Application of BnaGSTU11 gene in regulating resistance to sclerotinia sclerotiorum in brassica napus

By overexpressing the BnaGSTU11 gene in Brassica napus and using Agrobacterium-mediated genetic transformation, the resistance of Brassica napus to Sclerotinia sclerotiorum disease was solved, enhancing the resistance of rapeseed, shortening the breeding cycle, and improving the yield and quality of rapeseed. This provides theoretical support for the discovery of resistance genes in other crops.

CN119192311BActive Publication Date: 2025-11-18YANGZHOU UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411378945.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-30
Publication Date
2025-11-18
Estimated Expiration
2044-09-30

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve the resistance of Brassica napus to Sclerotinia stem rot. Traditional breeding techniques have long breeding cycles.

Method used

By overexpressing the BnaGSTU11 gene in Brassica napus, we can improve the resistance of Brassica napus to sclerotinia rot using transgenic technology. The BnaGSTU11 gene was introduced into Brassica napus using Agrobacterium-mediated genetic transformation, and a recombinant expression vector was constructed and overexpressed.

Benefits of technology

It significantly enhanced the resistance of Brassica napus to Sclerotinia stem rot, provided new genetic resources, shortened the breeding cycle, improved the yield and quality of rapeseed, and provided theoretical guidance for the discovery of Sclerotinia stem rot resistance genes in other crops.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119192311B_ABST
    Figure CN119192311B_ABST
Patent Text Reader

Abstract

The application of BnaGSTU11 gene in regulating resistance to sclerotinia sclerotiorum of brassica napus, and the amino acid sequence is shown as SEQ ID NO: 2. A gene encoding glutathione sulfur transferase is cloned from brassica napus in the application BnaGSTU11 The proteinase encoded by the gene can enhance the resistance to sclerotinia sclerotiorum of brassica napus by removing active oxygen and free radicals. BnaGSTU11 The discovery of the antibacterial sclerotinia gene provides new genetic resources for breeding new germplasm of oilseed rape resistant to sclerotinia sclerotiorum, and provides a new idea for mining of sclerotinia resistance genes of other crops.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically involving the application of the BnaGSTU11 gene in regulating resistance to sclerotinia stem rot in Brassica napus. Background Technology

[0002] Rapeseed (Brassica napus L.) is one of the world's most important oilseed crops, belonging to the genus Brassica in the family Brassicaceae. It is not only a major source of edible oil but also plays a crucial role in the chemical and energy sectors.

[0003] Sclerotinia sclerotiorum is a typical necrotrophic pathogen. Sclerotinia sclerotiorum disease is caused by Sclerotinia sclerotiorum. It has no specific host and infects more than 400 kinds of plants, including rapeseed, and mainly herbaceous plants (Boland, G.J.R.Hall, Index of plant hosts of Sclerotinia sclerotiorum. Canadian Journal of Plant Pathology, 1994.16(2):p.93-108.). Airborne ascospores are key to the development of sclerotinia sclerotiorum (Clarkson, JP, L. Fawcett, SGAnthony C. Young, A model for Sclerotinia sclerotiorum infection and disease development in lettuce, based on the effects of temperature, relative humidity and ascospore density. PLoS ONE, 2014.9(4):p.e94049.). The ascospores of Sclerotinia sclerotiorum mainly attach to rapeseed petals, and the petals act as a secondary medium to mediate the invasion of Sclerotinia sclerotiorum into other tissues of rapeseed. By producing oxalic acid and cell wall degrading enzymes, Sclerotinia sclerotiorum causes cell damage and leads to severe sclerotiorum sclerotiorum disease (Hegedus, DDSRRimmer, Sclerotinia sclerotiorum: when "to be or not to be" a pathogen? FEMS Microbiol Lett, 2005.251(2):p.177-84.). Sclerotiorum sclerotiorum is extremely destructive to rapeseed, seriously affecting the yield and quality of rapeseed.

[0004] During plant growth and development, plants need to constantly adapt to changes in the external environment. When changes in the external environment threaten plant growth, plants initiate appropriate signaling cascades and activate their internal defense mechanisms to protect themselves from damage. Enhanced expression of GSTs can be considered a marker of stress response readiness (Moreira, DC, DP, Paula M. Hermes-Lima, Changes in metabolism and antioxidant systems during tropical diapause in the sunflower caterpillar Chlosyne lacinia (Lepidoptera: Nymphalidae). Insect Biochemistry and Molecular Biology, 2021, 134.). Among them, the GSTU gene is specifically present in plants. Studies have shown that GSTU is widely involved in plant responses to stress. Simultaneously, GSTU also responds to plant stress and disease resistance responses in other plants. In wheat, TaGSTU6 enhances wheat's tolerance to powdery mildew (Wang, Q., J. Guo, P. Jin, M. Guo, J. Guo, P. Cheng, Q. Li B. Wang, Glutathione S-transferase interactions enhance wheat resistance to powdery mildew but not wheat striperust. Plant Physiology, 2022, 190(2): p. 1418-1439.). In cassava (Manihot esculentacrantz), the transcription factor MeLSD3 can form a complex with nuclear factors YC15, YA2 / 4, and YB18, activating the expression of downstream MeGSTU37 and MeGSTU39, thus enhancing cassava's tolerance to oxidative stress (Zeng, H., H. Xu, H. Wang, H. Chen, G. Wang, Y. Bai, Y. Wei, H. Shi, LSD3 mediates the oxidative stress response through fine-tuning). APX2 activity and the NF-YC15-GSTs module in cassava.ThePlant Journal,2022.110(5):p.1447-1461.)

[0005] Currently, there are no literature or patent reports on the function of BnaGSTU11 in resisting Sclerotinia stem rot in Brassica napus. Studies have found that inoculation of Brassica napus with Sclerotinia stem rot significantly increases the expression level of BnaGSTU11, and transgenic Brassica napus overexpressing BnaGSTU11 exhibits significantly enhanced resistance to Sclerotinia stem rot. Traditional breeding methods can effectively obtain Sclerotinia stem rot-resistant rapeseed, but the process is lengthy. Utilizing transgenic technology to increase the expression of the endogenous gene BnaGSTU11 in Brassica napus, thereby enhancing resistance to Sclerotinia stem rot and increasing yield, shows great promise for obtaining new Sclerotinia stem rot-resistant rapeseed germplasm. Summary of the Invention

[0006] Technical problem solved: This invention provides the application of the BnaGSTU11 gene in regulating the resistance of Brassica napus to Sclerotinia stem rot. By overexpressing BnaGSTU11 in Brassica napus, the resistance of Brassica napus to Sclerotinia stem rot can be improved, providing genetic resources for creating new germplasm of rapeseed resistant to Sclerotinia stem rot.

[0007] Technical solution: A rapeseed protein of the Brassica napus type, the amino acid sequence of which is shown in SEQ ID NO:2.

[0008] The nucleic acid molecule encoding the Brassica napus protein has the nucleic acid sequence shown in SEQ ID NO:1.

[0009] Expression vectors containing the above nucleic acid sequences.

[0010] The expression vectors mentioned above are plasmids, bacteriophages, or viruses.

[0011] Host cells containing the above expression vectors.

[0012] The host cells mentioned above are Escherichia coli, yeast, or plant cells.

[0013] The application of the above-mentioned rapeseed protein in regulating the resistance of rapeseed to sclerotinia stem rot.

[0014] A mutant gene sequence encoding the protein of Brassica napus, wherein the mutant gene encodes a protein having at least 80% sequence homology with the amino acid sequence shown in SEQ ID NO:2 and retaining the function of regulating Sclerotinia sclerotinia disease in Brassica napus.

[0015] A method for improving the resistance of Brassica napus to sclerotinia stem rot includes overexpressing the aforementioned nucleic acid molecules in Brassica napus.

[0016] The specific steps are as follows: (1) Clone the DNA fragment shown in SEQ ID NO:1 from Darmor and link it to the expression vector to form a recombinant expression vector; (2) Transform Agrobacterium GV3101 with the plasmid carrying the recombinant expression vector using the electroporation method; transform the Agrobacterium carrying the recombinant vector plasmid into rapeseed using the Agrobacterium transformation method to obtain transgenic plants.

[0017] Beneficial effects: (1) This invention isolates and clones a gene encoding glutathione S-transferase, BnaGSTU11, from Brassica napus. The protease encoded by the above gene can enhance the resistance of Brassica napus to sclerotinia stem rot by scavenging reactive oxygen species and free radicals. The discovery of the sclerotinia stem rot resistance gene BnaGSTU11 provides new genetic resources for cultivating new Brassica napus germplasm resistant to sclerotinia stem rot, and also provides new ideas for the discovery of sclerotinia stem rot resistance genes in other crops. (2) The recombinant overexpression vector containing the above gene encoding sequence is transformed into Agrobacterium tumefaciens GV3101 by electroporation. (3) Agrobacterium tumefaciens containing the recombinant overexpression vector containing the above gene encoding sequence is transformed into Brassica napus by Agrobacterium tumefaciens infection method to obtain strains overexpressing BnaGSTU11. Compared with non-transgenic strains, overexpression of BnaGSTU11 can enhance the resistance of Brassica napus to sclerotinia stem rot, providing raw materials for the study of the disease resistance function of the BnaGSTU11 gene. (4) Through a series of studies on the resistance to Sclerotinia stem rot in BnaGSTU11 overexpression lines, this invention fully demonstrates that BnaGSTU11 participates in the resistance of Brassica napus to Sclerotinia stem rot, and clarifies that BnaGSTU11 has important biological significance in the disease resistance process of Brassica napus. (5) The discovery of Sclerotinia stem rot resistance genes in Brassica napus has always been a research focus for rapeseed researchers. The development and utilization of the resistance gene BnaGSTU11 will greatly advance the research on Sclerotinia stem rot resistance in Brassica napus, and also provide theoretical guidance for the discovery of Sclerotinia stem rot resistance genes in other crops and the exploration of the molecular mechanism of Sclerotinia stem rot resistance. Attached Figure Description

[0018] To more clearly illustrate the specific implementation schemes and technical solutions of this invention, a brief introduction to the specific implementation schemes is given below.

[0019] The sequence listing SEQ ID NO:1 is the gene coding sequence of BnaGSTU11 in rapeseed Darmor;

[0020] Sequence listing SEQ ID NO:2 is the BnaGSTU11 amino acid sequence cloned from rapeseed Darmor;

[0021] Figure 1Changes in the expression level of BnaGSTU11 (BnaCnng49200D) after 0h, 3h, 6h, 9h and 12h of Sclerotium sclerotiorum inoculation;

[0022] Figure 2 Schematic diagram of the construction of the BnaGSTU11 overexpression vector;

[0023] Figure 3 A schematic diagram of Agrobacterium-mediated genetic transformation of hypocotyls in Brassica napus;

[0024] Figure 4 The expression of BnaGSTU11 in BnaGSTU11 overexpression plants. In the figure, J9712 is the wild-type control, and the others are BnaGSTU11 transgenic overexpression lines.

[0025] Figure 5 True leaf inoculation diagram of T1 generation Brassica napus transgenic overexpression lines. Identification of Sclerotinia sclerotiorum resistance phenotype in BnaGSTU11 overexpression transgenic Brassica napus. In the figure, J9712 is the wild-type control, and the others are BnaGSTU11 overexpression transgenic lines.

[0026] Figure 6 Statistics on the area of ​​true leaf lesions in T1 generation transgenic rapeseed overexpression lines. Detailed Implementation Plan

[0027] To enable those skilled in the art to better understand the technical solutions of the present invention, specific embodiments of the present invention are now described in detail. This detailed description should not be construed as a limitation of the present invention, but rather as a clearer, more complete, and more detailed exposition of the technical aspects of the present invention. Without departing from the scope and spirit of the present invention, those skilled in the art can make improvements to the specific embodiments of the present invention for multiple applications. All other embodiments obtained by those skilled in the art without inventive effort are within the protection scope of the present invention.

[0028] Example 1: qRT-PCR analysis of BnaGSTU11 expression before and after inoculation with Sclerotium sclerotiorum.

[0029] (1) Leaf inoculation treatment of Brassica napus J9712

[0030] Leaves of the four-leaf-one-heart stage of Brassica napus J9712 were inoculated with Sclerotinia sclerotiorum. Before treatment, the plants were cared for normally to avoid other stresses. Samples were taken at 0h, 3h, 6h, 9h, and 12h after inoculation.

[0031] (2) Extraction of total RNA from Brassica napus

[0032] Total RNA was extracted from leaves after 0h, 3h, 6h, 9h, and 12h of treatment with Sclerotium sclerotiorum in step (1) using the RNA isolater Total RNA Extraction Reagent (provided by Nanjing Novizan Biotechnology Co., Ltd.).

[0033] (3) Real-time quantitative PCR

[0034] Reverse transcription reagents were obtained using the HiScript IIQ Select RT Super Mix for qPCR (+gDNA wiper) kit (provided by Nanjing Novizan Biotechnology Co., Ltd.), and quantitative PCR reagents were obtained using the 2×Q3 SYBR qPCR Mastermix (Universal) (provided by Yangzhou Qingke Biotechnology Co., Ltd.). The rapeseed housekeeping genes BnaActin7 and BnaUBC9 were used as internal controls.

[0035] BnaActin7-F:AAGTACTCTTCCAGCCGTCGC;

[0036] BnaActin7-R:ATCTGTTGGAAAGTGCTGAGGG;

[0037] BnaUBQ9-F:TCCATCCGACAGCCCTTACTCT;

[0038] BnaUBQ9-R:ACACTTTGGTCCTAAAAGCCACC;

[0039] The primer sequence for BnaGSTU11 is:

[0040] GSTU11-qPCR-F:CCATCCTTCCCTCAGACCCA;

[0041] GSTU11-qPCR-R:CTTTTGCTACCGCCACTCCA;

[0042] This primer pair is a specific primer for quantitative real-time PCR designed targeting the coding sequence of BnaGSTU11. The quantitative real-time reaction system was 10 μL, containing 5 μL SYBR Mix, 0.2 μL each of forward and reverse primers (10 μmol / L), 2.6 μL ddH2O, and 2 μL template cDNA. Amplification conditions were 95℃ for 30 sec, followed by cycling at 95℃ for 10 sec and 60℃ for 30 sec, for a total of 40 cycles. Melting curves were obtained using the instrument's default melting curve acquisition program. At least three technical replicates were performed for each sample. After the reaction, the dynamic expression changes of BnaGSTU11 before and after inoculation with *Sclerotinia sclerotiorum* were calculated. Figure 1As shown.

[0043] Example 2: Isolation and Cloning of the BnaGSTU11 Coding Sequence

[0044] (1) RNA extraction and cDNA synthesis

[0045] Darmorium argenteum from Brassica napus was used as the experimental material. The growth conditions were 22±2℃, 70% humidity, and a photoperiod of 16 h light followed by 8 h darkness. Total RNA was extracted from rapeseed leaves according to the instructions of the RNA isolater Total RNA Extraction Reagent (provided by Nanjing Novizan Biotechnology Co., Ltd.). cDNA synthesis was performed using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (provided by Nanjing Novizan Biotechnology Co., Ltd.). The rapeseed genome database BnTIR (… (http: / / yanglab.hzau.edu.cn / BnTIR / ) To search the BnaGSTU11 coding sequence, primers were designed as follows:

[0046] GSTU11-1-F:AACCAGCCAAAAGTGTAATGGG;

[0047] GSTU11-1-R:GTCCGTGCCTTTAAATTAGCCG;

[0048] Using cDNA from *Darmor* (Brassica napus) as a template, PCR amplification was performed using a high-fidelity enzyme. The PCR amplification conditions were: 95℃ for 3 min, 95℃ for 15 sec, 58℃ for 15 sec, 72℃ for 1 min, for a total of 35 cycles, followed by 72℃ for 5 min and 25℃ for 5 min. After the PCR reaction, the reaction products were subjected to 1% agarose gel electrophoresis, and the agarose gels with a single band were recovered.

[0049] (2) Connection

[0050] The recovery of the target fragment was performed according to the gel recovery kit provided by Yangzhou Wanhe Biotechnology Co., Ltd. The ligation system between the target fragment and the TA cloning vector (provided by Nanjing Novizan Biotechnology Co., Ltd.) in the 5-min TA / Blunt-Zero Cloning Kit was as follows: 4.5 μL of target fragment + 0.5 μL of TA cloning vector ligated at 25℃ for 30 min. The ligation product was transformed into DH5α competent E. coli cells using a heat shock method. After centrifugation, the bacterial culture was plated on LB solid medium containing 1000 mg / L kana antibiotic and incubated at 37℃ for 12-16 h. Single clones were then picked for PCR. Positive clones were sent to Yangzhou Qingke Biotechnology Co., Ltd. for sequencing, and the correctly sequenced bacterial cultures were named BnaGSTU11-CDS.

[0051] Example 3: Obtaining transgenic plants overexpressing BnaGSTU11

[0052] (1) Construction of BnaGSTU11 overexpression vector

[0053] Add restriction enzyme sites (SpeI and AscI) and homologous arms to both ends of the cloning amplification primer, and name the primer: GSTU11-PMDC83-F:AGGACCTCGACTCTAGAACTAGTATGGGTCTAATCAGTGAAG;

[0054] GSTU11-PMDC83-R:GGCCCCCCCTCGAGGCGCGCCTCATTTAAAGATTGAAG.

[0055] The CDS sequence of BnaGSTU11 containing restriction enzyme sites and homologous arms was obtained by PCR amplification. The empty pMDC83 vector was double-digested, and both were recovered using a gel extraction kit (provided by Yangzhou Wanhe Biotechnology Co., Ltd.). The recovered pMDC83 empty vector and the BnaGSTU11 cDNA fragment containing restriction enzyme sites and homologous arms were ligated using the Clone Express II One Step Cloning Kit (provided by Nanjing Novizan Biotechnology Co., Ltd.). After transformation into E. coli, the fragments were plated and incubated at 37℃ for 12-16 h. Single clones were picked for colony PCR. The obtained positive clones were sent to Yangzhou Qingke Biotechnology Co., Ltd. for sequencing. The successfully sequenced colony was named pMDC83-BnaGSTU11.

[0056] (2) Genetic transformation of rapeseed

[0057] The genetic transformation method for Brassica napus was slightly modified based on the transformation method developed by the State Key Laboratory of Crop Genetic Improvement at Huazhong Agricultural University. Using the hypocotyl infection method, plasmids containing the recombinant vector pMDC83-BnaGSTU11 were transformed into Agrobacterium GV3101. The hypocotyls of Brassica napus J9712 were then infected with Agrobacterium. Transgenic plants were obtained through selection and differentiation. The specific steps are as follows:

[0058] (a) Plasmid containing the recombinant vector pMDC83-BnaGSTU11 was transformed into Agrobacterium tumefaciens GV3101 via electroporation. The specific steps were as follows: 100 μL of competent Agrobacterium cells were mixed with 1.5–2.5 μL of the recombinant plasmid. The mixture was then added to an electroporation cuvette, which was capped and placed in an electroporator. Immediately after electroporation, 500 μL of antibiotic-free LB broth was added for Agrobacterium culture. After thorough washing, 30–50 μL of the mixed culture was spread onto LB solid medium containing kanamycin and Rif antibiotics. The medium was incubated at 28°C for 36–48 h. Single colonies were picked for colony PCR identification. 50% glycerol was added to positive colony cultures at a 1:1 ratio for preservation. The cultures were then stored at -80°C for subsequent genetic transformation.

[0059] (b) Sterilization of seeds

[0060] Soak rapeseed J9712 seeds in 75% alcohol for 1 minute; disinfect seeds with 2% NaClO for 15 minutes; rinse seeds 4-5 times with sterilized ddH2O.

[0061] (c) Sowing

[0062] Using flaming tweezers, place the sterilized seeds into M0 medium and incubate in the dark at 24°C for 4-5 days.

[0063] (d) Activation of Agrobacterium

[0064] Incubate at 28℃ and 250 rpm in a shaker for 20-24 hours until Agrobacterium contains the recombinant vector, until its OD value reaches its maximum. 600 It reached 0.8.

[0065] (e) Acquisition of explants and Agrobacterium infection

[0066] Hypocotyls of seedlings 4-5 days after sowing are excised using sterile forceps and a scalpel, with each segment measuring 1.0-1.5 cm in length. 2 mL of bacterial suspension is centrifuged at 6000 rpm for 5 min, then 2 mL of DM solution is added to resuspend the precipitate. This process is repeated once, and finally, another 2 mL of DM is added to resuspend the precipitate. The mixture is then poured into a large petri dish containing 18 mL of DM (i.e., diluted 10-fold), followed by the addition of 20 μL (i.e., a 1:1000 ratio) of AS hormone, and the mixture is shaken well to prepare the infection solution. The infection time is typically 10-15 min. After infection, the explants are placed in a petri dish lined with two layers of filter paper using forceps and allowed to air dry for 10 min. After drying, they are placed on M1 medium and incubated upside down in the dark for 36-48 h.

[0067] (f) Differentiation and rooting of explants

[0068] After culturing on M1 medium for 36-48 hours, the explants are transferred to M2 medium and cultured for 20 days, resuming the normal photoperiod treatment. After 20 days, explants with swollen callus tissue from M2 are transferred to M3 medium, and the M3 iteration is repeated 2-3 times until green shoots appear on the explants. When a clear growth point is found on the explants with green shoots on M3, the seedlings are carefully cut off with a scalpel, and the regenerated seedlings are transferred to M4 medium for rooting treatment. After 2-4 weeks, the resulting tissue culture seedlings can be transferred to soil for soil culture. See the schematic diagram. Figure 3 .

[0069] Culture medium formulations (using 1L of culture medium as an example):

[0070]

[0071] Example 4: Positive identification of transgenic plants overexpressing BnaGSTU11

[0072] (1) Extraction of DNA from transgenic plants

[0073] One week after the transgenic plants were transferred to soil culture, they could be identified as positive. A standard rapid method for extracting plant DNA was used, and the specific steps were as follows:

[0074] (a) Take 2-3g of rapeseed leaf tissue, place it in a 2.0EP tube, and then add a cooled, sterilized steel ball and 500μL of buffer (for 1L of culture medium: 60.5g Tris-base + appropriate amount of pure water, adjust the pH to 7.5 with concentrated hydrochloric acid, and then add 17.5g NaCl and 102.69g sucrose);

[0075] (b) Place the sample in a sample grinder and grind for 210 seconds;

[0076] (c) The ground sample was placed in a boiling water bath for 10 min, followed by centrifugation at 12000 rpm for 5 min.

[0077] (d) Take 50 μL of sample supernatant as DNA stock solution, and dilute the stock solution to 100 ng / μL as DNA template concentration.

[0078] (2) Detection of positive transgenic plants

[0079] Use 1 μL of diluted DNA as a template and perform PCR amplification to identify positive results in the plants. The primers used are:

[0080] GSTU11-pMDC83-F:AGGACCTCGACTCTAGAACTAGTATGGGTCTAATCAGTGAAG;

[0081] pMDC83-GFP-R:CATCACCTTCACCCTCTCCAC.

[0082] The negative control was non-transgenic wild-type rapeseed DNA, and the positive control was a plasmid containing the recombinant vector. After PCR amplification, the products were subjected to agarose gel electrophoresis. The presence of a specific target band in the electrophoresis results determined whether pMDC83-BnaGSTU11 had been successfully introduced into the rapeseed genome.

[0083] Example 5: Overexpression of BnaGSTU11 reduced the area of ​​sclerotinia rot lesions in transgenic Brassica napus.

[0084] qPCR identification of transgenic rapeseed overexpressing BnaGSTU11

[0085] To identify whether BnaGSTU11 is overexpressed in rapeseed, qPCR was used to analyze the T1 generation lines of the positive plants identified in Example 3 after propagation. The control group was wild-type rapeseed J9712. The primer sequences used were:

[0086] GSTU11-qPCR-F:CCATCCTTCCCTCAGACCCA;

[0087] GSTU11-qPCR-R:CTTTTGCTACCGCCACTCCA.

[0088] qPCR results showed that the expression levels of BnaGSTU11 in the overexpressing lines were all higher than those in the wild-type control group. (See...) Figure 4Leaves from various lines of T1 generation rapeseed overexpressing BnaGSTU11 were inoculated with the bacillus sclerotinia to assess their resistance phenotype. The control group was wild-type rapeseed J9712. Results showed that the lesion area of ​​the BnaGSTU11 overexpressing lines was significantly smaller than that of the control group J9712, indicating that BnaGSTU11 overexpression enhances resistance to sclerotinia sclerotinia in rapeseed. (See...) Figure 5 and Figure 6 .

[0089] Therefore, BnaGSTU11 can effectively improve the resistance of Brassica napus to Sclerotinia stem rot, which has a profound impact on improving the yield and quality of Brassica napus. It also provides theoretical guidance for exploring Sclerotinia stem rot resistance genes in other crops.

[0090] The above embodiments are preferred embodiments of the present invention and are not intended to limit the present invention. Any technical improvements and equivalent substitutions made to the present invention by those skilled in the art without departing from the spirit or scope of the present invention are within the protection scope of the present invention.

Claims

1. Application of rapeseed protein with amino acid sequence as shown in SEQ ID NO:2 in improving resistance to sclerotinia stem rot in rapeseed.

2. A method for improving the resistance of Brassica napus to Sclerotinia stem rot, characterized in that, This involves overexpressing the nucleic acid molecule shown in SEQ ID NO:1 in Brassica napus.

3. The method according to claim 2, characterized in that, The steps are as follows: (1) Clone the DNA fragment shown in SEQ ID NO:1 from Darmor and ligate it into an expression vector to form a recombinant expression vector; (2) Transform Agrobacterium GV3101 with the plasmid carrying the recombinant expression vector using electroporation; Transform the Agrobacterium carrying the recombinant vector plasmid into rapeseed using Agrobacterium transformation to obtain transgenic plants.

Citation Information

Patent Citations

  • Application of BnWAK1 gene in regulation and control of sclerotinia rot resistance of brassica napus

    CN116064467A

  • Sclerotinia resistance gene

    WO2005090578A1