Lactobacillus halensis, nashi fruit enzyme and application thereof in insect repellent or insecticidal preparation

Abstract

The application discloses a Lactobacillus halensis, a grapefruit enzyme and application of the grapefruit enzyme in insect expelling or killing preparations, and belongs to the technical field of fermentation engineering. The grapefruit enzyme is mainly prepared from grapefruit, and is inoculated with Lactobacillus halensis EL07 and / or Kazachstania spencie EY02 and Farypichia fermentans EY01 for fermentation. The Lactobacillus halensis EL07 is preserved in the China Center for Type Culture Collection on July 6, 2023, and the preservation number is CCTCC M 20231206. The grapefruit enzyme prepared by the application has good insect expelling or killing effect on pests such as rice leaf roller in crop planting, and the insect expelling or killing rate reaches 94.0% or above. The application has good application prospect in promoting the wide planting of organic rice.

Description

Technical Field

[0001] This invention relates to the field of fermentation engineering technology, and in particular to a strain of Lactobacillus harbin, grapefruit enzyme, and their application in anthelmintic or insecticidal preparations. Background Technology

[0002] Pests and diseases are significant factors affecting rice growth and yield, including diseases caused by various organisms such as fungi, bacteria, viruses, and insects. Common pests and diseases include the rice leaf folder, aphids, and spider mites. Among these, the rice leaf folder is seasonal, generally causing severe infestations in the mid-to-late stages of rice growth. The larvae spin silk to curl rice leaves into a tube shape, feeding on the leaf tissue inside and hindering photosynthesis. Rice leaves damaged by the rice leaf folder are incomplete, photosynthetic efficiency is reduced, resulting in underdeveloped grains, decreased thousand-grain weight, and ultimately, lower yield and quality.

[0003] Currently, pest control methods include chemical control, physical control, and biological control. Biological control, which utilizes organisms or their metabolic products to control rice pests and diseases, offers numerous advantages such as environmental friendliness and sustainability. However, existing technologies primarily employ organic solvent extraction, which leaves organic solvent residues. The addition of various stabilizers, such as fatty alcohol polyoxyethylene ethers, also presents drawbacks including residues, high costs, and unmanageable waste.

[0004] Therefore, there is an urgent need to provide a method for pest control that does not require organic solvents, does not pollute the environment, has abundant raw materials, and is low in cost. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides a strain of *Lactobacillus harbinensis*, grapefruit enzyme, and their application in insect repellent or insecticide formulations. This invention employs a microbial fermentation method, using naturally sourced grapefruit as raw material, with the addition of molasses, water, garlic, and artemisia as auxiliary ingredients. It utilizes a novel, self-selected *Lactobacillus harbinensis* EL07 (preservation number CCTCC NO: M20231206) and / or *Saccharomyces cerevisiae* and *Hansenum falciparum* for fermentation to produce a highly effective liquid insect repellent / insecticide. Applying this fermented liquid insect repellent / insecticide enzyme to crop cultivation demonstrates excellent insect repellent / insecticide effects. This method utilizes the principle of mutual generation and restraint to cultivate organic crops effectively, promoting high-quality and high-yield crop production and management.

[0006] This invention is achieved through the following technical solution:

[0007] The first objective of this invention is to provide a Lactobacillus harbinensis EL07, which was deposited at the China Center for Type Culture Collection on July 6, 2023, with accession number CCTCC NO: M 20231206; the deposit address is Wuhan University.

[0008] The second objective of this invention is to provide a microbial preparation containing the aforementioned Lactobacillus hydantoin EL07.

[0009] A third objective of this invention is to provide the application of the *Lactobacillus hydantoin* EL07 or the microbial preparations described therein in the preparation of grapefruit enzymes.

[0010] The fourth objective of this invention is to provide a method for preparing grapefruit enzyme using the aforementioned *Lactobacillus hydantoin* EL07, comprising the following steps:

[0011] The grapefruit enzyme was obtained by inoculating a mixture of grapefruit and water with Lactobacillus hystericus EL07 to obtain grapefruit enzyme; the inoculation amount of Lactobacillus hystericus EL07 was 0.2%-20%.

[0012] And / or, using a mixture of grapefruit and water as raw material, inoculating it with Lactobacillus hydantoin EL07 and yeast for fermentation to obtain the grapefruit enzyme; the inoculation amounts of Lactobacillus hydantoin EL07 and yeast are 0.2%-20%, respectively.

[0013] In one embodiment of the present invention, the yeast is *Saccharomyces serrulata* EY02 or *Hanamizoa falpi* EY01.

[0014] And / or, the fermentation temperature is 5℃-38℃;

[0015] And / or, the fermentation is carried out by stirred fermentation, with a stirring speed of 10 rpm to 300 rpm;

[0016] And / or, the fermentation cycle is 7-20 days.

[0017] In one embodiment of the present invention, the pomelo is selected from one or more of the following: landscape pomelo, field pomelo, Wendan pomelo, Jinxiang pomelo, Dianjiang white pomelo, Jinlan pomelo, Pingshan pomelo, Changshan Hu pomelo, Four Seasons pomelo, Chuhong pomelo, and Guanxi honey pomelo.

[0018] In one embodiment of the present invention, the concentration of grapefruit in the raw material is 5wt%-60wt%.

[0019] In one embodiment of the present invention, the raw materials further include one or more of sucrose, brown sugar, glucose, molasses, garlic and mugwort; preferably molasses, garlic and mugwort.

[0020] In one embodiment of the present invention, the contents of molasses, water, garlic and mugwort are 2wt%-20wt%, 40wt%-80wt%, 1wt%-15wt%, and 0.5wt%-20wt%, respectively.

[0021] In one embodiment of the present invention, the garlic is selected from one or more of red-skinned garlic, white-skinned garlic, and purple-skinned garlic.

[0022] The fifth objective of this invention is to provide grapefruit enzyme prepared by the method described above.

[0023] The sixth objective of this invention is to provide the application of the grapefruit enzyme in the preparation of insect repellent or insecticide formulations for crops.

[0024] In one embodiment of the present invention, the insect is one or more of the following: rice leaf roller, aphid, and spider mite.

[0025] In one embodiment of the present invention, the method of repelling or killing insects is as follows: spray the fermented grapefruit enzyme onto the crops; spray once every 4 to 15 days, and the amount of spray per acre each time is 0.5 kg to 5.0 kg.

[0026] In one embodiment of the present invention, the *Lactobacillus harbinensis* EL07, *Saccharomyces serrulata* EY02, and *Hanamizoa falpi* EY01 are all lactic acid bacteria and yeasts obtained by screening soil samples.

[0027] The grapefruit enzyme of this invention, when applied to rice cultivation, has a good insecticidal / repellent effect on rice leaf rollers.

[0028] This invention utilizes *Lactobacillus harzianum* EL07, *Lactobacillus harzianum* EL07, and either *Saccharomyces serrulata* EY02 or *Hanamizoa falciparum* EY01 for fermentation. Simultaneously, the composition of the enzyme fermentation raw materials was optimized (e.g., adding different amounts of garlic for synergistic fermentation) to prepare grapefruit enzyme. Field experiments using rice cultivation further verified the application effect of the fermented enzyme in insecticidal and repellent applications.

[0029] The technical solution of the present invention has the following advantages compared with the prior art:

[0030] This invention provides a strain of *Lactobacillus harzianum*, a grapefruit enzyme, and its application in insect repellent or insecticide formulations. The method involves fermenting matured landscape grapefruit using a novel strain of *Lactobacillus harzianum* EL07 and *Saccharomyces serrulata* EY02, along with other auxiliary ingredients (molasses, water, garlic, and artemisia). The cultured liquid bacterial suspensions of *Lactobacillus harzianum* EL07 and *Hansenula faelii* EY01 are inoculated into the fermentation medium at an inoculation rate of 0.2%-20%. The grapefruit content is 10%-50%, and the contents of molasses, water, charcoal, and artemisia are 2%-20%, 40%-80%, 1%-15%, and 0.5%-20%, respectively. The fermentation temperature is 5℃-38℃. Stirred fermentation is employed at a stirring speed of 10rpm-300rpm. The fermentation cycle is 7-20 days. This fermented liquid insect repellent / killing enzyme, when applied to rice cultivation, exhibits good insect repellent / killing effects against the rice leaf roller.

[0031] Biological Preservation Information:

[0032] Lactobacillus harbinensis EL07 was deposited at the China Center for Type Culture Collection (CCTCC) on July 6, 2023, with accession number CCTCC NO: M 20231206, at Wuhan University; and classified as Lactobacillus harbinensis EL07.

[0033] Kazochstania cervazzii EY02 was deposited at the China Center for Type Culture Collection (CCTCC) on July 6, 2023, with accession number CCTCC NO: M 20231205, at Wuhan University; and classified as Kazochstania cervazzii EY02.

[0034] The Hanseniaspora valbyensis EY01 was deposited at the China Center for Type Culture Collection (CCTCC) on July 6, 2023, with accession number CCTCC NO: M 20231204, at Wuhan University; and classified as Hanseniaspora valbyensis EY01. Attached Figure Description

[0035] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein...

[0036] Figure 1 This is an electrophoresis image of the nucleic acid of Lactobacillus EL07 from Harbin in Example 1 of the present invention;

[0037] Figure 2 This illustrates the effect of different bacterial strains on the field application of liquid insecticidal / pesticide grapefruit enzyme fermentation production in Example 2 of the present invention.

[0038] Figure 3 This illustrates the effect of different carbon source feeds on the field application of liquid insecticidal / pesticide grapefruit enzyme fermentation production in Example 3 of the present invention.

[0039] Figure 4 This describes the effect of garlic supplementation on the field application of liquid insecticide / pesticide grapefruit enzyme fermentation production in Example 4 of the present invention.

[0040] Figure 5 This is a diagram showing the application effect of the liquid insecticidal grapefruit enzyme mixture (molasses + garlic + mugwort) in rice fields after spraying in Example 4 of the present invention. Detailed Implementation

[0041] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0042] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0043] Example 1: Screening and identification of Lactobacillus EL07 from Harbin.

[0044] Take 50g each of grapes, peaches, cowpeas, and chili peppers harvested from the farm, wash them with clean water, chop them, add 1200mL of purified water and 150g of molasses, place them in a water-sealed pickling jar for fermentation, control the temperature at 30℃, and ferment for 7 days. After sampling, use YPD solid medium (1% yeast extract, 2% peptone, 2% glucose, 2% agar powder) to screen for lactic acid bacteria. One strain of lactic acid bacteria was obtained. The genome of the lactic acid bacteria was extracted using the Bacteria Genomic DNA Kit (purchased from Kangwei Century, catalog number: CW0552) according to the instructions. Using the genome of lactic acid bacteria as a template, primers 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID No. 2) and 1492R: TACGGCTACCTTGTTACGACTT (SEQ ID No. 3) were used for PCR amplification with Ex-Taq enzyme. The PCR conditions were: 94℃ for 30s, 55℃ for 30s, and 72℃ for 1.4min, for 30 cycles, to obtain conserved sequence gene fragments. Figure 1The conserved sequences of the above-mentioned bacterial strain were sequenced to obtain the gene sequence (as shown in SEQ ID No. 1). The sequenced gene sequence was then compared with the NCBI database using BLAST, confirming that the selected lactic acid bacterium was *Lactobacillus harbinensis*, and named *Lactobacillus harbinensis* EL07. The highest similarity between *Lactobacillus harbinensis* EL07 and all conserved gene sequences of microorganisms in the NCBI database was 99% (compared to strain *Lactobacillus harbinensis* strain LH-1), fully demonstrating that the selected strain is a novel strain.

[0045] SEQ ID No. 1 is shown below:

[0046]

[0047] Example 2: Effects of different bacterial strains on the field application of liquid insecticidal / pesticide grapefruit enzyme fermentation production.

[0048] Lactobacillus harbinensis EL07 and Kazakhstania cervazzii EY02, obtained through screening, were inoculated into optimized MRS liquid medium (1% tryptone, 1% beef extract, 0.5% yeast extract, 2% glucose, 8% Tween, 0.2% K₂HPO₄, 0.5% sodium acetate, 0.2% citrate, 0.005% MgSO₄·4H₂O) and YPD liquid medium (1% yeast extract, 2% peptone, 2% glucose), respectively. For seed culture of Lactobacillus harbinensis EL07, 1000 mL of the solution was placed in a 5L Erlenmeyer flask and cultured at 200 rpm and 37℃ for 36 h. When culturing Kazakhstan yeast (Kazochstania cervazzii) EY02 seed culture, the liquid volume is 1000mL in a 5L Erlenmeyer flask, and the culture is carried out at 200rpm and 30℃ for 36h.

[0049] After crushing the landscape pomelo, it was mixed with other auxiliary ingredients (water) to obtain the fermentation medium. The following inoculation methods were used: 1) 1% of cultured *Lactobacillus harbinensis* EL07 was inoculated into the fermentation medium. 2) 1% of cultured *Lactobacillus plantarum* CICC20270 was inoculated into the fermentation medium. 3) 1% of cultured *Lactobacillus harbinensis* EL07 and *Kazakhstania cervazzii* EY02 seed cultures were each inoculated into the fermentation medium. 4) 1% of cultured *Lactobacillus harbinensis* EL07 and *Hanseniaspora valbyensis* EY01 seed cultures were each inoculated into the fermentation medium. 5) No exogenous microorganisms were inoculated; fermentation was carried out directly (control).

[0050] The mixture contains 20% pomelo and 80% water, fermented at 30℃. It is fermented using a stirring method at 50 rpm, with a fermentation period of 10 days. After fermentation, the liquid is filtered through a filter cloth and then centrifuged using a disc centrifuge until clear before use. The waste residue can be further composted and fermented for use as organic fertilizer. When spraying in farmland, the fermented enzymes do not need to be diluted with water. Using a drone, spray twice within 14 days (once every 7 days), with a dosage of 1.3 kg per acre of paddy field each time. Figure 2 As shown, the enzyme produced through natural fermentation without inoculation only achieved a 29% insect repellency / killing rate (for rice leaf roller). The enzyme produced by fermentation solely with *Lactobacillus harbinensis* EL07 showed a superior insect repellency / killing rate of 56%, compared to *Lactobacillus plantarum* CICC20270 (45%). Furthermore, the enzyme produced by fermentation using *Lactobacillus harbinensis* EL07 and *Saccharomyces cerevisiae* EY02 showed a superior insect repellency / killing rate of 66%, compared to *Lactobacillus harbinensis* EL07 and *Hanamizoa falciparum* EY01 (59%).

[0051] Example 3: Effects of different carbon source feeds on the field application of liquid insecticidal / pesticide grapefruit enzyme fermentation production.

[0052] Lactobacillus harbin EL07 and Saccharomyces serrulatae Kazakhstane EY02, obtained through screening, were inoculated into optimized MRS liquid medium (1% tryptone, 1% beef extract, 0.5% yeast extract, 2% glucose, 8% Tween, 0.2% K₂HPO₄, 0.5% sodium acetate, 0.2% citrate, 0.005% MgSO₄·4H₂O) and YPD liquid medium (1% yeast extract, 2% peptone, 2% glucose), respectively. For Lactobacillus harbin EL07 seed culture, the liquid volume was 1000 mL in a 5L Erlenmeyer flask, and cultured at 200 rpm and 37℃ for 36 h. For Saccharomyces serrulatae Kazakhstane EY02 seed culture, the liquid volume was 1000 mL in a 5L Erlenmeyer flask, and cultured at 200 rpm and 30℃ for 36 h.

[0053] After crushing the ornamental pomelo, it was mixed with 80% water (control group), 60% water + 15% molasses (molasses group), 60% water + 15% brown sugar (brown sugar group), 60% water + 15% sucrose (sucrose group), and 60% water + 15% glucose (glucose group). The cultured *Lactobacillus hystericus* EL07 and *Saccharomyces cerevisiae* EY02 seed cultures were inoculated into the fermentation medium at a rate of 0.5%. The fermentation temperature was 30℃; stirring fermentation was used at a speed of 50 rpm; and the fermentation period was 9 days. After fermentation, the broth was filtered through a filter cloth and then centrifuged using a disc centrifuge until clear before use. The waste residue was further composted and fermented for use as organic fertilizer. When spraying in farmland, the fermented enzymes do not need to be diluted with water.

[0054] Using drones, spray twice within 14 days (once every 7 days), with each application using 1.2 kg per acre of paddy field. Figure 3 As shown, the insect repellent / killing rates (for rice leaf roller) of the liquid grapefruit enzymes in the molasses, brown sugar, sucrose, and glucose groups were all higher than those of the enzyme without any carbon source supplementation (control group), with insect repellent / killing rates of 81%, 79%, 68%, and 72%, respectively. However, the insect repellent / killing rate of the enzyme without any carbon source supplementation was only 66%.

[0055] Example 4: Effects of different key component supplementation on the field application of liquid insecticidal / pesticide grapefruit enzyme fermentation production.

[0056] Lactobacillus harbin EL07 and Kazakhstania cervazzii EY02, obtained through screening, were inoculated into optimized MRS liquid medium (1% tryptone, 1% beef extract, 0.5% yeast extract, 2% glucose, 8% Tween, 0.2% K₂HPO₄, 0.5% sodium acetate, 0.2% citrate, 0.005% MgSO₄·4H₂O) and YPD liquid medium (1% yeast extract, 2% peptone, 2% glucose), respectively. For Lactobacillus harbin EL07 seed culture, the liquid volume was 1000 mL in a 5L Erlenmeyer flask, and the culture was carried out at 200 rpm and 37℃ for 36 h. For Kazakhstania cervazzii EY02 seed culture, the liquid volume was 1000 mL in a 5L Erlenmeyer flask, and the culture was carried out at 200 rpm and 30℃ for 36 h.

[0057] After crushing the ornamental pomelo, it was mixed with 65% water + 15% molasses (molasses group), 63% water + 15% molasses + 2% garlic (molasses + garlic group), and 61% water + 15% molasses + 2% garlic + 2% artemisia (molasses + garlic + artemisia group). The cultured *Lactobacillus hygroscopicus* EL07 and *Saccharomyces cerevisiae* EY02 seed cultures were inoculated into the fermentation medium at a rate of 0.5%. The fermentation temperature was 30℃; stirring fermentation was used at a speed of 50 rpm; and the fermentation period was 9 days. After fermentation, the liquid was filtered through a filter cloth and then centrifuged using a disc centrifuge until clear before use. The waste residue was further composted and fermented for use as organic fertilizer. When spraying in farmland, the fermented enzymes do not need to be diluted with water.

[0058] Using drones, spray twice within 14 days (once every 7 days), with each application using 1.2 kg per acre of paddy field. Figure 4 As shown, the insect repellent / killing rates (for rice leaf folder) of the liquid grapefruit enzyme in the molasses + garlic group and the molasses + garlic + mugwort group were higher than those in the molasses group, with repellent / killing rates of 88% and 94.0%, respectively. However, the insect repellent / killing rate of the enzyme in the molasses group was only 81%. Applying this fermented liquid insect repellent / killing enzyme to rice cultivation showed good insect repellent / killing effects against the rice leaf folder. Figure 5 ).

[0059] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A type of Lactobacillus harzianum ( Lactobacillus harbinensis EL07, characterized in that, The *Lactobacillus hydantoin* EL07 was deposited at the China Center for Type Culture Collection (CCTCC) on July 6, 2023, with accession number CCTCC NO: M20231206; the deposit address is Wuhan University.

2. A microbial preparation containing the Harbin Lactobacillus EL07 as described in claim 1.

3. The application of the Harbin Lactobacillus EL07 of claim 1 or the microbial preparation of claim 2 in the preparation of grapefruit enzyme.

4. A method for preparing grapefruit enzyme using *Lactobacillus hydantoin* EL07 as described in claim 1, characterized in that, Includes the following steps: A mixture of grapefruit and water was used as a raw material, and fermented with Lactobacillus hydantoin EL07 to obtain the grapefruit enzyme; the inoculum amount of Lactobacillus hydantoin EL07 was 0.2%-20%. And / or, using a mixture of grapefruit and water as raw material, inoculating it with Lactobacillus hydantoin EL07 and yeast for fermentation to obtain the grapefruit enzyme; the inoculation amounts of Lactobacillus hydantoin EL07 and yeast are 0.2%-20%, respectively; The yeast strain is either *Saccharomyces serrulata* EY02 or *Hanson's yeast* EY01. The Kazakhstan yeast of the Sergei ( kazochstania cervazzii EY02 was deposited at the China Center for Type Culture Collection on July 6, 2023, with accession number CCTCC NO: M 20231205, at Wuhan University. The falpi-spored Hansenum yeast ( Hanseniaspora valbyensis EY01 was deposited at the China Center for Type Culture Collection (CCTCC) on July 6, 2023, with accession number CCTCC NO: M 20231204, at Wuhan University.

5. The method according to claim 4, characterized in that, The fermentation temperature is 5℃-38℃; And / or, the fermentation is carried out by stirred fermentation, with a stirring speed of 10 rpm to 300 rpm; And / or, the fermentation cycle is 7 days to 20 days.

6. The method according to claim 4, characterized in that, The pomelos are selected from one or more of the following: landscape pomelo, field pomelo, Wendan pomelo, Jinxiang pomelo, Dianjiang white pomelo, Jinlan pomelo, Pingshan pomelo, Changshan Hu pomelo, Four Seasons pomelo, Chuhong pomelo, and Guanxi honey pomelo.

7. The method according to claim 4, characterized in that, The concentration of pomelo in the raw materials is 5wt%-60wt%.

8. The method according to claim 4, characterized in that, The raw materials also include one or more of sucrose, brown sugar, glucose, molasses, garlic, and mugwort.

9. The grapefruit enzyme prepared by the method according to any one of claims 4-8.

10. The use of the grapefruit enzyme according to claim 9 in the preparation of agents that repel or kill rice leaf rollers in crops.

Images