Recombinant saccharomyces cerevisiae for producing human epidermal growth factor based on biological membrane as well as construction method and application thereof

Abstract

The invention relates to the technical field of bioengineering, in particular to recombinant saccharomyces cerevisiae for producing a human epidermal growth factor based on a biological membrane as well as a construction method and application of the recombinant saccharomyces cerevisiae. According to the invention, saccharomyces cerevisiae BY4742 and 530-1C are used as chassis cells for expressing the human epidermal growth factor (hEGF), and the yield of the human epidermal growth factor (hEGF) is increased to 15 mg / L from 80 [mu] g / L by means of gene modification, promoter optimization, signal peptide optimization and the like; by optimizing related modules in an engineering protein secretion pathway, single or combined deletion of degrading enzyme genes (PEP4, PRB1 and YAP3) and overexpression of key node genes (KAR2, PDI1, HAC1, ERV29, ERO1, SRP54, SEC24 and DER1) in the protein secretion pathway, the hEGF yield is increased to the level of 141 mg / L; a biological membrane strain with the performance of flocculation and adhesion to an abiotic surface is constructed by selecting an endogenous flocculation gene FLO11 of overexpression yeast and an exogenous gene ALS3 of tritirachium album, and continuous production of hEGF is realized based on biological membrane immobilized continuous fermentation, and the yield is stabilized at 300 mg / L or above.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a recombinant saccharomyces cerevisiae producing human epidermal growth factor based on a biofilm, and a construction method and application thereof. Background Art

[0002] Human epidermal growth factor (hEGF) plays an important role in stimulating cell growth, proliferation and differentiation. It can promote the healing of epidermal wounds, corneal injuries and burns, as well as the regeneration of nerve tissue and tympanic membranes. It has a certain repair effect on liver and eye injuries. hEGF has been widely used in various acute and chronic wounds, and is also used in the beauty industry to improve skin quality, with great prospects.

[0003] The hEGF from natural sources is very limited, the separation steps are very cumbersome, and the yield is very low, which cannot meet the current market demand. At present, the demand for hEGF is met based on the biological production of microbial hosts. It has been successfully expressed in multiple hosts such as Escherichia coli, Saccharomyces cerevisiae, and Chinese ovary cells (CHO). However, different hosts have their own limitations. Escherichia coli does not have post-translational modification function and cannot directly obtain hEGF with biological activity. The cultivation cost of CHO cells is high, and Saccharomyces cerevisiae has excessive glycosylation and is not easy to achieve high-density fermentation. Regardless of the host, in the process of producing hEGF, intermittent fermentation or continuous fermentation mode is generally used, and there are also problems such as poor environmental tolerance and loss of production cells, which leads to low production efficiency of hEGF.

[0004] Biofilms are microbial aggregates embedded in extracellular polymers formed by microbial cells adhering to biological or non-biological surfaces, which protect cells from adverse environmental conditions such as osmotic pressure, heat shock, oxidative stress and nutrient deficiency. Biofilm-based fermentation is a technology developed based on the characteristics of biofilms, which is very different from other cell immobilization technologies (such as embedding, cross-linking, adsorption and covalent binding). Different from traditional cell immobilization methods that are limited in terms of carrier material cost, performance and cell immobilization, biofilm fermentation provides superior fermentation potential, environmental tolerance, efficiency and stability. Although biofilm-based immobilized fermentation has been successfully applied to the production of small molecules such as bioethanol, its application in protein production is still not widespread, and related research is also rare. So far, there has been no report on the production of hEGF based on biofilm by Saccharomyces cerevisiae, which has been certified by the FDA for general safety. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a recombinant saccharomyces cerevisiae for producing human epidermal growth factor based on biofilm in view of the deficiencies of the prior art.

[0006] The technical problem that the present invention also aims to solve is to provide a construction method for producing human epidermal growth factor based on biofilm.

[0007] The final technical problem to be solved by the present invention is to provide the use of the above-mentioned recombinant saccharomyces cerevisiae in the fermentation preparation of human epidermal growth factor.

[0008] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0009] The recombinant Saccharomyces cerevisiae for producing human epidermal growth factor based on biofilm is constructed by taking Saccharomyces cerevisiae as the starting strain and mediating the expression of human epidermal growth factor hEGF by deleting protease encoding genes and / or overexpressing molecular chaperone genes and overexpressing biofilm-forming genes.

[0010] A method for constructing human epidermal growth factor based on biofilm production uses Saccharomyces cerevisiae as a starting strain and mediates the expression of human epidermal growth factor hEGF by deleting protease encoding genes and / or overexpressing molecular chaperones and biofilm-forming genes.

[0011] Furthermore, any one or a combination of several of the promoter, fusion polypeptide chain and signal peptide is introduced into the starting strain.

[0012] Preferably, a combination of a promoter and a signal peptide or a combination of a fusion polypeptide chain and a signal peptide is introduced into the starting strain.

[0013] Wherein, the promoter is an inducible promoter or a constitutive promoter.

[0014] Preferably, the inducible promoter is GAL1, and the constitutive promoter is any one of TEF1, TPI1, and TDH3.

[0015] Wherein, the fusion polypeptide chain is HL28; and the signal peptide is MFα or TA57.

[0016] Specifically, the nucleotide sequence of the GAL1 is shown in SEQ ID NO.12; the nucleotide sequence of the TEF1 is shown in SEQ ID NO.9; the nucleotide sequence of the TPI1 is shown in SEQ ID NO.10; the nucleotide sequence of the TDH3 is shown in SEQ ID NO.11; the amino acid sequence of the HL28 is shown in SEQ ID NO.23, and the corresponding nucleotide sequence is shown in SEQ ID NO.24; the amino acid sequence of the MFα is shown in SEQ ID NO.3, and the corresponding nucleotide sequence is shown in SEQ ID NO.4; the amino acid sequence of the TA57 is shown in SEQ ID NO.7, and the corresponding nucleotide sequence is shown in SEQ ID NO.8.

[0017] Among them, the starting strains include but are not limited to Saccharomyces cerevisiae 530-1C, Saccharomyces cerevisiae 2-1C, Saccharomyces cerevisiae BY4741, Saccharomyces cerevisiae BY4742 or Saccharomyces cerevisiae W303-1A. As long as the Saccharomyces cerevisiae in the prior art can be used as the starting strain of the present invention, it is within the scope of protection of the present invention.

[0018] Preferably, the starting strain is Saccharomyces cerevisiae BY4742 or Saccharomyces cerevisiae 530-1C.

[0019] Wherein, the protease encoding gene includes any one or a combination of PEP4, PRB1, YAP3, PRC1, and CMY1.

[0020] Preferably, the protease encoding gene includes any one or a combination of PEP4, PRB1, and YAP3, more preferably PEP4 and PRB1.

[0021] Specifically, the amino acid sequences of the protease encoding genes PEP4, PRB1, and YAP3 are shown in SEQ ID NO.13, SEQ ID NO.15, and SEQ ID NO.17, respectively, and the corresponding nucleotide sequences are shown in SEQ ID NO.14, SEQ ID NO.16, and SEQ ID NO.18, respectively.

[0022] The molecular chaperone genes include any one or a combination of KAR2, PDI1, HAC1, DER1, SEC24, SRP54, ERO1, and ERV29.

[0023] Preferably, the molecular chaperone gene includes any one or a combination of PDI1, KAR2, and HAC1, more preferably PDI1 or KAR2.

[0024] Specifically, the amino acid sequences of KAR2 and PDI1 are shown in SEQ ID NO.19 and SEQ ID NO.21, respectively, and the corresponding nucleotide sequences are shown in SEQ ID NO.20 and SEQ ID NO.22, respectively; the amino acid sequences of HAC1, DER1, SEC24, SRP54, ERO1 and ERV29 genes are shown in SEQ ID NO.25, SEQ ID NO.27, SEQ ID NO.29, SEQ ID NO.31, SEQ ID NO.33 and SEQ ID NO.35, respectively, and the corresponding nucleotide sequences are shown in SEQ ID NO.26, SEQ ID NO.28, SEQ ID NO.30, SEQ ID NO.32, SEQ ID NO.34 and SEQ ID NO.36, respectively.

[0025] Wherein, the overexpression of the molecular chaperone is based on overexpression of the molecular chaperone by a plasmid or overexpression of the molecular chaperone by integrating the molecular chaperone into the genome of Saccharomyces cerevisiae.

[0026] Preferably, when Saccharomyces cerevisiae 530-1C is used as the most original starting strain, the molecular chaperone genes PDI1, KAR2 and HAC1 are integrated into the genome of Saccharomyces cerevisiae for overexpression.

[0027] Specifically, the integration gene site of the PDI1 gene is 1309a, the integration gene site of the KAR2 gene is 911b, and the integration gene site of the HAC1 gene is HAC1.

[0028] The biofilm-forming genes include any one of ALS3 and FLO11 or a combination of both.

[0029] Furthermore, the ALS3 gene is derived from Candida albicans, and the FLO11 gene is endogenous to Saccharomyces cerevisiae.

[0030] Preferably, the biofilm-forming gene is ALS3 or FLO11, more preferably ALS3.

[0031] Specifically, the amino acid sequences of ALS3 and FLO11 are shown in SEQ ID NO.37 and SEQ ID NO.39 respectively, and the corresponding nucleotide sequences are shown in SEQ ID NO.38 and SEQ ID NO.40 respectively.

[0032] Wherein, the overexpression of the biofilm-forming gene is to integrate the biofilm-forming gene into the genome of Saccharomyces cerevisiae for overexpression.

[0033] Specifically, the integration gene site of the FLO11 gene is 1622b, and the integration gene site of the ALS3 gene is 106a.

[0034] In some embodiments of the present invention, when Saccharomyces cerevisiae BY4742 is used as the expression strain of hEGF, the recombinant Saccharomyces cerevisiae is specifically constructed as follows: Saccharomyces cerevisiae BY4742 is used as the starting strain, and the hEGF plasmid expression system is constructed with any one of the promoters TEF1, TPI1, TDH3, and GAL1 and the signal peptide TA57, and a recombinant Saccharomyces cerevisiae that produces human epidermal growth factor based on a biofilm is constructed by deleting any one or a combination of several of the protease encoding genes PEP4, PRB1, and YAP3 and / or overexpressing any one or a combination of two of the molecular chaperone genes PDI1 and KAR2, and integrating the flocculant encoding gene FLO11 or ALS3 into the genome.

[0035] In some embodiments of the present invention, when Saccharomyces cerevisiae 530-1C is used as the expression strain of hEGF, the specific construction of the recombinant Saccharomyces cerevisiae is as follows: Saccharomyces cerevisiae 530-1C is used as the starting strain, and the hEGF plasmid expression system is constructed with the signal peptide and the fusion polypeptide HL28, and by deleting any one or a combination of two of PEP4 and PRB1 and / or overexpressing any one or a combination of several of the molecular chaperone genes KAR2, PDI1, HAC1, DER1, SEC24, SRP54, ERO1, and ERV29, and integrating the flocculant protein encoding gene FLO11 or ALS3 into the genome, a recombinant Saccharomyces cerevisiae that produces human epidermal growth factor based on a biofilm is constructed.

[0036] The use of recombinant Saccharomyces cerevisiae in the fermentation preparation of human epidermal growth factor is also within the scope of protection of the present invention.

[0037] Wherein, the fermentation is free fermentation or immobilized fermentation.

[0038] Preferably, the free fermentation is fed-batch fermentation, and the immobilized fermentation is immobilized continuous fermentation.

[0039] Among them, the immobilized continuous fermentation, its immobilized carrier includes but is not limited to cotton fiber, and the materials that can be used as immobilized carriers in the prior art can be used in the immobilized fermentation of the present invention, such as any one of glass sheets, polyester fibers, nylon fibers, wood pulp cotton, polylactic acid, activated carbon, polyethylene, polyvinyl alcohol, polyurethane, clay, metal and ceramics.

[0040] Preferably, the cotton fiber has a content of 2.5 to 60 g / L.

[0041] The fed-batch fermentation comprises inoculating the seed liquid into the fermentation medium, adding the feed medium after fermentation for 18 to 24 hours, maintaining the glucose concentration at 0.5 to 3 g / L, and the total fermentation time is 120 to 144 hours; the fermentation conditions are as follows: temperature 28 to 32°C, initial stirring speed 500 rpm, aeration rate 1 to 3 vvm, maintaining the dissolved oxygen value at 20 to 30%, and pH 6.0 to 6.5.

[0042] Among them, the immobilized continuous fermentation specifically involves inoculating the seed liquid into the fermentation medium for fermentation, and when the fermentation reaches 18 to 24 hours, feeding medium is added to maintain the glucose concentration at 0.5 to 3 g / L. When the fermentation reaches 24 to 60 hours, the first batch of fermentation is terminated, 20 to 100% v / v of the fermentation liquid is discharged, and an equal amount of fresh feeding medium is added, and the fermentation, feeding medium is added, and the operation of discharging 20 to 100% v / v of the fermentation liquid is repeated.

[0043] Preferably, the first batch of fermentation is terminated when the fermentation reaches 48 hours.

[0044] Specifically, the fermentation conditions are as follows: temperature 28-32° C., initial stirring speed 500 rpm, aeration rate 1-3 vvm, maintaining dissolved oxygen value 20-30%, pH 6.0-6.5.

[0045] In some embodiments of the present invention, the operations of repeating the fermentation, feeding the feed medium, and discharging 20-100% v / v of the fermentation liquid can be performed for 2-15 batches.

[0046] The fermentation medium for the fed-batch fermentation and immobilized continuous fermentation is composed of 30-50 g / L glucose, 8-10 g / L yeast extract, 15-20 g / L trypsin, and the solvent is deionized water; the feed medium is composed of 8-10 g / L yeast extract, 15-20 g / L trypsin, 60-100 g / L glucose, 2-5 g / L KH2PO4, 2-5 g / L MgSO4, 1-2 g / L CaCl2, 1-3 g / L BSA, and 1-2 mL / L defoaming agent.

[0047] Beneficial effects:

[0048] (1) The present invention screened and obtained two expression hosts BY4742 and 530-1C for expressing hEGF. From the gene level: the signal peptide MFα, TA57, the promoter GAL1, TEF1, TPI1, TDH3 and the fusion polypeptide fragment HL28 were screened and combined for optimization, so that the yield of hEGF was increased from the μg level (80μg / L) to the mg level (50mg / L).

[0049] (2) The present invention optimizes the node genes that regulate hEGF in the secretory protein pathway of Saccharomyces cerevisiae and the proteases that degrade hEGF. The processing level of hEGF by related elements in the protein secretion pathway and endoplasmic reticulum (ER) is enhanced, and the level of hEGF production by Saccharomyces cerevisiae is significantly improved, and the hEGF yield is increased from 50 mg / L to 140 mg / L, an increase of 180%.

[0050] (3) The present invention introduces biofilm-forming genes FLO11 and ALS3 to change the phenotype of Saccharomyces cerevisiae, thereby enabling it to be adsorbed in a carrier, thereby achieving a fermentation mode in which Saccharomyces cerevisiae is fixed in a carrier to produce hEGF.

[0051] (4) The present invention successfully achieved a continuous fermentation model in a fermentation tank by constructing a successful biofilm strain, and the output was stabilized above 300 mg / L. The production efficiency of 6.25 mg / L / h was greater than the 4.52 mg / L / h of free fermentation. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0053] Figure 1 For the screening of expression hosts. Among them, a is the expression and schematic diagram of yeGFP in different hosts; b is the average fluorescence intensity of different hosts.

[0054] Figure 2 Results of optimizing the expression of hEGF signal peptide and promoter in BY4742. a is the signal peptide optimization result, using plasmid pYES2 / CT-GAL1-CYC1 as the backbone to construct GAL1 promoter-mediated hEGF expression without signal peptide (null), MFα and TA57; b is the promoter optimization result, using plasmid pG418-TA57-ADH1t as the backbone to construct four promoters (GAL1, TEF1, TPI1, TDH3) to mediate the TA57 signal peptide expression hEGF system.

[0055] Figure 3The experimental results of multi-gene regulation in producing hEGF. Among them, a is a schematic diagram of the deletion of protease encoding genes (PEP4, PRB1, YAP3); b is the co-expression of PDI1, KAR2 and hEGF using plasmids; c is the investigation of the growth curves of different recombinant strains; c is the growth curve investigation; d is SDS-PAGE analysis (lane 1: WT; lane 2: overexpression of KAR2; lane 3: overexpression of PDI1; lane 4: deletion of YAP3 and PEP4; lane 5: deletion of YAP3 and PRB1; lane 6: deletion of PEP4 and PRB1; lane 7: deletion of PEP4; lane 8: deletion of YAP3; lane 9: deletion of PEP4, YAP3 and PRB1; lane 10: deletion of PRB1; lane 11: overexpression of PDI1 and KAR2; lane 12: deletion of PEP4; lane 13: marker); e is the effect of different modified recombinant strains on hEGF production.

[0056] Figure 4 The hEGF expression system was constructed based on the host 530-1C. a is a schematic diagram of the construction of the hEGF expression system; b is a graph showing the average yield of extracellular hEGF by free fermentation of the three recombinant strains constructed.

[0057] Figure 5 Effects of three protease-deficient recombinant strains on hEGF production and OD 600 and pH influence.

[0058] Figure 6 To improve the production of hEGF by engineering related elements in the protein secretion pathway. Among them, a is a schematic diagram of the recombinant plasmid based on the secretion channel gene; b is the effect of plasmid overexpression and genome integration overexpression strain on hEGF production and OD 600 and pH influence.

[0059] Figure 7 Statistical graph of hEGF production results from combined protease deletion and overexpression of chaperone-related genes.

[0060] Figure 8 The results of the standard plate washing analysis experiment are shown in Figure 1. a is the recombinant strains BY4742 ALS3ΔPEP4ΔPRB1pKAR2 and BY4742 FLO11ΔPEP4ΔPRB1pKAR2 overexpressing FLO11 or ALS3; b is the recombinant strains SIC ALS3-1309a-PDI1 and SIC ALS3-1309a-PDI1 overexpressing FLO11 or ALS3.

[0061] Fig. 9The results of the SEM analysis experiment are shown in Figure 1. a is the SEM result of the recombinant strain BY4742 FLO11ΔPEP4ΔPRB1pKAR2 overexpressing FLO11; b is the SEM result of the recombinant strain BY4742 ALS3ΔPEP4ΔPRB1pKAR2 overexpressing ALS3.

[0062] Fig.10 The effects of biofilm formation genes FLO11 and ALS3 on the production of hEGF in different recombinant strains. a is in BY4742 FLO11ΔPEP4ΔPRB1pKAR2 and BY4742 FLO11ΔPEP4ΔPRB1pKAR2 recombinant strains; b is in SIC ALS3-1309a-PDI1 and SIC ALS3-1309a-PDI1 recombinant strains.

[0063] Fig.11 The results of integrating FLO11 and ALS3 into four recombinant strains and using cotton fiber as a carrier for immobilized fermentation in a shake flask for 72 hours. a is in BY4742 FLO11ΔPEP4ΔPRB1pKAR2 and BY4742FLO11ΔPEP4ΔPRB1pKAR2 recombinant strains; b is in SIC ALS3-1309a-PDI1 and SIC ALS3-1309a-PDI1 recombinant strains.

[0064] Fig.12 This is a graph showing the changes in various parameters of the non-film-forming strain SIC in the fermenter.

[0065] Fig.13 Results of different fermentation times for 5 strains in different states. a: pH; b: OD 600 ; c: hEGF production.

[0066] Fig.14 The cell activity detection of 5 different strains. Among them, a: PI staining; b: statistical results of the percentage of live and dead cells.

[0067] Fig.15 To verify the effect of a single fermentation time on strain SIC-ALS3 in multiple batches. Among them, a: 10 batches of shake flask fermentation results of strain SIC-ALS3; b: PI staining image; c: statistical results of the percentage of live and dead cells.

[0068] Fig.16The results of cell activity of immobilized fermentation and free fermentation of strain SIC-ALS3 at different time points in a single batch fermentation (48h). Among them, a: PI staining of immobilized fermentation and free fermentation; b: statistical results of the percentage of live and dead cells in immobilized fermentation; c: statistical results of the percentage of live and dead cells in free fermentation.

[0069] Fig.17 The fermentation results of strain SIC-ALS3 in different fermentation media in a single batch.

[0070] Fig.18 The effect of different sugar concentrations on the fermentation results of multiple batches of strain SIC-ALS3. Among them, a: 30g / L glucose; b: 40g / L glucose; c: 50g / L glucose.

[0071] Fig.19 The effects of feeding and no feeding on the results of single batch fermentation of strain SIC-ALS3.

[0072] Fig. 20 These are the results of multiple batches of fermentation based on the pH-STAT fermentation strategy for strain SIC-ALS3.

[0073] Fig.21 These are the results of multiple batches of strain SIC-ALS3 based on the DO-STAT fermentation strategy.

[0074] Fig. 22 Results of a single batch using a DO-STAT based fermentation strategy for three high producing strains. Fig.23 The results of fed-batch fermentation experiments of SICALS3-1309a-PDI1 and BY4742 ALS3ΔPEP4ΔPRB1pKAR2 are shown in Figure 1. a is BY4742 ALS3ΔPEP4ΔPRB1pKAR2; b is SIC ALS3-1309a-PDI1.

[0075] Fig.24 The results of the immobilized continuous fermentation culture experiment of SIC ALS3-1309a-PDI1 and BY4742 ALS3ΔPEP4ΔPRB1pKAR2. a is BY4742 ALS3ΔPEP4ΔPRB1pKAR2; b is SIC ALS3-1309a-PDI1. DETAILED DESCRIPTION

[0076] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0077] The present invention can be better understood according to the following examples. However, it is easy for those skilled in the art to understand that the contents described in the examples are only used to illustrate the present invention, and should not and will not limit the present invention described in detail in the claims.

[0078] In the following examples, the Saccharomyces cerevisiae 530-1C was donated by Professor Yang Sheng from the Key Laboratory of Synthetic Biology, Chinese Academy of Sciences, and the Saccharomyces cerevisiae 2-1C, Saccharomyces cerevisiae BY4741, Saccharomyces cerevisiae BY4742 and Saccharomyces cerevisiae W303-1A were from the National Biochemical Engineering Technology Research Center.

[0079] In the following embodiments, the formula of the YPD medium is: peptone 20 g / L, yeast extract 10 g / L, glucose 20 g / L; the formula of the SDU medium is: 10×AA solution (L-arginine 0.1 g / L; L-cysteine ​​0.1 g / L; L-lysine 0.1 g / L; L-threonine 0.1 g / L; L-aspartic acid 0.05 g / L; L-isoleucine 0.05 g / L; L-phenylalanine 0.05 g / L; L-proline 0.05 g / L; L- Serine 0.05g / L; L-tyrosine 0.05g / L; L-valine 0.05g / L; L-methionine 0.05g / L; L-tryptophan 0.1g / L; L-histidine 0.05g / L; L-uracil 0.1g / L; L-leucine 0.1g / L; L-adenine 0.1g / L); 10×YNB solution (13.4%); 20g / L glucose; the formula of the SGU culture medium is: 10×AA solution; 10×YNB solution; 20g / L galactose.

[0080] In the following examples, the primers used are shown in the following table:

[0081]

[0082]

[0083] Example 1: Screening hEGF-expressing strains using the fluorescent reporter gene yeGFP

[0084] 1. Construction of plasmid pYES2 / CT-GAL1-yeGFP-CYC1

[0085] The commercial plasmid pYES2 / CT-GAL1-CYC1 was degraded by using fast-cutting enzymes Kpn I and Not I to obtain a linearized backbone, the reporter gene yeGFP was amplified by using primers yeGFP-F and yeGFP-R, and the plasmid backbone reporter gene yeGFP was connected by using a one-step cloning kit to construct a recombinant plasmid pYES2 / CT-GAL1-yeGFP-CYC1. The amino acid sequence of the reporter gene yeGFP is shown in SEQ ID NO.1, and the corresponding nucleotide sequence is shown in SEQ ID NO.2.

[0086] 2. Plasmid transformation

[0087] (1) The host yeasts Saccharomyces cerevisiae W303-1A, Saccharomyces cerevisiae BY4741, Saccharomyces cerevisiae BY4742, and Saccharomyces cerevisiae 530-1C were activated and cultured at 30°C for about 40 hours to grow single colonies.

[0088] (2) In a sterile clean bench, single colonies from step (1) were picked and transferred into 5 mL of YPD liquid culture medium and cultured at 30° C. and 220 rpm for 20 h to obtain culture medium.

[0089] (3) The culture solution described in step (2) was transferred to 50 mL of YPD liquid medium and cultured at 30°C and 220 rpm until the culture solution OD 600 =0.8~1.0.

[0090] (4) In a sterile clean bench, transfer 50 mL of the culture medium in step (3) into a sterilized and pre-cooled 50 mL centrifuge tube, centrifuge at 4000 rpm and 4°C for 5 min, and discard the supernatant.

[0091] (5) LiAc conversion: Add a small amount of ddH2O to each of the centrifuge tubes in step (4), shake well, add ddH2O to 1 / 2 of the tube, centrifuge at 3000rpm for 5min, and discard the supernatant. Repeat the above steps, add 1mL of ddH2O to resuspend, and centrifuge at 8000rpm for 1min. Add 1mL of ddH2O to resuspend, pipette 200μL into a 1.5mL microcentrifuge tube, and centrifuge at 12000rpm for 1min. Pipette the supernatant, add 1μg of recombinant plasmid, and vortex. Add 240μL of 500g / L PEG 3350, 50μL of 2mg / mL ss DNA (ssDNA was boiled for 5min before use), and 36μL of 1M lithium acetate. After vortexing, incubate at 42℃ in a water bath for 20min, mix twice, and centrifuge at 12000rpm for 1min, and discard the supernatant. Finally, add 1 mL of YPD medium, culture in a shaker at 30°C, 240 rpm for 2-3 h, centrifuge at 3000 rpm for 4 min, discard 600 μL of supernatant, mix the remaining 200 μL of bacterial solution by pipetting, spread on SDU solid culture medium, and culture at 30°C for 40 h.

[0092] 3. Strain identification

[0093] Single colonies were picked from the plates and mixed by pipetting in 20 μL of ddH2O. Microwaved for 1 min at high temperature, frozen at -80°C for 10 min, and microwaved for 12 min at high temperature. PCR amplification was performed using 2x Taq Plus Master Mix II. Four recombinant strains were obtained after nucleic acid gel verification and transferred into different hosts.

[0094] The PCR amplification system was: 2x Taq Plus Master Mix II 10 μL, Primer-F 1 μL, Primer-R 1 μL, Template 1 μL, ddH2O 7 μL; PCR amplification conditions were: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C at 1 kb / min, 34 cycles; extension at 72°C for 5 min, and insulation at 12°C∞.

[0095] 4. Strain fermentation: Select positive transformants and place them in 5 mL of SDU medium for 24 hours. Transfer all the cultured bacterial liquid to SGU medium and continue fermentation for 72 hours.

[0096] 5. Microscope observation: Take the bacterial solution and dilute it with ddH2O for 10 3 The cells were observed under an inverted fluorescence microscope, and Image J was used to quantify the average fluorescence intensity of green fluorescence in the recombinant strain.

[0097] result: Figure 1a is a schematic diagram of yeGFP expression in different hosts. Figure 1 b and Table 1 show the average fluorescence intensity of different hosts. According to the detection of the average fluorescence intensity, hosts BY4742 and 530-1C have better protein expression performance.

[0098] Table 1 Average fluorescence intensity of green fluorescence of recombinant strains of different hosts in free fermentation

[0099] Serial number Recombinant strains Mean fluorescence intensity 1 W303-1A / pYES2 / CT-GAL1-yeGFP-CYC1 61.99 2 BY4741 / pYES2 / CT-GAL1-yeGFP-CYC1 110.08 3 BY4742 / pYES2 / CT-GAL1-yeGFP-CYC1 136.47 4 530-1C / pYES2 / CT-GAL1-yeGFP-CYC1 160.77

[0100] Example 2: Optimization and construction of hEGF expression strain using BY4742 as host

[0101] 2.1 Construction and production of hEGF expression strain by optimizing signal peptide

[0102] (1) Construction of recombinant plasmid pYES2 / CT-GAL1-MFα-hEGF-CYC1. The commercial plasmid pYES2 / CT-GAL1-CYC1 was degraded with the fast cutting enzymes Kpn I and Not I to obtain a linearized backbone, the signal peptide MFα was amplified with primers MFα-F and MFα-R, the artificial synthetic gene hEGF was amplified with primers hEGF-F and hEGF-R, and the plasmid backbone, signal peptide MFα and artificial synthetic gene human epidermal growth factor hEGF gene fragment were connected with a one-step cloning kit to construct the recombinant plasmid pYES2 / CT-GAL1-MFα-hEGF-CYC1. The amino acid sequence of the signal peptide MFα is shown in SEQ ID NO.3, and the corresponding nucleotide sequence is shown in SEQ ID NO.4; the amino acid sequence of the human epidermal growth factor hEGF is shown in SEQ ID NO.5, and the corresponding nucleotide sequence is shown in SEQ ID NO.6.

[0103] (2) Constructing the recombinant plasmid pYES2 / CT-GAL1-TA57-hEGF-CYC1, using the plasmid backbone and hEGF gene fragment obtained in step (1), using primers TA57-F and TA57-R to amplify the signal peptide TA57, and using a one-step cloning kit to connect the plasmid backbone, signal peptide TA57 and the artificially synthesized gene human epidermal growth factor hEGF gene fragment to construct the recombinant plasmid pYES2 / CT-GAL1-TA57-hEGF-CYC1. The amino acid sequence of the signal peptide TA57 is shown in SEQ ID NO.7, and the corresponding nucleotide sequence is shown in SEQ ID NO.8.

[0104] (3) Plasmid transformation and strain identification: Referring to the steps of plasmid transformation and strain identification in Example 1, the recombinant plasmids obtained in steps (1) and (2) were introduced into the host BY4742 to obtain the recombinant strains BY4742 / pYES2 / CT-GAL1-MFα-hEGF-CYC1 and the recombinant strains BY4742 / pYES2 / CT-GAL1-TA57-hEGF-CYC1.

[0105] (4) Strain fermentation: Select positive transformants and place them in 5 mL of SDU medium, and culture them at 30°C for 24 h. Transfer all the cultured bacterial liquid to SGU medium and continue to culture at 30°C for 72 h. Use the recombinant strain BY4742 / pYES2 / CT-GAL1-hEGF-CYC as a control.

[0106] (5) Collecting bacteria: Centrifuge the bacterial solution obtained in step (4) at 6000 rpm for 10 min and collect the supernatant.

[0107] (6) hEGF detection: ELISA was used for detection, and the kit used was ab217772 Human EGF SimpleStep from abcam Kit.

[0108] The experimental results are as follows Figure 2 a and Table 2, it can be seen that the signal peptide TA57 has better performance and a higher average hEGF yield.

[0109] Table 2 Average production of extracellular human epidermal growth factor in free fermentation of recombinant strains with optimized signal peptide

[0110]

[0111] 2.2 Construction and production of hEGF expression strains by optimizing promoters

[0112] The promoter was optimized based on the signal peptide TA57 optimized in 2.1. The candidate promoters include: constitutive promoters TEF1, TPI1 and TDH3; and inducible promoter GAL1.

[0113] (1) Construction of expression plasmid. The commercial plasmid pG418-GAL2t was degraded using the fast-cutting enzyme BamH I and Kpn I sites to obtain a linearized plasmid backbone. The promoters TEF1, TPI1 and TDH3 were amplified using primers TEF1-F, TEF1-R, TPI1-F, TPI1-R, TDH3-F, and TDH3-R. The inducible promoter GAL1 is contained in the commercial plasmid pYES2 / CT-GAL1-CYC1. The nucleotide sequences of the promoters TEF1, TPI1, TDH3 and GAL1 are shown in SEQ ID NOs. 9 to 12, respectively.

[0114] The plasmid backbone, promoter, signal peptide TA57 and hEGF gene fragment were connected respectively using a one-step cloning kit to construct recombinant plasmids pG418-TEF1-TA57-hEGF-GAL2t, recombinant plasmids pG418-TPI1-TA57-hEGF-GAL2t, recombinant plasmids pG418-TDH3-TA57-hEGF-GAL2t and recombinant plasmids pG418-GAL1-TA57-hEGF-GAL2t.

[0115] (2) Plasmid transformation and strain identification: Referring to the steps of plasmid transformation and strain identification in Example 1, the recombinant plasmid obtained in step (1) was introduced into the host BY4742 to obtain recombinant strains BY4742 / pG418-TEF1-TA57-hEGF-GAL2t, BY4742 / pG418-TPI1-TA57-hEGF-GAL2t, BY4742 / pG418-TDH3-TA57-hEGF-GAL2t and BY4742 / pG418-GAL1-TA57-hEGF-GAL2t.

[0116] (3) Strain fermentation: Select positive transformants and place them in 5 mL of YPD medium containing 400 mg / L G418, and culture them at 30°C for 24 h. Transfer all the cultured bacterial liquid to YPD medium containing 400 mg / L G418, and continue to culture them at 30°C for 72 h.

[0117] (4) Collecting bacteria: Centrifuge the bacterial solution obtained in step (3) at 6000 rpm for 10 min and collect the supernatant.

[0118] (5) hEGF detection: ELISA was used for detection, and the kit used was ab217772 Human EGF SimpleStep from abcam Kit.

[0119] Results: The combination of inducible promoter GAL1, constitutive promoters TEF1, TPI1 and TDH3 mediated hEGF expression in host BY4742. The average and specific yield values ​​of extracellular hEGF in free fermentation were as follows: Figure 2 b and Table 3. According to the production of hEGF, it can be seen that the promoter TDH3 has better performance. The recombinant strain BY4742 / pG418-TDH3-TA57-hEGF-GAL2t expresses hEGF best.

[0120] Table 3 Average extracellular hEGF production of recombinant strains with optimized promoters in free fermentation

[0121]

[0122] 2.3 Deletion of protease encoding genes PEP4, PRB1, and YAP3 increases hEGF production

[0123] The recombinant strain BY4742 / pG418-TDH3-TA57-hEGF-GAL2t obtained in 2.2 is used as the chassis strain to knock out the protease encoding genes PEP4, PRB1, and YAP3, and the specific process is as follows. Among them, the amino acid sequences of the protease encoding genes PEP4, PRB1, and YAP3 are shown in SEQ ID NO.13, SEQ ID NO.15, and SEQ ID NO.17, respectively, and the corresponding nucleotide sequences are shown in SEQ ID NO.14, SEQ ID NO.16, and SEQ ID NO.18, respectively.

[0124] (1) The sgRNA sequences of PEP4, PRB1, and YAP3 were obtained from https: / / chopchop.cbu.uib.no /

[0125] Among them, the sgRNA sequence of the PEP4 gene is: AGAAGTACCAGTATCGATGG; the sgRNA sequence of the PRB1 gene is: TCGAGATCTTCGTCGTTAAG; the sgRNA sequence of the YAP3 gene is:

[0126] TTTGTAAAGATACTCCCAGGTGG

[0127] (2) Construction of CRISPR plasmid for gene knockout

[0128] The original plasmid pCas9-Hyg-ccdB was degraded with the fast-cutting enzyme Bsa I. The company's synthesized primers sgRNA-PEP4-F, sgRNA-PRB1-F, sgRNA-YAP3-F and sgRNA-PEP4-R, sgRNA-PRB1-R, sgRNA-YAP3-R were used to synthesize sgRNA-PEP4, sgRNA-PRB1, and sgRNA-YAP3 at 94°C according to 1 μL of upstream and downstream primers, 7 μL of ddH2O and 1 μL of T4 buffer at 94°C for 5 min. The linearized plasmid pCas9-Hyg-ccdB backbone was connected to sgRNA-PEP4, sgRNA-PRB1, and sgRNA-YAP3 using T4 ligase, and then transformed into E. coli Top 10 In competent cells, after ampicillin plate screening and sequencing verification, pCas9-Hyg-PEP4, pCas9-Hyg-PRB1, and pCas9-Hyg-YAP3 recombinant plasmids were obtained for subsequent gene knockout.

[0129] (3) Construction of donor DNA

[0130] 1000bp fragments upstream and downstream of the knockout gene were selected as the upstream and downstream homology arms, and PCR amplification was performed using corresponding primers. The upstream and downstream homology arms were spliced ​​together using Overlap PCR to form donor DNA of the genes to be knocked out, PEP4, PRB1, and YAP3, respectively, for subsequent gene knockout.

[0131] The amplification system of Overlap PCR is as follows: 10 μL of 5×buffer, 5 μL of dNTP, 1 μL of primer-F, 1 μL of primer-R, template 1: 1 μL of upstream homology arm, template 2: 1 μL of target gene expression cassette, template 3: 1 μL of downstream homology arm, 1 μL of DNA polymerase, and ddH2O added to 50 μL.

[0132] The amplification conditions of the Overlap PCR are: pre-denaturation at 98°C for 10 min; denaturation at 98°C for 10 sec, annealing at 55°C for 15 sec, extension at 72°C at 1 kb / min, for a total of 38 cycles; further extension at 72°C for 5 min; and insulation at 12-16°C∞.

[0133] (4) LiAc conversion

[0134] Take out the recombinant strain BY4742 / pG418-TDH3-TA57-hEGF-GAL2t stored in glycerol from -80℃, streak it on a YPD medium plate containing 400μg / L G418, culture it at 30℃ for 19-24h, wait for a single point to grow, pick the single point into 5mL YPD medium for culture, culture it at 30℃ for 19-24h, take the bacterial solution according to the initial OD 600 Inoculate into 50mL YPD culture medium at 0.1-0.2. 600 When the concentration reaches 0.8-1.0, collect the bacteria, centrifuge at 3000rpm for 5min, discard the supernatant, add a small amount of ddH2O and shake well, add ddH2O to 1 / 2 tube, centrifuge at 3000rpm for 5min, repeat the above steps, add 1mL of ddH2O to resuspend, centrifuge at 8000rpm for 1min. Add 1mL of ddH2O to resuspend, pipette 200μL into a 1.5ml microcentrifuge tube, centrifuge at 12000rpm for 1min. Pipette the supernatant, add 1μg of recombinant plasmid, 34μL of homologous recombination fragment and vortex. Add 240μL of PEG 3350 with a concentration of 500g / L, 50μL of 2mg / mL ss DNA (ss DNA was boiled for 5min before use) and 36μL of 1M lithium acetate, vortex and incubate at 42℃ for 20min in a water bath, mix twice during the period, centrifuge at 12000rpm for 1min, and discard the supernatant. Finally, 1 mL of YPD medium was added, and the mixture was cultured in a shaker at 30°C and 240 rpm for 2-3 h. The mixture was centrifuged at 3000 rpm for 4 min, 600 μL of supernatant was discarded, and 200 μL was spread on a YPD medium plate containing 400 μg / L HygB. The plate was incubated upside down in a constant temperature incubator at 30°C.

[0135] (5) Strain identification: Pick a single colony from the plate and mix it in 20 μL of ddH2O by pipetting. Heat it in a microwave oven at high temperature for 1 min, freeze it at -80℃ for 10 min, and heat it in a microwave oven at high temperature for 12 min. Perform PCR amplification using 2×Taq Plus Master Mix II. Verify the recombinant strains with single or combined deletion of protease encoding genes by nucleic acid gel.

[0136] (6) Plasmid elimination: Pick a single colony and place it in 5 mL of antibiotic-free YPD medium and culture it for 24 h. Pipette 50 μL of the bacterial solution into 5 mL of antibiotic-free YPE medium and culture it for 24 h (subculture). Pipette another 50 μL of the bacterial solution into 5 mL of antibiotic-free YPD medium and culture it for 24 h (subculture). Dilute the subcultured bacterial solution by 10 4Multiple times, plate on non-antibiotic YPD medium for culture. Pick single colonies and culture on YPD plates with and without antibiotics. Compare YPD plates without antibiotics and YPD plates with antibiotics. The strains that do not grow on YPD plates with antibiotics but grow on YPD plates without antibiotics are strains that have successfully lost the plasmid. Pick these strains from the YPD plates without antibiotics for culture and then preserve the bacteria.

[0137] (7) Strain culture: Pick a single colony in a sterile clean bench and transfer it to 5 mL of liquid YPD medium and culture it at 30°C and 220 rpm for 20 h. Then transfer the culture solution to 50 mL of YPD liquid medium and culture it at 30°C and 220 rpm for 72 h. The recombinant strain BY4742 / pG418-TDH3-TA57-hEGF-GAL2t was used as a control.

[0138] Results: The preferred recombinant strain BY4742 / pG418-TDH3-TA57-hEGF-GAL2t in 2.2 was used as the host for expressing hEGF, and seven different recombinant strains were constructed by single or combined deletion of proteases YAP3, PEP4, and PRB1. The average yield of extracellular hEGF in free fermentation is shown in Table 4. The schematic diagram of the deletion of protease encoding genes (PEP4, PRB1, YAP3) is shown in Figure 3 As shown in a. According to the production of hEGF, the recombinant strain BY4742ΔPEP4ΔPRB1pG418-TDH3-TA57-hEGF-GAL2t is preferred.

[0139] Table 4 Average production of extracellular hEGF in free fermentation by recombinant strains lacking single or combined proteases

[0140]

[0141] 2.4 Overexpression of molecular chaperones KAR2 and PDI1 in the protein secretion pathway increases hEGF production

[0142] The recombinant strain BY4742 / pG418-TDH3-TA57-hEGF-GAL2t obtained in 2.2 is used as the chassis strain, and the molecular chaperone KAR2 and disulfide bond isomerase PDI1 in the secretory pathway of the strain are overexpressed based on plasmid. Wherein, the amino acid sequences of the molecular chaperone KAR2 and disulfide bond isomerase PDI1 are shown in SEQ ID NO.19 and SEQ ID NO.21, respectively, and the corresponding nucleotide sequences are shown in SEQ ID NO.20 and SEQ ID NO.22, respectively.

[0143] (1) Construction of overexpression plasmid

[0144] Using plasmid pG418-TDH3-hEGF as a template, appropriate restriction sites were selected and the expression cassettes TPI1-PDI1-ADH1t, TPI1-KAR2-ADH1t and TPI1-KAR2-ADH1t-TEF1-PDI1-PRT41Bt were ligated into the pG418-TDH3-hEGF backbone using T4 ligase to obtain recombinant plasmids pG418-TPI1-PDI1-ADH1t-TDH3-hEGF, pG418-TPI1-KAR2-ADH1t-TDH3-hEGF and pG418-TPI1-KAR2-ADH1t-TEF1-PDI1-PRT41Bt-TDH3-hEGF, respectively, for subsequent transformation.

[0145] (2) LiAc conversion

[0146] Take out the recombinant strain BY4742 / pG418-TDH3-TA57-hEGF-GAL2t stored in glycerol from -80℃, streak it on a YPD medium plate containing 400μg / L G418, culture it at 30℃ for 19-24h, wait for a single point to grow, pick the single point to 5YPD medium for culture, culture it at 30℃ for 19-24h, take the bacterial solution according to the initial OD 600 Inoculate into 50YPD culture medium at 0.1-0.2. 600 When the concentration reaches 0.8-1.0, collect the bacteria, centrifuge at 3000rpm for 5min, discard the supernatant, add a small amount of ddH2O and shake well, add ddH2O to 1 / 2 tube, centrifuge at 3000rpm for 5min, repeat the above steps, add 1mL of ddH2O to resuspend, centrifuge at 8000rpm for 1min. Add 1mL of ddH2O to resuspend, pipette 200μL into a 1.5ml microcentrifuge tube, centrifuge at 12000rpm for 1min. Pipet the supernatant, add 1μg of recombinant plasmid and vortex. Add 240μL of 500g / L PEG3350, 50μL of 2mg / mL ss DNA (ss DNA boiled for 5min before use) and 36μL of 1 M lithium acetate, vortex and incubate at 42℃ for 20min in a water bath, mix twice during the period, centrifuge at 12000rpm for 1min, and discard the supernatant. Finally, 1 mL of YPD medium was added, and the mixture was cultured in a shaker at 30°C and 240 rpm for 2-3 h. The mixture was centrifuged at 3000 rpm for 4 min, 600 μL of supernatant was discarded, and 200 μL was spread on a YPD medium plate containing 400 μg / L HygB. The plate was incubated upside down in a constant temperature incubator at 30°C.

[0147] (3) Strain identification: Pick a single colony from the plate and mix it in 20 μL of ddH2O by pipetting. Heat it in a microwave oven at high temperature for 1 min, freeze it at -80℃ for 10 min, and heat it in a microwave oven at high temperature for 12 min. Use 2x Taq Plus Master Mix II for PCR amplification. Verify the recombinant strains that overexpress a single or combined molecular chaperone by nucleic acid gel.

[0148] (4) Strain culture: Pick a single colony in a sterile clean bench and transfer it to 5 mL of liquid YPD medium and culture it at 30°C and 220 rpm for 20 h. Then transfer the culture solution to 50 mL of YPD liquid medium and culture it at 30°C and 220 rpm for 72 h. The recombinant strain BY4742 / pG418-TDH3-TA57-hEGF-GAL2t was used as a control.

[0149] Results: The recombinant strain BY4742 / pG418-TDH3-TA57-hEGF-GAL2t selected in 2.2 was used as the host for expressing hEGF. Based on plasmid overexpression, three different recombinant strains were constructed by single or combined overexpression of molecular chaperones PDI1 and KAR2 in the secretory pathway. The average yield of extracellular hEGF in free fermentation is shown in Table 5. The schematic diagram of using plasmids to co-express PDI1, KAR2 and hEGF is shown in Figure 3 As shown in b. According to the yield of hEGF, the preferred molecular chaperone is KAR2, that is, the recombinant strain BY4742 pG418-TPI1-KAR2-TDH3-TA57-hEGF-GAL2t.

[0150] Table 5 Average production of extracellular hEGF in free fermentation by recombinant strains overexpressing molecular chaperones alone or in combination

[0151]

[0152] (5) Growth curve examination: Culture 2.3 in a 12 mL culture tube containing 5 mL of YPD medium at 30°C.

[0153] The recombinant strain constructed in part 2.4 was cultured for 32 hours. Samples were collected at 2-hour intervals and the OD was measured using an ultra-trace UV spectrophotometer. 600 The experimental results are as follows Figure 3 As shown in c.

[0154] 2.5 Combination of protease deletion and overexpression of chaperone-related genes to increase hEGF production

[0155] The recombinant strain BY4742 / pG418-TDH3-TA57-hEGF-GAL2t obtained in 2.2 was used as the host, and the regulatory factors PEP4 and PRB1 of the protease-deficient strain with the highest yield in 2.3 were combined with the regulatory factor KAR2 of the overexpression strain in 2.4 to obtain the recombinant strain BY4742ΔPEP4ΔPRB1 pG418-TPI1-KAR2-TDH3-TA57-hEGF-GAL2t. The construction process refers to 2.3 and 2.4.

[0156] Results: The average extracellular hEGF production of the recombinant strain BY4742ΔPEP4ΔPRB1 pG418-TPI1-KAR2-TDH3-TA57-hEGF-GAL2t in free fermentation is shown in Table 6. According to the hEGF production, the hEGF production of the recombinant strain BY4742ΔPEP4ΔPRB1 pG418-TPI1-KAR2-TDH3-TA57-hEGF-GAL2t with combined deletion of PEP4, PRB1 protease gene and molecular chaperone KAR2 reached 60.55 mg / L.

[0157] Table 6 Average yield of hEGF in free fermentation of recombinant strains with combined deletion of protease and overexpression of molecular chaperone genes

[0158]

[0159] All recombinant strains constructed in 2.3, 2.4, and 2.5 were subjected to SDS-PAGE analysis. The results of SDS-PAGE analysis are shown in Figure 3 d, the effects of all the different modified recombinant strains in 2.3, 2.4, and 2.5 on the hEGF production are shown in Figure 3 As shown in e.

[0160] Example 3: Optimization and construction of hEGF expression strain using 530-1C as host

[0161] 3.1 Construction of hEGF expression strain by optimizing expression elements (signal peptide and fusion polypeptide)

[0162] The hEGF expression system was constructed based on the preferred host 530-1C in Example 1, and the preferred elements included: fusion polypeptide HL28, artificial signal peptide TA57 and natural signal peptide α-matting factor (MFα). The amino acid sequence of the fusion polypeptide HL28 is shown in SEQ ID NO.23, and the corresponding nucleotide sequence is shown in SEQ ID NO.24.

[0163] (1) Construction of hEGF expression plasmid: The plasmid CPOTud was degraded using the Knp I and Not I sites of the fast-cutting enzyme to obtain a linearized backbone. The fusion polypeptide HL28, signal peptide TA57 and MFα were amplified using primers HL28-F, HL28-R, TA57-F, TA57-R, MFα-F, and MFα-R. The plasmid backbone, hEGF, and HL28, TA57, and MFα were connected using a one-step cloning kit to construct the recombinant plasmids CPOT-TA57-hEGF, CPOT-TA57-HL28-hEGF, and CPOT-MFα-HL28-hEGF.

[0164] (2) Plasmid transformation: Refer to the plasmid transformation process of Example 1

[0165] (3) Strain identification: refer to the strain identification process of Example 1. Finally, the recombinant strain 530-1C / CPOT-TA57-hEGF, the recombinant strain 530-1C / CPOT-TA57-HL28-hEGF and the recombinant strain 530-1C / CPOT-MFα-HL28-hEGF were obtained.

[0166] (4) Strain fermentation: Select positive transformants and place them in 5 mL of YPD medium, and culture them at 30°C for 24 h. Transfer all the cultured bacterial liquid to YPD medium and continue to culture at 30°C for 72 h.

[0167] (5) Bacteria collection: refer to the bacteria collection process of Example 1.

[0168] (6) Detection of hEGF: The chromatographic column uses octadecylsilane bonded silica gel as the filler; A trifluoroacetic acid-water solution (measure 1.0 ml trifluoroacetic acid and add water to 1000 ml, mix thoroughly) and B trifluoroacetic acid-acetonitrile solution (measure 1.0 ml trifluoroacetic acid and add chromatographic pure acetonitrile to 1000 ml, mix thoroughly) are used as the mobile phases, and gradient elution is performed at room temperature. The sample load should be no less than 10 μg, and the yield of extracellular hEGF in free fermentation is detected at a wavelength of 280 nm.

[0169] The gradient elution process was as follows: 0 min phase A: 100%, phase B 0%; 5 min phase A: 30%, phase B 70%; 5.1 min phase A: 100%, phase B 0%; 16 min phase A: 100%, phase B 0%.

[0170] Schematic diagram of hEGF expression system of three recombinant strains Figure 4 As shown in a, the production of extracellular hEGF by free fermentation of the three recombinant strains is as follows Figure 4 b and Table 7. According to the production of hEGF, the recombinant strain 530-1C / CPOT-TA57-hEGF performed better.

[0171] Table 7 Average production of extracellular hEGF in free fermentation of recombinant strains with optimized signal peptide and fusion polypeptide

[0172]

[0173] 3.2 Deletion of protease encoding genes PEP4 and PRB1 increases hEGF production

[0174] The preferred recombinant strain 530-1C / CPOT-TA57-hEGF in 3.1 was used as the chassis strain to knock out the protease encoding genes PEP4 and PRB1. The specific process is as follows.

[0175] (1) The sgRNA sequences of PEP4 and PRB1 were obtained from https: / / chopchop.cbu.uib.no /

[0176] Among them, the sgRNA sequence of the PEP4 gene is: AGAAGTACCAGTATCGATGG; the sgRNA sequence of the PRB1 gene is: TCGAGATCTTCGTCGTTAAG.

[0177] (2) Construction of CRISPR plasmid for gene knockout: The same as step (2) of step 2.3 of Example 2 was used to obtain pCas9-Hyg-PEP4 and pCas9-Hyg-PRB1 recombinant plasmids for subsequent gene knockout.

[0178] (3) Construction of donor DNA: The same as step (3) of step 2.3 of Example 2 was used to obtain donor DNA of genes to be knocked out, PEP4 and PRB1, for subsequent gene knockout.

[0179] (4) LiAc transformation: Using the recombinant strain 530-1C / CPOT-TA57-hEGF as the host, refer to step (4) of step 2.3 of Example 2.

[0180] (5) Strain identification: The same as step (5) of step 2.3 of Example 2. After nucleic acid gel verification, positive transformants were obtained, namely: 530-1CΔPEP4 COPT-TA57-hEGF, 530-1CΔPRB1 COPT-TA57-hEGF and 530-1CΔPEP4ΔPRB1COPT-TA57-hEGF.

[0181] (6) CRISPR plasmid elimination: same as step (6) of step 2.3 of Example 2.

[0182] (7) Strain culture: Pick a single colony in a sterile clean bench and transfer it to 5 mL of liquid YPD medium and culture it at 30°C and 220 rpm for 20 h. Then transfer the culture solution to 50 mL of liquid YPD medium and culture it at 30°C and 220 rpm for 72 h.

[0183] Results: The recombinant strain 530-1C / CPOT-TA57-hEGF selected in 3.1 was used as the host for expressing hEGF. The average production of extracellular hEGF in free fermentation of three different recombinant strains constructed by single and combined deletion of proteases PEP4 and PRB1 is shown in Table 8. According to the production of hEGF, the recombinant strain 530-1CΔPEP4ΔPRB1 / CPOT-TA57-hEGF was preferred. Figure 5 The effects of the above three protease-deficient recombinant strains on hEGF production, OD600 and pH are shown. It can be seen from the figure that the lack of protease has an impact on the growth performance of the strain.

[0184] Table 8 Average production of extracellular hEGF in free fermentation by recombinant strains lacking single or combined proteases

[0185]

[0186] 3.3 Engineering related elements in the protein secretion pathway to increase hEGF production

[0187] 3.3.1 Improving hEGF production by overexpressing related genes based on plasmids

[0188] The preferred recombinant strain 530-1C / CPOT-TA57-hEGF in 3.1 is used as a host to perform plasmid-based overexpression of relevant elements in the secretory pathway of the engineered protein in the secretory pathway of the strain.

[0189] (1) Construction of overexpression plasmid: Using plasmid pG418-TEF1-GAL2 as template, the fast-cutting enzymes Kpn I and Sac I were used to degrade the plasmid, and primers PDI1-F, PDI1-R; KAR2-F, KAR2-R; HAC1-F, HAC1-R; DER1-F, DER1-R; SEC24-F, SEC24-R; SRP54-F, SRP54-R; ERO1-F, ERO1-R; ERV29-F, ERV29-R were used to amplify the PDI1, KAR2, HAC1, DER1, SEC24, SRP54, ERO1 and ERV29 gene fragments, respectively. The linearized plasmid backbone pG418-TEF1-GAL2 was ligated to the already amplified The amplified gene fragments were ligated to the backbone using T4 ligase to obtain recombinant plasmids pG418-TEF1-PDI1-GAL2, pG418-TEF1-KAR2-GAL2, pG418-TEF1-HAC1-GAL2, pG418-TEF1-DER1-GAL2, pG418-TEF1-SEC24-GAL2, pG418-TEF1-SRP54-GAL2, pG418-TEF1-ERO1-GAL2, and pG418-TEF1-ERV29-GAL2, respectively, for subsequent transformation. Figure 6 a shows a schematic diagram of the recombinant plasmid based on the secretion channel gene.

[0190] Among them, the amino acid sequences of the HAC1, DER1, SEC24, SRP54, ERO1 and ERV29 genes are shown in SEQ ID NO.25, SEQ ID NO.27, SEQ ID NO.29, SEQ ID NO.31, SEQ ID NO.33 and SEQ ID NO.35, respectively, and the corresponding nucleotide sequences are shown in SEQ ID NO.26, SEQ ID NO.28, SEQ ID NO.30, SEQ ID NO.32, SEQ ID NO.34 and SEQ ID NO.36, respectively.

[0191] (2) LiAc transformation: Using the recombinant strain 530-1C / CPOT-TA57-hEGF as the host, refer to step (2) of step 2.4 of Example 2.

[0192] (3) Strain identification: The same as step (3) of step 2.4 of Example 2 was performed to finally obtain the recombinant strains described in Table 9.

[0193] Table 9 Recombinant strains constructed in 3.3 of Example 3

[0194]

[0195]

[0196] (4) Strain culture: same as step (4) of step 2.4 of Example 2.

[0197] Results: The preferred recombinant strain 530-1C / CPOT-TA57-hEGF in 3.1 was used as the host for expression. Based on plasmid overexpression, 8 different recombinant strains were constructed by overexpressing the related elements PDI1, KAR2, HAC1, DER1, SEC24, SRP54, ERO1 and ERV29 in the protein secretion pathway. The average production of extracellular hEGF in free fermentation is shown in Table 10. According to the production of hEGF, the preferred related element in the protein secretion pathway is disulfide isomerase PDI1, i.e., the recombinant strain 530-1CpG418-TEF1-PDI1-GAL2t / COPT-TA57-hEGF (i.e., SICpPDI1).

[0198] Table 10 Average production of extracellular hEGF in free fermentation of recombinant strains with single overexpression of protein secretion pathway related elements

[0199] Serial number Recombinant strains Average hEGF production (mg / L) 1 SICpERV29 (i.e. Figure 6 b) 109.02 2 SICpDER1 (i.e. Figure 6 b) 105.55 3 SICpERO1 (i.e. Figure 6 pERO1 in b) 110.32 4 SICpSEC24 (i.e. Figure 6 b) 105.32 5 SICpSRP54 (i.e. Figure 6 b) 115.77 6 SICpPDI1 (i.e. Figure 6 b) 120.85 7 SICpKAR2 (i.e. Figure 6 b) 116.23 8 SICpHAC1 (i.e. Figure 6 pHAC1) 115.84

[0200] 3.3.2 Improving hEGF production based on integration of overexpression-related genes

[0201] According to the results of 3.3.1, taking the yield of hEGF as the standard, it is preferred to integrate the overexpression-related elements PDI1, KAR2 and HAC1 with higher yield into the genome for overexpression, and the specific operation process is as follows.

[0202] (1) The sgRNA sequences of PDI1, KAR2 and HAC1 are shown in Table 11:

[0203] Table 11 sgRNA sequences of PDI1, KAR2 and HAC1

[0204] Integration of genes Gene Loci sgRNA sequence PDI1 1309a ATTCCGGAAGTGCTTGACAT KAR2 911b GTAATATTGTCTTGTTTCCC HAC1 208a GTCCGCTAAACAAAAGATCT

[0205] (2) Construction of CRISPR plasmid for gene integration: The original plasmid pCas9-Hyg-ccdB was degraded with the fast-cutting enzyme Bsa I, and the company's synthesized primers sgRNA-1309a-F, sgRNA-1309a-R; sgRNA-911b-F, sgRNA-911b-R; sgRNA-208a-F and sgRNA-208a-R were used to synthesize sgRNA-1309a, sgRNA-911b and sgRNA-208a at 94°C, according to 1 μL of upstream and downstream primers, 7 μL of ddH2O and 1 μL of T4 buffer at 94°C for 5 min. The linearized plasmid pCas9-Hyg-ccdB backbone was connected to gRNA-1309a, sgRNA-911b, and sgRNA-208a using T4 ligase, and then transformed into E. coli Top 10 competent cells. After ampicillin plate screening and sequencing verification, pCas9-Hyg-1309a, pCas9-Hyg-911b, and pCas9-Hyg-208a recombinant plasmids were obtained for subsequent gene integration.

[0206] (3) Construction of donor DNA: 1000 bp fragments upstream and downstream of the integration sites of the PDI1, KAR2 and HAC1 genes were selected as the upstream and downstream homology arms, and PCR amplification was performed using corresponding primers. The upstream and downstream homology arms were spliced ​​together using Overlap PCR to form donor DNA for subsequent gene integration.

[0207] (4) Transformation: Using the recombinant strain 530-1C / CPOT-TA57-hEGF as the host, refer to the transformation process of step (4) of step 2.3 of Example 2.

[0208] (5) Strain identification: The same as step (5) of step 2.3 of Example 2 was performed to finally obtain the recombinant strain (Table 11).

[0209] Serial number Strain abbreviation Recombinant strains 1 SIC-1309a-PDI1 530-1C-1309a-PDI1 COPT-TA57-hEGF 2 SIC-911b-KAR2 530-1C-911b-KAR2 COPT-TA57-hEGF 3 SIC-208a-HAC1 530-1C-208a-HAC1 COPT-TA57-hEGF

[0210] (6) CRISPR plasmid elimination: refer to step (6) of step 2.3 of Example 2.

[0211] (7) Strain culture: Pick a single colony in a sterile clean bench and transfer it to 5 mL of liquid YPD medium and culture it at 30°C and 220 rpm for 20 h. Then transfer the culture solution to 50 mL of liquid YPD medium and culture it at 30°C and 220 rpm for 72 h.

[0212] Based on the production of hEGF (Table 12), the recombinant strain 530-1C-1309a-PDI1 COPT-TA57-hEGF (SIC-1309a-PDI1) was preferred.

[0213] Table 12 Average production of extracellular hEGF in free fermentation based on recombinant strains with integrated overexpression-related genes

[0214] Serial number Recombinant strains Average hEGF production (mg / L) 1 SIC-1309a-PDI1 (i.e. Figure 6 b1309a-PDI1) 141.32 2 SIC-911b-KAR2 (i.e. Figure 6 b911b-KAR2) 109.95 3 SIC-208a-HAC1 (i.e. Figure 6 b208a-HAC1) 127.47

[0215] at the same time, Figure 6 b shows the effects of plasmid overexpression and genome integration overexpression strains on hEGF production, OD 600 The figure shows that genome-integrated overexpression is significantly better than plasmid-based overexpression.

[0216] 3.4 hEGF production by combined protease deletion and overexpression of chaperone-related genes

[0217] (1) The overexpression plasmids pG418-TEF1-PDI1-GAL2, pG418-TEF1-KAR2-GAL2, pG418-TEF1-HAC1-GAL2, pG418-TEF1-ERV29-GAL2 and pG418-TEF1-ERO1-GAL2 in the preferred embodiment 3.3.1 that are effective in increasing the hEGF production.

[0218] (2) Transformation: The protease-deficient recombinant strains SICΔPEP4, SICΔPRB1, SICΔPEP4ΔPRB1 and the integrated overexpression strains SIC-1309a-PDI1, SIC-911b-KAR2, SIC-208a-HAC1 were used as chassis strains, and the transformation process was performed in step (4) of step 2.3 of Example 2. The recombinant strain 530-1C / CPOT-TA57-hEGF was used as a control.

[0219] (3) Strain identification: The same as step (5) of step 2.3 of Example 2 was performed to finally obtain the recombinant strain (Table 13).

[0220] (4) Strain culture: Pick a single colony in a sterile clean bench and transfer it to 5 mL of liquid YPD medium and culture it at 30°C and 220 rpm for 20 h. Then transfer the culture solution to 50 mL of liquid YPD medium and culture it at 30°C and 220 rpm for 72 h.

[0221] Table 13 Average production of extracellular hEGF in free fermentation by combination of protease deletion and overexpression of chaperone-related genes

[0222]

[0223]

[0224] The results are shown in Table 13 and Figure 7 As shown in the figure, after combined optimization, it was found that except for strain SICΔPRB1 pERO1, which increased by 21.3% compared with the control strain, the hEGF production of other strains decreased compared with the control strain. However, the production of strain SICΔPRB1pERO1 was still 50.2% lower than that of the single-regulated strain SIC-1309a-PDI1 (141.1 mg / L). In addition, as can be seen from the figure, OD 600 This result proves that the current combined operation cannot effectively increase the hEGF production.

[0225] Example 4: Construction and characterization of biofilm high hEGF producing strain

[0226] Biofilm modification was performed on the basis of the recombinant strains BY4742ΔPEP4ΔPRB1pG418-TPI1-KAR2-TDH3-TA57-hEGF-GAL2t and SIC-1309a-PDI1, which are respectively preferred in Examples 2 and 3 for high hEGF production, and the biofilm encoding genes ALS3 and FLO11, which are derived from the endogenous flocculant proteins of Candida albicans and Saccharomyces cerevisiae, were integrated into the genome. The amino acid sequences of the flocculant protein genes ALS3 and FLO11 are shown in SEQ ID NO.37 and SEQ ID NO.39, respectively, and the corresponding nucleotide sequences are shown in SEQ ID NO.38 and SEQ ID NO.40, respectively.

[0227] (1) Construction of an integrated CRISPR plasmid for FLO11 insertion into the 1622b site: The original plasmid pCas9-Hyg-ccdB was degraded using the fast-cutting enzyme Bsa I, and sgRNA-1622b was synthesized using the company's synthesized primers sgRNA-1622b-F and sgRNA-1622b-R at 94°C for 5 min. The linearized plasmid pCas9-Hyg-ccdB backbone and sgRNA-1622b were connected using T4 ligase and then transformed into E. coli Top 10 competent cells. After ampicillin plate screening and sequencing verification, the pCas9-Hyg-1622b recombinant plasmid was obtained for subsequent gene integration.

[0228] (2) Construction of an integrated CRISPR plasmid for ALS3 insertion at the 106a site: The original plasmid pCas9-Hyg-ccdB was degraded using the fast-cutting enzyme Bsa I, and sgRNA-106a was synthesized using the company's synthesized primers sgRNA-106a-F and sgRNA-106a-R at 94°C for 5 min. The linearized plasmid pCas9-Hyg-ccdB backbone and sgRNA-106a were connected using T4 ligase and then transformed into E. coli Top 10 competent cells. After ampicillin plate screening and sequencing verification, the pCas9-Hyg-106a recombinant plasmid was obtained for subsequent gene integration.

[0229] (3) Construction of donor DNA: 1000 bp fragments upstream and downstream of the FLO11 and ALS3 gene integration sites were selected as the upstream and downstream homology arms, respectively. The upstream and downstream homology arms and the target gene expression frame were amplified by PCR using corresponding primers. Overlap PCR was used to splice the upstream and downstream homology arms and the target gene expression frame to form donor DNA for subsequent gene integration.

[0230] (4) Transformation: The recombinant strains BY4742ΔPEP4ΔPRB1 pG418-TPI1-KAR2-TDH3-TA57-hEGF-GAL2t and SIC-1309a-PDI1 with high hEGF production in Examples 2 and 3 were used as hosts, respectively, and the transformation process was carried out in step (4) of step 2.3 of Example 2.

[0231] (5) Strain identification: The same as step (5) of step 2.3 of Example 2. The recombinant strains SIC ALS3-1309a-PDI1, SIC FLO11-1309a-PDI1, BY4742 ALS3ΔPEP4ΔPRB1pKAR2, and BY4742 FLO11ΔPEP4ΔPRB1pKAR2 were obtained.

[0232] (6) CRISPR plasmid elimination: refer to step (6) of step 2.3 of Example 2.

[0233] (7) Standard plate washing analysis: After the obtained colonies of the four recombinant strains were cultured on a plate for 3 days, 1 mL of PBS was added to the plate and the plate was washed at 50 rpm for 5 minutes. The images before and after washing were compared.

[0234] The results are as follows Figure 8a and 8b show that regardless of whether the recombinant strain BY4742ΔPEP4ΔPRB1 pG418-TPI1-KAR2-TDH3-TA57-hEGF-GAL2t or SIC-1309a-PDI1 was transformed, the strain expressing FLO11 adhered to the agar plate, the strain expressing ALS3 had residues on the agar plate, and the WT strain was washed clean on the agar plate.

[0235] (8) Scanning electron microscopy (SEM) analysis: Taking the recombinant strains BY4742 ALS3ΔPEP4ΔPRB1pKAR2 and BY4742 FLO11ΔPEP4ΔPRB1pKAR2 as examples, the biofilm cells of the strains were harvested after 18 h of immobilization fermentation using cotton fibers as carriers. The cotton fibers were washed twice with PBS buffer and stored at 2-8°C for 24 h. The biofilm cells were then dried using a FreeZone 4.5L freeze drying system (Labconco, Kansas City, MO, USA) and sputter-coated with gold before imaging with a SEM (SEM 4800, Hitachi, Japan).

[0236] The results are as follows Fig. 9 a and 9b show that the recombinant strains overexpressing FLO11 or ALS3 were attached to the cotton fiber carrier.

[0237] Example 5: Effect of film-forming genes on strains

[0238] (1) Comparison of the free fermentation capabilities of FLO11 and ALS3 in shake flasks: The verified positive clones were picked and inoculated into 5 mL of YPD medium and cultured for 18 to 24 h. At an initial OD value of 0.1 to 0.2, they were inoculated into 50 mL of YPD medium and cultured for 72 h at 30°C and a shaker speed of 220 rpm.

[0239] The results showed that: 600 There was no significant difference in pH and hEGF production, which proved that FLO11 and ALS3 had no effect on the expression of hEGF in the two preferred recombinant strains. Fig.10 a and 10b.

[0240] (2) Comparison of the immobilized fermentation capabilities of FLO11 and ALS3 in shake flasks: The verified positive clones were picked and spotted into 5 mL of YPD medium and cultured for 18 to 24 h. Then, at an initial OD value of 0.1 to 0.2, they were inoculated into 50 mL of YPD medium (containing 2.25 ± 0.2 g of cotton fiber carrier) and cultured at 30 °C with a shaker speed of 220 rpm for 72 h.

[0241] The results showed that the ability of ALS3 film-forming strain BY4742 ALS3ΔPEP4ΔPRB1pKAR2 to express hEGF (62.81 mg / L) was greater than that of FLO11 film-forming strain BY4742 FLO11ΔPEP4ΔPRB1pKAR2 (49.33 mg / L). The ability of ALS3 film-forming strain SIC ALS3-1309a-PDI1 to express hEGF was greater than that of FLO11 film-forming strain SIC FLO11-1309a-PDI1. Fig.11 a and 11b.

[0242] Summary: After biofilm characterization and hEGF production comparison, ALS3 gene was selected as the biofilm-forming gene for subsequent immobilized continuous fermentation.

[0243] Example 6: Process exploration based on biofilm immobilization continuous fermentation model

[0244] 6.1 Taking the non-film-forming strain 530-1C / CPOT-TA57-hEGF as an example (abbreviated as SIC in the figure), the changes in process parameters in the fermenter containing the carrier were explored

[0245] In establishing a continuous fermentation model based on biofilm immobilization, the state of the non-film-forming strain used as a control in a bioreactor containing a carrier should be determined first to provide a basic reference for the subsequent fermentation model.

[0246] (1) Seed culture: The strain SIC preserved in glycerol at -80℃ was streaked onto a plate culture medium (formula: tryptone 10g / L, yeast extract 10g / L, glucose 20g / L, agar powder 18g / L), and activated and cultured in an incubator at 30℃ for 18-24h to obtain activated bacteria. Fresh, well-growing activated bacteria were selected and inoculated into test tubes containing seed culture medium for culture at 30℃ and a shaking speed of 220r / min for 18-24h to obtain a first-level seed solution; then, the first-level seed solution was transferred to a 250mL Erlenmeyer flask containing 50mL seed culture medium at an inoculation volume of 1% v / v, and the culture temperature was 30℃ and a shaking speed of 220r / min for 18-24h to obtain a second-level seed solution.

[0247] Wherein, the seed culture medium has a formula of: 20 g / L tryptone, 10 g / L yeast extract, and 20 g / L glucose.

[0248] (2) Fermentation culture: The secondary seed liquid obtained in step (1) was inoculated into a 1 L fermentation tank containing fermentation medium YPD at an inoculation amount of 10% v / v, with a liquid volume of 0.7 L, and 5.0±2.5 g of cotton fiber carrier was fixed in the fermentation tank. Fermentation was carried out for 168 h at a culture temperature of 30° C., an initial stirring speed of 500 rpm / min, and an aeration rate of 1 to 3 vvm.

[0249] The results are as follows Fig.12 As shown, the pH fluctuates, initially decreasing and then increasing. This change in pH may be related to the sugar decomposition process of the yeast, resulting in the production of hydrogen ions causing a decrease in pH. As lactic acid and ethanol are produced during fermentation, the solution becomes more acidic. Once the nutrients are exhausted, the strain's proteases become active, increasing the amino nitrogen level in the culture broth and subsequently increasing the pH. This shift eventually triggers cell autolysis and stops metabolic activity.

[0250] OD 600 This indicates that there are three different stages in the fermentation process. In the first stage, the OD 600 In the second stage, due to the action of the stirring paddle, the strain adheres to the carrier, resulting in OD 600 In the third stage, when the strain dosage on the carrier reaches the maximum capacity, the strain begins to separate and return to the culture medium, resulting in OD 600 Increase. OD 600 The changes in the dissolved oxygen (DO) and OD values ​​of the biofilm strains revealed the importance of biofilm-forming genes, and the attachment ability of the biofilm strains provided potential for continuous immobilized fermentation. 600 The changes in pH showed opposite trends, which was closely related to the strain population in the culture medium. hEGF is sensitive to pH and shows optimal production at pH 6.0 to 6.53. However, during the culture process, yeast cells undergo processes such as cell autolysis and self-metabolism, resulting in significant fluctuations in pH. These changes may lead to the hydrolysis of hEGF, ultimately reducing its production.

[0251] The above-mentioned changes in various parameters of non-film-forming strains in the fermenter provide a basic reference for the development of biofilm strains in immobilized continuous fermentation models.

[0252] 6.2 Study on the timing of liquid replacement in continuous fermentation based on biofilm immobilization

[0253] The expression cassettes of the biofilm-forming genes ALS3 and FLO11 were respectively integrated into the 106a and 1622b sites using the CRISPR / Cas9 system. The specific integration process is detailed in Example 4.

[0254] In order to achieve the goal of long-term continuous fermentation, the performance of the strain itself becomes the key. Changing the liquid too early can easily lead to insufficient biomass. As the fermentation batches increase, the bacterial amount may gradually decrease, which in turn leads to a decrease in hEGF production and failure to achieve stable and continuous expression; while changing the liquid too late, although the accumulation of higher biomass is achieved, the cell activity may decrease as the fermentation batches increase, and thus failure to achieve stable and continuous expression of hEGF.

[0255] Select 36h, 48h, 72h, 94h, and 120h as the fermentation endpoints and detect OD in the shake flask. 600 , pH, hEGF production and live and dead cells were used as detection indicators to evaluate the effect of fermentation time on the fermentation process.

[0256] The experimental settings are as follows:

[0257]

[0258]

[0259] (1) Strain fermentation culture: Same as Example 6.1.

[0260] (2) Extraction method of fixed fermentation stationary phase cells: After fermentation, the cotton fiber carrier carrying the strain was washed in 200 mL of PBS to remove all the cells from the carrier and detect the OD 600 and cell death and life.

[0261] (3) PI staining steps: Take 300 μL of bacterial sample, centrifuge, discard the supernatant, resuspend the bacterial sludge with PBS, centrifuge at 6000 rpm for 2 min, discard the supernatant, repeat this process once, and finally resuspend the bacterial sludge with PBS. Mix the prepared PI staining solution with 300 μL of washed bacterial sample, incubate at room temperature in the dark for 30 min, and observe under a microscope after completion.

[0262] The experimental results show:

[0263] pH: The pH change was not stable under the four conditions, fluctuating between 4.5 and 5.8. During the period from 36h to 48h, the pH of the immobilized fermentation showed a downward trend, while that of the free fermentation increased, which was directly related to the cell's consumption of sugar and acid production, reflecting that the utilization rate of the medium in the immobilized fermentation process was lower than that in the free fermentation ( Fig.13 a).

[0264] OD 600 :Free fermentation conforms to the growth curve; OD of SIC-ALS3 strain during immobilized fermentation 600 It shows a trend of first rising, then falling, and then rising again. This phenomenon may be directly related to the self-adsorption cycle of biofilm strains ( Fig.13 b).

[0265] hEGF production: The production of free fermentation is 2 / 3 higher than that of immobilized fermentation on average. The reason why the difference between ALS3 and FLO11 strains in the immobilized fermentation process is not large may be related to pH ( Fig.13 c).

[0266] Dead and live cell detection: In the five groups of strain staining experiments with different fluid replacement times, the proportion of dead cells began to increase at 72h ( Fig.14 a) OD at 48h 600 This is consistent with the following time points, indicating that biomass accumulation is complete. However, at 36h and 48h, the proportion of dead cells is very small ( Fig.14 b).

[0267] Conclusion: 48 h was selected as the single fermentation batch time.

[0268] 6.2.2 Evaluation of cell activity of strain SIC-ALS3 in a single batch fermentation (48h).

[0269] (1) Strain fermentation culture: Same as Example 1

[0270] (2) Methylene blue staining step: Take 300 μL of SIC-ALS3 bacterial sample, centrifuge, discard the supernatant, resuspend the bacterial sludge with PBS, centrifuge at 6000 rpm for 2 min, discard the supernatant, repeat this process once, and finally resuspend the bacterial sludge with PBS. Dilute the methylene blue staining solution to 1× with ddH2O, take 300 μL of methylene blue staining and mix with 300 μL of washed bacterial sample, incubate at 30°C in the dark for 30 min, and observe under a microscope after completion.

[0271] Result: OD 600 The pH fluctuated between 15 and 25; the pH was maintained at around 6.5 in the third batch and close to 8.0 in the fourth to tenth batches. The number of cell deaths in the figure was small, and the live and dead cell situation was relatively stable during the batch fermentation process ( Fig.15 ).

[0272] Conclusion: The 48h liquid replacement timing is sufficient for stable long-term, multi-batch fermentation.

[0273] 6.2.3 Identification of live and dead status of a single batch of cells in a fermenter (PI staining).

[0274] In order to determine the changes in cell activity during the 48-h fermentation process, PI staining was used, and samples were taken for testing at 8h, 15h, 21h, 33h, 39h, 45h, and 48h.

[0275] (1) PI staining: Same as step (3) in 6.2.1.

[0276] Results: The number of cell deaths in the SIC-ALS3 immobilization group and the free fermentation group was relatively small in each period ( Fig.16 ).

[0277] Conclusion: In a single batch fermentation, cell activity did not decay.

[0278] 6.3 Study on the immobilized fermentation of SIC-ALS3 strain in different culture media

[0279] In order to increase the expression yield of hEGF, 4 different culture media were selected for fermentation in a single batch.

[0280] (1) Strain fermentation culture: Same as Example 6.1.

[0281] (2) Culture medium: YPD medium: 20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose; YPDB medium: 20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose, 1 g / L BSA (bovine serum albumin); PDMU medium: 20 g / L peptone, 20 g / L glucose, 80 mL / L molasses, 0.5 g / L urea, 0.5 g / L KH2PO4; SC medium: 10×AA solution, 10×YNB solution, 20 g / L glucose.

[0282] Results: hEGF production: YPDB>YPD>PDMU>SC; OD 600 : PDMU>YPDB / YPD>SC. The OD value of PDMU medium is higher, and it has the potential for high-density fermentation in the later stage, but the yield of hEGF is lower. YPD medium can be selected, and BSA can be used as a component in the feed medium. ( Fig.17 ).

[0283] 6.4 Batch fermentation study with different sugar concentrations

[0284] Glucose, as the carbon source of the strain, has a very significant impact on the production of hEGF, so the glucose concentration was optimized. According to literature reports, high concentrations of sugar >60% (w / v) cannot be effectively utilized because the limitation of dissolved O2 leads to the Crabtree effect and produces toxic byproducts, namely ethanol and / or acetate, which inhibit cell growth. Therefore, 30g / L, 40g / L, and 50g / L were selected as glucose concentrations.

[0285] (1) Fermentation culture of SIC-ALS3 strain: Same as Example 6.1.

[0286] (2) Culture medium: YPD30 medium: 20 g / L peptone, 10 g / L yeast extract, 30 g / L glucose; YPD40 medium: 20 g / L peptone, 10 g / L yeast extract, 40 g / L glucose; YPD50 medium: 20 g / L peptone, 10 g / L yeast extract, 50 g / L glucose.

[0287] Results: OD and hEGF production gradually increased with the increase of sugar concentration. The average level of 30g / L glucose was 120mg / L; the average level of 40g / L glucose was 170mg / L, and the average level of 50g / L glucose was 220mg / L. Fig.18 ).

[0288] Conclusion: 50g / L glucose is conducive to the production of hEGF.

[0289] 6.5 Effect of feed addition on fermentation results during single batch fermentation.

[0290] According to the results of 6.4, adding a certain concentration of glucose during the fermentation process significantly increased the hEGF production. Therefore, two modes were selected for investigation in a single batch fermentation process, namely: immobilized fermentation + feeding (when the fermentation reaches 14-18 hours, the feed culture medium is added to ensure that the sugar concentration is around 1-3 g / L); immobilized fermentation + no feeding.

[0291] (1) Fermentation culture of SIC-ALS3 strain: Same as Example 6.1.

[0292] Result: OD 600 : Both modes are basically around 30; DO is maintained at 20-30% during fermentation, and pH is maintained at 6.35±0.2; in fed-batch fermentation, the overall sugar concentration is around 5g / L. hEGF production: fed > no fed ( Fig.19 ).

[0293] Conclusion: The feeding method in single batch fermentation mode is indeed helpful to the improvement of hEGF.

[0294] 6.6 Study on the fermentation process of strain SIC-ALS3 using pH-STAT strategy

[0295] Adopting appropriate feeding methods to maintain a low glucose concentration in the culture medium is a simple and effective method to reduce acetic acid production by process means. When glucose is exhausted, the cell's demand for oxygen decreases, causing an increase in dissolved oxygen in the culture medium; at this time, the cell decomposes substances in the body to produce ammonium ions, causing an increase in the pH of the culture medium; indicating the start and stop of glucose feeding according to the changes in these parameter values ​​is a reasonable feedback feeding strategy in high-density fermentation.

[0296] (1) Strain fermentation culture: Same as Example 6.1.

[0297] (2) Fermentation culture: The secondary seed solution obtained in step (1) was inoculated into a 1L fermentation tank containing a fermentation medium at an inoculum volume of 10% v / v, with a liquid volume of 0.7L, a culture temperature of 30°C, an initial stirring speed of 500 rpm / min, and an aeration rate of 1 to 3 vvm until the fermentation was completed for 48 hours, during which feed medium 1 was added to maintain a pH of 6.35. The formula of feed medium 1 is: 20 g / L peptone, 10 g / L yeast extract, and 100 g / L glucose.

[0298] Results: In the 7 batches of fermentation, the hEGF production in the first 3 batches was maintained at a high level, about 380 mg / L, but in the subsequent batches, the hEGF production gradually decreased. This trend indicates that hEGF cannot be continuously produced in the pH-STAT strategy fermentation ( Fig. 20 ).

[0299] 6.7 Study on the fermentation process of strain SIC-ALS3 using DO-STAT strategy

[0300] The feed rate is controlled by monitoring and adjusting the concentration of dissolved oxygen (DO) to achieve high-density cell growth. According to the search results, the DO-STAT strategy can be combined with other feeding strategies to achieve better fermentation results.

[0301] (1) Strain fermentation culture: Same as Example 6.1.

[0302] (2) Fermentation culture: The secondary seed solution obtained in step (1) was inoculated into a 1L fermentation tank containing a fermentation medium at an inoculation volume of 10% (v / v), with a liquid volume of 0.7L, a culture temperature of 30°C, an initial stirring speed of 500rpm / min, an aeration rate of 1-3vvm, until the fermentation was completed for 48h, and 1M hydrochloric acid and 1M ammonia water were used to maintain the pH at 6.35. During this period, when the dissolved oxygen was lower than 20%, the dissolved oxygen was adjusted to within the range of 20-30%, and feed medium 2 was added. The formula of feed medium 2 was: peptone 20g / L, yeast extract 10g / L, glucose 100g / L, KH2PO4 5g / L, MgSO4 5g / L, CaCl2 2g / L, BSA 1g / L, defoamer 1-2mL / L.

[0303] Results: During the five batches of fermentation, the hEGF production was at the level of 250 mg / L, and the production was stable ( Fig.21 ).

[0304] Conclusion: DO-STAT fermentation strategy can be used for the production of hEGF.

[0305] 6.8 Study on single batch DO-STAT fermentation process of different expression strains

[0306] According to the experimental method of 6.7, SIC-ALS3 and SIC-ALS3-208a-HAC1 (i.e. Fig. 22 SIC-ALS3-HAC1), SIC-ALS3-911b-KAR2 (i.e. Fig. 22 SIC-ALS3-KAR2) and SIC ALS3-1309a-PDI1 (i.e. Fig. 22 The strain SIC ALS3-PDI1) was used for single batch fermentation to compare the hEGF yield, and the strain was selected for multiple batch fermentation to verify the ability of immobilized continuous fermentation based on biofilm.

[0307] Results: The hEGF production capacity of the SIC ALS3-1309a-PDI1 strain was the highest, with an OD of about 40. The hEGF production was: SIC ALS3-1309a-PDI1 (330 mg / L) > SIC-ALS3-208a-HAC1 (270 mg / L) > SIC-ALS3 (200 mg / L) > SIC-ALS3-911b-KAR2 (170 mg / L) ( Fig. 22 ).

[0308] Conclusion: The SIC ALS3-1309a-PDI1 strain was selected to verify the biofilm-based immobilized continuous fermentation capability.

[0309] Example 7: Fed-batch fermentation and immobilized continuous fermentation of SIC ALS3-1309a-PDI1 and BY4742 ALS3ΔPEP4ΔPRB1pKAR2 in 1 L parallel bioreactors

[0310] (1) Seed culture: The strains SIC ALS3-1309a-PDI1 and BYALS3ΔPEP4ΔPRB1pKAR2 stored in glycerol at -80°C were streaked onto a plate culture medium (formula: 10 g / L tryptone, 10 g / L yeast extract, 20 g / L glucose, 18 g / L agar powder), and activated and cultured in an incubator at 30°C for 18 to 24 hours to obtain activated bacteria. Fresh, well-growing activated bacteria were selected and inoculated into test tubes containing seed culture medium for culture at a temperature of 30°C and a shaking speed of 220 r / min for 18 to 24 hours to obtain a first-level seed solution; thereafter, the first-level seed solution was transferred to a 250 mL Erlenmeyer flask containing 50 mL seed culture medium at an inoculation rate of 1% v / v, and the culture temperature was 30°C and a shaking speed of 220 r / min for 18 to 24 hours to obtain a second-level seed solution.

[0311] Wherein, the seed culture medium has a formula of: 20 g / L tryptone, 10 g / L yeast extract, and 20 g / L glucose.

[0312] (2) Fed-batch fermentation culture: The secondary seed solution obtained in step (1) was inoculated into a 1L fermentation tank containing a fermentation medium at an inoculum volume of 10% v / v, with a liquid volume of 0.5L, a culture temperature of 30°C, an initial stirring speed of 500rpm / min, an aeration rate of 1-3vvm, and a dissolved oxygen value of 25±5% and a pH of 6.35±0.15. After 18h of fermentation, feed medium was added at a rate of 10mL / h, during which the glucose concentration was maintained at 0.5-3g / L until the fermentation was completed at 144h. Samples were taken in the middle to measure the cell growth.

[0313] The fermentation medium formula is as follows: 50 g / L glucose, 10 g / L yeast extract, 20 g / L trypsin, and the solvent is deionized water.

[0314] Among them, the feed medium formula is as follows: yeast extract 10g / L, trypsin 20g / L, glucose 100g / L, KH2PO4 5g / L, MgSO4 5g / L, CaCl2 2g / L, BSA 1g / L, defoaming agent 1-2mL / L.

[0315] The experimental results showed that when the BYALS3ΔPEP4ΔPRB1pKAR2 strain OD 600 Nearly 75,144 hours later, the hEGF production reached about 230 mg / L, with a production efficiency of 1.62 mg / L / h. When the OD of SIC ALS3-1309a-PDI1 strain was 600 Close to 100, after 144 hours, the hEGF production reached about 650 mg / L, and the production efficiency was 4.51 mg / L / h. Fig.23 a and 23b.

[0316] (3) Based on biofilm immobilization continuous fermentation culture:

[0317] The secondary seed liquid obtained in step (1) was inoculated into a 1L fermentation tank containing a fermentation medium at an inoculation volume of 10% v / v. In the fermentation tank, 20-40 g / L of cotton fiber was sewn inside the fermentation tank as a carrier for cell attachment. The liquid volume was 0.5 L, the culture temperature was 30 ° C, the initial stirring speed was 500 rpm / min, and the dissolved oxygen value was maintained at 25 ± 5%. After 18 hours of fermentation, the feed medium was added, and the glucose concentration was maintained at 0.5-3 g / L during the fermentation until the end of fermentation. The cell growth was measured by sampling in the middle. After batch fermentation for about 48 hours, 20%-80% v / v of the fermentation liquid was discharged, and the fermentation tank control system was used to control the peristaltic pump to add an equal amount of fresh feed medium solution and pump it into the fermentation tank. The BYALS3ΔPEP4ΔPRB1pKAR2 strain repeated the above fermentation process for 5 batches, and the SIC ALS3-1309a-PDI1 strain repeated the above fermentation process for 10 batches.

[0318] The experimental results showed that when the BYALS3ΔPEP4ΔPRB1pKAR2 strain OD 600 Close to 55, after 48 hours, the hEGF production reached about 130 mg / L, and the production efficiency of each batch of hEGF in immobilized fermentation was 2.71 mg / L / h, exceeding the 1.62 mg / L / h of free fermentation; when the OD of SIC ALS3-1309a-PDI1 strain was 600 Nearly 50, 48 hours later, the hEGF production reached about 300 mg / L, and the production efficiency of each batch of hEGF in the immobilized fermentation was about 6.25 mg / L / h, exceeding the 4.51 mg / L / h of the free fermentation. Fig.24 a and 24b.

[0319] The above results indicate that the present invention successfully constructed an expression system for high-yield hEGF of Saccharomyces cerevisiae through genetic modification and strain transformation, and then realized an immobilized continuous fermentation system by introducing the film-forming gene ALS3. The production rate of hEGF was significantly higher than that of the traditional free fermentation system.

[0320] The present invention provides a recombinant saccharomyces cerevisiae for producing human epidermal growth factor based on biofilm and its construction method and application ideas and methods. There are many methods and ways to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. A recombinant Saccharomyces cerevisiae producing human epidermal growth factor based on biofilm, characterized in that: The recombinant Saccharomyces cerevisiae is constructed by taking Saccharomyces cerevisiae as the starting strain, deleting the protease encoding gene and / or overexpressing the molecular chaperone gene and the biofilm-forming gene to mediate the expression of human epidermal growth factor hEGF.

2. A method for constructing a biofilm-based method for producing human epidermal growth factor, characterized in that: Using Saccharomyces cerevisiae as the starting strain, the expression of human epidermal growth factor hEGF is mediated by deleting protease encoding genes and / or overexpressing molecular chaperones and overexpressing biofilm-forming genes.

3. The recombinant Saccharomyces cerevisiae according to claim 1 or the construction method according to claim 2, characterized in that: Any one or a combination of a promoter, a fusion polypeptide chain and a signal peptide is introduced into the starting strain; preferably, a combination of a promoter and a signal peptide or a combination of a fusion polypeptide chain and a signal peptide is introduced into the starting strain.

4. The recombinant Saccharomyces cerevisiae or the construction method according to claim 3, characterized in that: The promoter is an inducible promoter or a constitutive promoter, wherein the inducible promoter is GAL1, and the constitutive promoter is any one of TEF1, TPI1, and TDH3; the fusion polypeptide chain is HL28; and the signal peptide is MFα or TA57.

5. The recombinant Saccharomyces cerevisiae or the construction method according to claim 4, characterized in that: The nucleotide sequence of the GAL1 is shown in SEQ ID NO.12; the nucleotide sequence of the TEF1 is shown in SEQ ID NO.9; the nucleotide sequence of the TPI1 is shown in SEQ ID NO.10; the nucleotide sequence of the TDH3 is shown in SEQ ID NO.11; the amino acid sequence of the HL28 is shown in SEQ ID NO.23, and the corresponding nucleotide sequence is shown in SEQ ID NO.24; the amino acid sequence of the MFα is shown in SEQ ID NO.3, and the corresponding nucleotide sequence is shown in SEQ ID NO.4; the amino acid sequence of the TA57 is shown in SEQ ID NO.7, and the corresponding nucleotide sequence is shown in SEQ ID NO.

8.

6. The recombinant Saccharomyces cerevisiae according to claim 1 or the construction method according to claim 2, characterized in that: The starting strain is Saccharomyces cerevisiae 530-1C, Saccharomyces cerevisiae 2-1C, Saccharomyces cerevisiae BY4741, Saccharomyces cerevisiae BY4742 or Saccharomyces cerevisiae W303-1A, preferably Saccharomyces cerevisiae BY4742 or Saccharomyces cerevisiae 530-1C.

7. The recombinant Saccharomyces cerevisiae according to claim 1 or the construction method according to claim 2, characterized in that: The protease encoding gene includes any one or a combination of PEP4, PRB1, YAP3, PRC1, and CMY1, preferably any one or a combination of PEP4, PRB1, and YAP3, and more preferably PEP4 and PRB1.

8. The recombinant Saccharomyces cerevisiae or method according to claim 7, characterized in that: The amino acid sequences of the protease encoding genes PEP4, PRB1, and YAP3 are shown in SEQ ID NO.13, SEQ ID NO.15, and SEQ ID NO.17, respectively, and the corresponding nucleotide sequences are shown in SEQ ID NO.14, SEQ ID NO.16, and SEQ ID NO.18, respectively.

9. The recombinant Saccharomyces cerevisiae according to claim 1 or the construction method according to claim 2, characterized in that: The molecular chaperone gene includes any one or a combination of KAR2, PDI1, HAC1, DER1, SEC24, SRP54, ERO1, and ERV29, preferably any one or a combination of PDI1, KAR2, and HAC1, and more preferably PDI1 or KAR2.

10. The recombinant Saccharomyces cerevisiae or the construction method according to claim 9, characterized in that: The amino acid sequences of KAR2 and PDI1 are shown in SEQ ID NO.19 and SEQ ID NO.21, respectively, and the corresponding nucleotide sequences are shown in SEQ ID NO.20 and SEQ ID NO.22, respectively; the amino acid sequences of HAC1, DER1, SEC24, SRP54, ERO1 and ERV29 genes are shown in SEQ ID NO.25, SEQ ID NO.27, SEQ ID NO.29, SEQ ID NO.31, SEQ ID NO.33 and SEQ ID NO.35, respectively, and the corresponding nucleotide sequences are shown in SEQ ID NO.26, SEQ ID NO.28, SEQ ID NO.30, SEQ ID NO.32, SEQ ID NO.34 and SEQ ID NO.36, respectively.

11. The recombinant Saccharomyces cerevisiae according to claim 1 or the construction method according to claim 2, characterized in that: The biofilm-forming gene includes any one of ALS3 and FLO11 or a combination of both, preferably ALS3 or FLO11, and more preferably ALS3.

12. The recombinant Saccharomyces cerevisiae or the construction method according to claim 11, characterized in that: The amino acid sequences of ALS3 and FLO11 are shown in SEQ ID NO.37 and SEQ ID NO.39 respectively, and the corresponding nucleotide sequences are shown in SEQ ID NO.38 and SEQ ID NO.40 respectively.

13. The recombinant Saccharomyces cerevisiae according to claim 1 or the construction method according to claim 2, characterized in that: The overexpression of the molecular chaperone is based on plasmid overexpression of the molecular chaperone or integration of the molecular chaperone into the genome of Saccharomyces cerevisiae for overexpression.

14. The recombinant Saccharomyces cerevisiae according to claim 1 or the construction method according to claim 2, characterized in that: The overexpression of the biofilm-forming gene is to integrate the biofilm-forming gene into the genome of Saccharomyces cerevisiae for overexpression.

15. Use of the recombinant Saccharomyces cerevisiae according to claim 1 in fermentation preparation of human epidermal growth factor.

16. The use according to claim 15, characterized in that The fermentation is free fermentation or immobilized fermentation; preferably, the free fermentation is fed-batch fermentation, and the immobilized fermentation is immobilized continuous fermentation.

17. The use according to claim 16, characterized in that In the immobilized continuous fermentation, the immobilized carrier is cotton fiber, and the content of cotton fiber is 2.5-60 g / L.

18. The use according to claim 16, characterized in that The fed-batch fermentation specifically involves inoculating the seed liquid into the fermentation medium, and when the fermentation is 18 to 24 hours, feeding the feed medium to maintain the glucose concentration at 0.5 to 3 g / L, and the total fermentation time is 120 to 144 hours; The fermentation conditions are as follows: temperature 28-32°C, initial stirring speed 500rpm, aeration rate 1-3vvm, maintaining dissolved oxygen value 20-30%, pH 6.0-6.

5.

19. The use according to claim 16, characterized in that: The immobilized continuous fermentation specifically involves inoculating seed liquid into a fermentation medium for fermentation, adding feed medium when the fermentation reaches 18 to 24 hours, maintaining a glucose concentration of 0.5 to 3 g / L, and ending the first batch of fermentation when the fermentation reaches 24 to 60 hours, discharging 20 to 100% v / v of the fermentation liquid, adding an equal amount of fresh feed medium, and repeating the operations of fermentation, adding feed medium, and discharging 20 to 100% v / v of the fermentation liquid. The fermentation conditions are as follows: temperature 28-32°C, initial stirring speed 500rpm, aeration rate 1-3vvm, maintaining dissolved oxygen value 20-30%, pH 6.0-6.

5.

20. The use according to claim 18 or 19, characterized in that The fermentation medium is composed of 30-50 g / L glucose, 8-10 g / L yeast extract, 15-20 g / L trypsin, and the solvent is deionized water; the feed medium is composed of 8-10 g / L yeast extract, 15-20 g / L trypsin, 60-100 g / L glucose, 2-5 g / L KH2PO4, 2-5 g / L MgSO4, 1-2 g / L CaCl2, 1-3 g / L BSA, and 1-2 mL / L defoaming agent.

Images