Mutant for improving enzyme activity of fucoidase and application thereof
By site-directed mutation of the α-1,4-fucosidase gene, mutants that significantly improve enzyme activity and thermal stability are formed, and the problem of poor enzyme activity of existing fucoseases is solved and more efficient Catalytic effect.
Patent Information
- Application Number
- CN202411271478.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-11
- Publication Date
- 2024-12-27
AI Technical Summary
The existing fucoidanases have poor performance in enzyme activity and thermal stability, resulting in poor industrial application effects and catalytic efficiency needs to be improved.
By molecularly transforming the α-1,4-fucosidase gene from Mariniflexilefucanivorans, using site-directed mutation technology, the formation of amino acids such as leucine, tyrosine, aspartic acid and asparagine of the mutant parents has been significantly improved. Enzymatic activity and thermal stability α-1,4-fucosacase mutant.
The enzyme activity of the mutant at 50°C and pH 7.5 was increased by 1.4-2.67 times, significantly improving the efficiency and stability of the enzyme, and creating better application conditions.
Smart Images
Figure CN119193548A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a fucoidanase mutant with improved enzyme activity and thermal stability, belonging to the technical field of genetic engineering and enzyme engineering. Background Art
[0002] Fucoidanase (EC 3.2.1.212) has a wide range of sources, mainly from marine bacteria, followed by invertebrate organisms and marine fungi, and the enzymatic properties of various enzymes vary greatly. Fucoidanase has two types of action: endo-type and exo-type; currently, the discovered fucoidanase is mainly endo-type.
[0003] As the research deepened, it was found that low molecular weight fucoidan has better water solubility and biological activity. There are three main methods for preparing low molecular weight fucoidan: chemical method, physical method and enzymatic hydrolysis method. Since enzymatic hydrolysis method is milder and does not damage the biological activity of the product fucoidan oligosaccharide, it can be applied to the production of fucoidan oligosaccharide.
[0004] However, the enzymatic activity of the fucoidanase discovered so far is not very outstanding, resulting in poor industrial application effects, so the catalytic efficiency needs to be further improved. Summary of the invention
[0005] In order to solve the above-mentioned existing problems, the present invention molecularly transforms the α-1,4-fucoidanase gene from Mariniflexilefucanivorans (the nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2), and uses site-directed mutagenesis technology to obtain an α-1,4-fucoidanase mutant with significantly improved enzyme activity and thermal stability.
[0006] The first technical solution provided by the present invention is a fucoidanase mutant, wherein one or more of the 46th leucine, the 290th tyrosine, the 361st aspartic acid and the 374th asparagine of the α-1,4-fucoidanase parent are mutated, and the amino acid sequence of the parent is shown in SEQ ID NO.2.
[0007] In certain embodiments, the mutant is a mutant of the parent subjected to the mutation shown in (a) or (b):
[0008] (c) Single point mutants: mutating the leucine at position 46 to arginine to obtain the mutant L46R; or mutating the tyrosine at position 290 to phenylalanine to obtain the mutant Y290F; or mutating the aspartic acid at position 361 to threonine to obtain the mutant D361T; or mutating the asparagine at position 374 to aspartic acid to obtain the mutant N374D;
[0009] (d) Combination mutants: the leucine at position 46 was mutated to arginine and the tyrosine at position 290 was mutated to phenylalanine to obtain the mutant L46R / Y290F; or the aspartic acid at position 361 was mutated to threonine and the asparagine at position 374 was mutated to aspartic acid to obtain the mutant D361T / N374D; or the leucine at position 46 was mutated to arginine, the tyrosine at position 290 was mutated to phenylalanine, and the asparagine at position 374 was mutated to aspartic acid to obtain the mutant L46R / Y290F / N374D.
[0010] In certain embodiments, the mutant is obtained by mutating the amino acid leucine L at position 46 of the α-1,4-fucoidanase shown in SEQ ID NO.2 to arginine R to obtain a single point mutant L46R.
[0011] In certain embodiments, the mutant is obtained by mutating the tyrosine Y at position 290 of the α-1,4-fucoidanase as shown in SEQ ID NO.2 to phenylalanine F to obtain a single point mutant Y290F.
[0012] In certain embodiments, the mutant is obtained by mutating the aspartic acid D at position 361 of the α-1,4-fucoidanase as shown in SEQ ID NO.2 to threonine T to obtain a single point mutant D361T.
[0013] In certain embodiments, the mutant is obtained by mutating the asparagine N at position 374 of the α-1,4-fucoidanase shown in SEQ ID NO.2 to aspartic acid D to obtain a single point mutant N374D.
[0014] In certain embodiments, the mutant is obtained by mutating the leucine L at position 46 of the α-1,4-fucoidanase as shown in SEQ ID NO.2 to arginine R, and mutating the tyrosine Y at position 290 to phenylalanine F, to obtain the mutant L46R / Y290F.
[0015] In certain embodiments, the mutant is obtained by mutating the aspartic acid D at position 361 of the α-1,4-fucoidanase shown in SEQ ID NO.2 to threonine T, and the asparagine N at position 374 to aspartic acid D, to obtain the mutant D361T / N374D.
[0016] In certain embodiments, the mutant is an α-1,4-fucoidanase whose amino acids are mutated from leucine L at position 46 to arginine R, tyrosine Y at position 290 to phenylalanine F, and asparagine N at position 374 to aspartic acid D, to obtain the mutant L46R / Y290F / N374D.
[0017] The second technical solution provided by the present invention is a gene encoding the mutant described in the first technical solution.
[0018] The third technical solution provided by the present invention is a recombinant plasmid carrying the gene described in the second technical solution.
[0019] The fourth technical solution provided by the present invention is a recombinant microbial cell expressing the mutant described in the first technical solution, or containing the gene described in the second technical solution, or transformed with the recombinant plasmid described in the third technical solution.
[0020] In certain embodiments, the microorganism is Escherichia coli.
[0021] In certain embodiments, the recombinant microbial cell uses Escherichia coli BL21 (DE3) as a host and plasmid pCOLA-Duet as a vector.
[0022] The fifth technical solution provided by the present invention is a method for improving the enzymatic activity of α-1,4-fucoidanase, wherein the method comprises mutating the 46th leucine, the 290th tyrosine, the 361st aspartic acid, and the 374th asparagine of the α-1,4-fucoidanase of the amino acid sequence as shown in SEQ ID NO.2.
[0023] In certain embodiments, the method is to mutate the leucine at position 46 of the α-1,4-fucoidanase with an amino acid sequence as shown in SEQ ID NO.2 to arginine; or mutate the tyrosine at position 290 to phenylalanine; or mutate the aspartic acid at position 361 to threonine; or mutate the asparagine at position 374 to aspartic acid; or mutate the leucine at position 46 to arginine and the tyrosine at position 290 to phenylalanine; or mutate the aspartic acid at position 361 to threonine and the asparagine at position 374 to aspartic acid; or mutate the leucine at position 46 to arginine, the tyrosine at position 290 to phenylalanine, and the asparagine at position 374 to aspartic acid.
[0024] The sixth technical solution provided by the present invention is a method for producing fucoidan oligosaccharides, wherein the method uses fucoidan as a substrate and utilizes the mutant described in the first technical solution to catalyze the production of fucoidan oligosaccharides.
[0025] In certain embodiments, the preparation method of the α-1,4-fucoidanase mutant is as follows: recombinant microbial cells are inoculated into a culture medium and cultured at 35-38°C for at least 12 hours, wherein the recombinant microbial cells use Escherichia coli BL21 (DE3) as a host and pCOLA-Duet as a vector to express the α-1,4-fucoidanase mutant.
[0026] Furthermore, the preparation method further comprises inducing the recombinant microbial cells; the induction method is to culture the recombinant microbial cells to an OD of 600 In the range of 0.6-0.8, add 1mmol / L IPTG and induce at 16-25℃, 200r / min for 8-16h.
[0027] In certain embodiments, the method comprises the following steps: using an enzyme obtained by fermenting and culturing recombinant microbial cells containing a gene encoding an α-1,4-fucoidanase mutant and then crushing the wet cells as a catalyst, dissolving fucoidan (15 g / L, pH=7.5) in Tris-HCL buffer as a substrate, performing a catalytic reaction under heating in a water bath, and after the reaction is completed, separating and purifying the reaction solution to obtain fucoidan oligosaccharides.
[0028] The seventh technical solution provided by the present invention is the use of the α-1,4-fucoidanase mutant described in the first technical solution, or the gene described in the second technical solution, or the recombinant plasmid described in the third technical solution, or the recombinant microbial cell described in the fourth technical solution, or the method described in the fifth technical solution, or the method described in the sixth technical solution in the preparation of fucoidan oligosaccharides or fucoidan-containing products.
[0029] The technical effects of the present invention are as follows:
[0030] The α-1,4-fucoidanase mutant provided by the present invention has significantly improved enzyme activity and stability compared with the original enzyme. The enzyme activity after mutation can reach 165%, 140%, 175%, 170%, 187%, 257% and 267% of the original enzyme under the conditions of 50°C and pH=7.5, respectively, which is 1.4-2.67 times higher than the original enzyme activity, and has higher enzyme activity under neutral (pH 7.5) conditions. The present invention creates better use conditions for the enzyme in practical applications. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 is the relative enzymatic activity of the wild-type FcnA and the forward mutant enzyme of the present invention. DETAILED DESCRIPTION
[0032] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.
[0033] Test method:
[0034] 1. α-1,4-fucoidanase activity detection method
[0035] Enzyme activity assay conditions: The reaction system includes 200 μL of 100-fold diluted purified fermentation broth or supernatant, 200 μL of 15 g / L fucoidan solution (pH=7.5), react at 50°C for 30 min, boil for 15 min to inactivate the enzyme, cool and centrifuge, and then determine the reducing sugar content by DNS method, calculated using the fucose standard curve.
[0036] Enzyme activity unit (U·mL-1): The amount of enzyme required to generate 1 μmol of fucose per minute at 50°C is one enzyme activity unit.
[0037] Among them, the calculation formula of α-1,4-fucoidanase activity is as follows:
[0038] Fucoidanase activity (U·mL-1) = 1000AN / MtV
[0039] 1000: coefficient of conversion from mmol to umol; A: reducing sugar content (mg); N: dilution factor of enzyme solution; M:
[0040] Fucose relative molecular mass (164.16); T: reaction time (min); V: volume of crude enzyme solution (mL).
[0041] 2. Fucose detection method:
[0042] Take 400 μL of fucose and add 600 μL of DNS solution. Mix well and boil in water for 10 min to develop color. Cool quickly and centrifuge (12000 rpm, 1 min). Take 200 μL of supernatant and measure the absorbance at 540 nm.
[0043] The raw materials used in the examples are:
[0044] Materials and reagents: The restriction endonucleases, DpnI enzymes, PCR reagents, etc. used were purchased from TaKaRa Biotechnology Co., Ltd.; plasmid extraction kits were purchased from Nanjing Novozymes Biotech Co., Ltd.; primers were purchased from Suzhou Genewise Biotechnology Co., Ltd.; commercial strains E.coil DH5α, E.coil BL21 (DE3) strains, and commercial plasmid pCOLA-Duet were preserved in the laboratory; other reagents were analytical grade reagents purchased domestically or abroad.
[0045] The culture medium involved in the following examples is as follows:
[0046] LB liquid medium: yeast extract 5.0 g / L, tryptone 10.0 g / L, NaCl 10.0 g / L.
[0047] LB solid medium: yeast extract 5.0 g / L, tryptone 10.0 g / L, NaCl 10.0 g / L, agar powder 15 g / L.
[0048] The buffer involved in the following examples is as follows:
[0049] Lysis buffer: 50mmol / L Tris, 100mmol / L NaCl, pH 7.5;
[0050] Binding Buffer: 50mmol / L Tris, 500mmol / L NaCl, pH 7.5;
[0051] Washing Buffer: 50mmol / L Tris, 500mmol / L NaCl, 50mmol / L imidazole, pH 7.5;
[0052] Elution Buffer: 50mmol / L Tris, 500mmol / L NaCl, 500mmol / L imidazole, pH 7.5;
[0053] Dialysis buffer: 50mmol / L Tris, pH 7.5.
[0054] Example 1: Design of mutation sites of α-1,4-fucoidanase
[0055] The mutation sites were selected by multiple sequence alignment combined with the online server FireProt (https: / / loschmidt.chemi.muni.cz / fireprotweb / example) HotSpot Vizard (https: / / loschmidt.chemi.muni.cz / hotspotwizard / ?action=help&); the sites to be mutated were determined to be leucine at position 46, tyrosine at position 290, aspartic acid at position 361, asparagine at position 374, isoleucine at position 102, leucine at position 142, serine at position 242, and tryptophan at position 380.
[0056] Example 2: Site-directed mutagenesis of α-1,4-fucoidanase
[0057] Primers for the mutation site were designed based on the gene encoding FcnA from Mariniflexilefucanivorans as shown in SEQ ID NO.1. The specific primers are as follows:
[0058] L46R-F:GGTGCG cgc GGCATGCTGTGGCTGCCGGAACGTACGTTCAA
[0059] L46R-R:CATGCC gcg CGCACCACGCATCCACTCGGCTCTCAGACCTTGATT
[0060] Y290F-F:TTTGATGAC ttc ACGTTCGGTCATCCGTTCGG
[0061] Y290F-R:GAACGT gaa GTCATCAAACAGGGTGGCAGAGGTAAACGG
[0062] D361T-F:CTGACT acc GAGCAGTTTGTCGAGTGGACCTCTA
[0063] D361T-R:CTGCTC ggt AGTCAGACACGGGGTATTGCCAGCATT
[0064] N374D-F:ATTGTT gac GGCGGTGGCATCACCTGGGGTAC
[0065] N374D-R:GCCACCGCCA gtc ACAATACCGGTAGAGGTCC
[0066] The underlined lowercase letters represent the codons corresponding to the 46th arginine, 290th phenylalanine, 361st threonine, and 374th aspartic acid encoded by the mutant gene.
[0067] The PCR amplification system is:
[0068]
[0069] After PCR amplification, add 2μLDpnⅠ restriction endonuclease (10U / μL) to the reaction solution and incubate at 37℃ for 2h to eliminate the template. Transform the PCR product into E.coil DH5α cells, spread on LB plates, and culture at 37℃ overnight. Pick a single colony from the plate into LB liquid culture medium, extract the plasmid, and obtain the correct mutant plasmid pCOLA-Duet-FcnA by sequencing. L46R 、pCOLA-Duet-FcnA Y290F 、pCOLA-Duet-FcnA D361T 、pCOLA-Duet-FcnA D361T Orderly stacking was performed to obtain the combined mutation plasmid pCOLA-Duet-FcnA L46R / Y290F、pCOLA-Duet-FcnA D361T / N374D 、pCOLA-Duet-FcnA L46R / Y290F / N374D The successfully constructed mutant plasmid was transformed into E.coil BL21(DE3) to obtain the recombinant cell BL21(DE3) / pCOLA-Duet-FcnA that can express the mutant L46R , BL21(DE3) / pCOLA-Duet-FcnA Y290F , BL21(DE3) / pCOLA-Duet-FcnA D361T , BL21(DE3) / pCOLA-Duet-FcnA D361T , BL21(DE3) / pCOLA-Duet-FcnA L46R / Y290F , BL21(DE3) / pCOLA-Duet-FcnA D361T / N374D , BL21(DE3) / pCOLA-Duet-FcnA L46R / Y290F / N374D .
[0070] Example 3: Expression and purification of original enzyme and mutant enzyme
[0071] The original BL21(DE3) / pCOLA-Duet-FcnA and mutant single colonies prepared in Example 2 were picked up in LB liquid medium containing 50 μg / mL kanamycin, cultured at 37°C, 200 r / min for 12 h, and then transferred to LB medium containing 50 μg / mL kanamycin and cultured at 37°C, 200 r / min until OD 600 In the range of 0.6-0.8, 1 mmol / L IPTG was added and induced overnight at 20°C and 200 r / min, and the fermentation broth was collected.
[0072] Centrifuge the collected fermentation broth at 8000r / min and 4°C for 10min, discard the supernatant, collect the cells, resuspend the cells with 10mL Tris-HCl buffer, and ultrasonically disrupt for 20min (power 30%, disruption for 1s, rest for 2s). Centrifuge at 8000r / min and 4°C for 10min, collect the supernatant, which is the crude enzyme solution. Use Binding Buffer to treat Ni 2+ The chelating agar resin column is pre-balanced; crude enzyme solution is added and balanced with Binding Buffer and Washing Buffer respectively; the enzyme solution is eluted with Elution Buffer and recovered; the recovered enzyme solution is dialyzed in dialysis buffer at 4°C to finally prepare a pure enzyme solution.
[0073] The specific enzyme activity of the pure enzyme solution was tested separately. First, the original enzyme activity was set as 100%. The final results were as follows: Figure 1As shown, compared with the original enzyme, the enzyme activity of the single point mutants was improved as follows: L46R increased by 1.65 times, Y290F increased by 1.4 times, D361T increased by 1.75 times, and N374D increased by 1.7 times; the enzyme activity of the combination mutants was improved as follows: L46R / Y290F increased by 1.87 times, D361T / N374D increased by 2.57 times, and L46R / Y290F / N374D increased by 2.67 times.
[0074] Example 4: Preparation of fucoidan
[0075] The mutant of Example 3 was used as a catalyst, and fucoidan (15 g / L, pH=7.5) was dissolved in Tris-HCL buffer as a substrate. The catalytic reaction was carried out under water bath heating conditions. After the reaction was completed, the reaction solution was separated and purified to obtain fucoidan oligosaccharides.
[0076] Comparative Example 1:
[0077] According to the same method as in Examples 1-3, the conservative sites I102A (isoleucine at position 102 mutated to alanine), L142Q (leucine at position 142 mutated to glutamine), S242T (serine at position 242 mutated to threonine), and W380E (tryptophan at position 380 mutated to glutamate) were screened, and mutants and recombinant bacteria were constructed with reference to the following primers; the recombinant bacteria were cultured according to the same method as in Example 3, and the fermentation enzyme activities were detected respectively. The results are shown in Table 1. The enzyme activity of the mutant L142Q was lower than the original enzyme activity, while the mutants I102A, S242T, and W380E were inactivated.
[0078] The primers are as follows:
[0079] I102A-F:CCGATT gcg GAGAGCCTGTGGCAGGGTGATACCGACGCTAAT
[0080] I102A-R:GCTCTC cgc AATCGGGTGCGGCGCAACATGGGTCGGGCTAAAGATAT
[0081] L142Q-F:GCAGGT cag CGCACCGAAATTTACGTGAACTCATATAA
[0082] L142Q-R:GGTGCG ctg ACCTGCAGCTCTTAACGCTTTTAACCAGGA
[0083] S242T-F:CCGGCG acgGAAGATGTTAATGACCAGCGTATTT
[0084] S242T-R:ATCTTC cgt CGCCGGGTCGTCACCGCACTCGTCTTCCATCACGTT
[0085] W380E-F:ATCACC gag GGTACTCCGCTGGTTCGTACCAACTTGGAGAAT
[0086] W380E-R:AGTACC ctc GGTGATGCCACCGCCATTAACAATA
[0087] The underlined lowercase letters represent the codons corresponding to the 102nd alanine, 142nd glutamine, 242nd threonine, and 380th glutamate encoded by the mutant gene.
[0088] Table 1 Relative enzyme activities of wild-type FcnA and negative mutant enzymes
[0089] Relative enzyme activity (%) WT 100 L142Q 61.7 I102A — S242T — W380E —
[0090] Note: “—” indicates almost no enzyme activity
[0091] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.
Claims
1. An α-1,4-fucoidanase mutant, characterized in that: The mutant is obtained by mutating one or more of the 46th leucine, the 290th tyrosine, the 361st aspartic acid and the 374th asparagine of the α-1,4-fucoidanase parent, and the amino acid sequence of the parent is shown in SEQ ID NO.
2.
2. The mutant according to claim 1, characterized in that The mutant is a mutant of the parent subjected to the mutation shown in (a) or (b): (a) Single point mutants: mutate the leucine at position 46 to arginine to obtain the mutant L46R; or mutate the tyrosine at position 290 to phenylalanine to obtain the mutant Y290F; or mutate the aspartic acid at position 361 to threonine to obtain the mutant D361T; or mutate the asparagine at position 374 to aspartic acid to obtain the mutant N374D; (b) Combination mutants: the leucine at position 46 is mutated to arginine and the tyrosine at position 290 is mutated to phenylalanine to obtain the mutant L46R / Y290F; or the aspartic acid at position 361 is mutated to threonine and the asparagine at position 374 is mutated to aspartic acid to obtain the mutant D361T / N374D; or the leucine at position 46 is mutated to arginine, the tyrosine at position 290 is mutated to phenylalanine, and the asparagine at position 374 is mutated to aspartic acid to obtain the mutant L46R / Y290F / N374D.
3. A gene encoding the mutant according to claim 1 or 2.
4. A recombinant plasmid carrying the gene according to claim 3.
5. A recombinant microbial cell expressing the mutant according to claim 1 or 2, or containing the gene according to claim 3, or transformed with the recombinant plasmid according to claim 4.
6. A method for improving the activity of α-1,4-fucoidanase, characterized in that: The method comprises mutating the 46th leucine, the 290th tyrosine, the 361st aspartic acid and the 374th asparagine of the α-1,4-fucoidanase whose amino acid sequence is shown in SEQ ID NO.
2.
7. The method according to claim 6, characterized in that The method comprises the following steps: mutating the leucine at position 46 of the α-1,4-fucoidanase with an amino acid sequence as shown in SEQ ID NO.2 to arginine; or mutating the tyrosine at position 290 to phenylalanine; or mutating the aspartic acid at position 361 to threonine; or mutating the asparagine at position 374 to aspartic acid; or mutating the leucine at position 46 to arginine and the tyrosine at position 290 to phenylalanine; or mutating the aspartic acid at position 361 to threonine and the asparagine at position 374 to aspartic acid; or mutating the leucine at position 46 to arginine, the tyrosine at position 290 to phenylalanine and the asparagine at position 374 to aspartic acid.
8. A method for producing fucoidan, characterized in that: The method uses fucoidan as a substrate and utilizes the mutant described in claim 1 or 2 to catalyze the production of fucoidan oligosaccharides.
9. The method according to claim 8, characterized in that The method comprises the following steps: using an enzyme obtained by fermenting and culturing recombinant microbial cells containing an α-1,4-fucoidanase mutant encoding gene and then crushing the wet cells as a catalyst, dissolving fucoidan in a Tris-HCL buffer as a substrate, performing a catalytic reaction under water bath heating conditions, and after the reaction is completed, separating and purifying the reaction solution to obtain fucoidan oligosaccharides.
10. Use of the α-1,4-fucoidanase mutant according to claim 1 or 2, or the gene according to claim 3, or the recombinant plasmid according to claim 4, or the recombinant microbial cell according to claim 5, or the method according to claim 6 or 7, or the method according to claim 8 or 9 in the preparation of fucoidan oligosaccharides or fucoidan-containing products.