soak the seeds of Brassica napus J9712 in 75% alcohol for 1 min; sterilize the seeds with 2% NaClO for 15 min; sterilize with ddH 2 O Rinse the seeds 4-5 times.

[0061] (c) Seeding

[0062] Use sterilized forceps to spread the sterilized seeds on the M 0 Culture in medium at 24°C in the dark for 4-5 days.

[0063] (d) Activation of Agrobacterium

[0064] Incubate in a shaker at 250 rpm at 28°C for 20-24 hours until the Agrobacterium containing the recombinant vector reaches OD 600 Reached 0.8.

[0065] (e) Explant acquisition and Agrobacterium infection

[0066] Use sterile forceps and a scalpel that have been sterilized by burning to cut the hypocotyls of seedlings that have been sown for 4-5 days. The length of each cut segment is 1.0-1.5 cm. Take 2 mL of bacterial solution, centrifuge at 6000 rpm for 5 minutes, add 2 mL of DM solution to resuspend the precipitate, repeat the centrifugation once, and finally add 2 mL of DM to resuspend the precipitate and pour it into a large dish containing 18 mL of DM (i.e., diluted 10 times), then add 20 μL (i.e., a ratio of 1:1000) of AS hormone and shake well to prepare the infection solution. The infection time is usually 10-15 minutes. After the infection is completed, use forceps to place the explant in a dish covered with 2 layers of filter paper and let it dry for 10 minutes. After drying, place it on the M 1 Incubate on medium and incubate in darkness for 36-48h.

[0067] (f) Differentiation and rooting of explants

[0068] M 1 After 36-48 h of culture on the medium, the explants were transferred to M 2 The cells were cultured on the culture medium for 20 days and then the positive long photoperiod treatment was resumed. 2 The explants of callus expansion were transferred to M 3 Repeat 2-3 times on medium 3 Iterate until green shoots grow on the explants. 3 After the explants with green shoots were found to have obvious growth points, the seedlings were carefully cut off with a scalpel and the regenerated seedlings were transferred to M 4 Rooting treatment is carried out on the culture medium. After 2-4 weeks, the formed tissue culture seedlings can be transferred to the soil for soil culture. Figure 3 .

[0069] Formula of each culture medium (taking 1L culture medium as an example):

[0070]

[0071] Example 4: Positive identification of transgenic plants overexpressing BnaGSTU11

[0072] (1) Extraction of DNA from transgenic plants

[0073] After the transgenic plants were transferred to soil culture for one week, they could be positively identified. The conventional method of rapid plant DNA extraction was used, and the specific steps were as follows:

[0074] (a) Take 2-3 g of rapeseed leaf tissue and place it in a 2.0 EP tube, then add cooled and sterilized steel beads and 500 μL of buffer (taking 1 L of culture medium as an example: 60.5 g Tris-base + appropriate amount of pure water, adjust the pH to 7.5 with concentrated hydrochloric acid, then add 17.5 g NaCl and 102.69 g sucrose);

[0075] (b) Grind the sample in a sampler for 210 seconds;

[0076] (c) The ground sample was placed in a boiling water bath for 10 min and then centrifuged at 12000 rpm for 5 min;

[0077] (d) 50 μL of the sample supernatant was taken as the DNA stock solution, and the stock solution was diluted to 100 ng / μL as the DNA template concentration.

[0078] (2) Detection of positive transgenic plants

[0079] Take 1 μL of diluted DNA as a template and use PCR amplification to identify the plants positively. The primers used are:

[0080] GSTU11-pMDC83-F:AGGACCTCGACTCTAGAACTAGTATGGGTCTAATCAGTGAAG;

[0081] pMDC83-GFP-R:CATCACCTTCACCCTCTCCAC.

[0082] The negative control was non-transgenic wild-type rapeseed DNA, and the positive control was a plasmid containing a recombinant vector. After PCR amplification, the product was subjected to agarose gel electrophoresis, and whether specific target bands appeared in the electrophoresis results was used to determine whether pMDC83-BnaGSTU11 was successfully introduced into the rapeseed genome.

[0083] Example 5: Overexpression of BnaGSTU11 reduces the area of ​​sclerotinia lesions in transgenic Brassica napus

[0084] qPCR Identification of Transgenic Rapeseed Overexpressing BnaGSTU11

[0085] In order to identify whether BnaGSTU11 is overexpressed in rapeseed, the qPCR method was used to analyze the positive plants identified in Example 3 after propagation. 1 The analysis was performed on 100 strains of rapeseed J9712, and the control group was wild-type rapeseed J9712. The primer sequences used were:

[0086] GSTU11-qPCR-F: CCATCCTTCCCTCAGACCCA;

[0087] GSTU11-qPCR-R:CTTTTGCTACCGCCACTCCA.

[0088] qPCR results showed that the expression levels of BnaGSTU11 overexpression lines were higher than those of the wild-type control group. Figure 4 . Take T 1 The leaves of each strain of BnaGSTU11-overexpressing transgenic rapeseed were inoculated in vitro to identify the phenotype of Sclerotinia sclerotiorum resistance, and the control group was wild-type rapeseed J9712. The experimental results showed that the lesion area of ​​the BnaGSTU11-overexpressing strain was significantly smaller than that of the control group J9712. Overexpression of BnaGSTU11 can enhance the resistance of Brassica napus to Sclerotinia sclerotiorum. Figure 5 and Figure 6 .

[0089] It can be seen that BnaGSTU11 can effectively improve the resistance of Brassica napus to Sclerotinia sclerotiorum, and has a profound impact on improving the yield and quality of Brassica napus. It also provides theoretical guidance for the exploration of Sclerotinia sclerotiorum resistance genes in other crops.

[0090] The above embodiments are descriptions of preferred embodiments of the present invention, and are not intended to limit the present invention. Without departing from the spirit or scope of the present invention, technical improvements and equivalent substitutions made by relevant technical personnel to the present invention are within the protection scope of the present invention.

Claims

1. A Brassica napus protein, characterized in that The amino acid sequence is shown in SEQ ID NO:

2.

2. The nucleic acid molecule encoding the Brassica napus protein according to claim 1, characterized in that: Its nucleic acid sequence is shown in SEQ ID NO:

1.

3. An expression vector containing the nucleic acid sequence of claim 2.

4. The expression vector according to claim 2, characterized in that The expression vector is a plasmid, a phage or a virus.

5. A host cell containing the expression vector according to claim 4.

6. The host cell according to claim 5, characterized in that The host cell is Escherichia coli, yeast or plant cell.

7. Use of the Brassica napus protein according to claim 1 in regulating resistance to sclerotinia sclerotiorum of Brassica napus.

8. A mutant of the gene sequence encoding the Brassica napus protein according to claim 1, characterized in that: The protein encoded by the mutant gene has at least 80% sequence homology with the amino acid sequence shown in SEQ ID NO: 2, and retains the function of regulating Brassica napus sclerotinia disease.

9. A method for improving the resistance of Brassica napus to bacterial sclerotinia, characterized in that: The method comprises transferring the nucleic acid molecule of claim 2 into Brassica napus for over-expression.

10. The method according to claim 8, characterized in that The steps are as follows: (1) cloning the DNA fragment shown in SEQ ID NO: 1 from Darmor, and connecting it to an expression vector to form a recombinant expression vector; (2) using the electroporation method to transform the plasmid carrying the recombinant expression vector into Agrobacterium GV3101; and transforming the Agrobacterium carrying the recombinant vector plasmid into Brassica napus by the Agrobacterium transformation method to obtain transgenic plants.

Images