Application of programmable TnpB nuclease gene editing

Abstract

The invention discloses application of programmable TnpB nuclease gene editing, and relates to the technical field of gene editing. The TnpB nuclease is any one of (A1), (A2) and (A3): (A1) TnpB nuclease, the amino acid sequence of which is as shown in SEQ ID NO.1; (A2) carrying out substitution, deletion and / or addition of one or more amino acid residues on the amino acid sequence of the TnpB nuclease to obtain a protein which has 80% or more of identity with the TnpB nuclease and has the same biological function with the TnpB nuclease; and (A3) a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of (A1) or (A2). The TnpB nuclease provided by the invention has cis-cleavage activity and trans-cleavage activity, and has a wide application prospect in the fields of nucleic acid detection and gene editing.

Description

Technical Field

[0001] The present invention relates to the technical field of gene editing, and in particular to an application of a programmable TnpB nuclease in gene editing. Background Art

[0002] TnpB is an RNA-guided compact nuclease with a protein size of about 400 amino acids. It was first discovered in bacterial transposons. The TnpB system mainly includes two key components: 1) TnpB protein. Responsible for identifying and cutting target DNA; 2) Guide RNA (ωRNA). ωRNA interacts with TnpB protein to guide it to identify and cut target DNA sequences. Although multiple applications of TnpB nucleases in gene editing have been reported at home and abroad, there are few reports in the field of nucleic acid detection. TnpB protein is the ancestor of Cas12 protein in the V-type CRISPR system. The trans-cleavage activity of Cas12 protein has been widely used in in vitro diagnosis, including pathogenic microorganisms, toxins, compounds, etc. Therefore, TnpB proteins with trans-cleavage activity need to be identified. TnpB nuclease can improve gene editing activity through protein engineering and optimization of ωRNA molecules. AlphaFold 3 can accurately predict RNA-protein-DNA complexes. On this basis, whether the activity of TnpB nuclease can be improved by engineering ωRNA molecules needs further study. Summary of the invention

[0003] The purpose of the present invention is to provide an application of a programmable TnpB nuclease in gene editing to solve the problems existing in the above-mentioned prior art. The TnpB nuclease provided by the present invention has cis- and trans-cleavage activities and has broad application prospects in the fields of nucleic acid detection and gene editing.

[0004] To achieve the above object, the present invention provides the following solutions:

[0005] The present invention provides a TnpB nuclease, wherein the TnpB nuclease is any one of (A1), (A2) and (A3):

[0006] (A1) TnpB nuclease, the amino acid sequence of which is shown in SEQ ID NO.1;

[0007] (A2) replacing, deleting and / or adding one or more amino acid residues in the amino acid sequence of the TnpB nuclease to obtain a protein having more than 80% identity with the TnpB nuclease and having the same biological function as the TnpB nuclease;

[0008] (A3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of (A1) or (A2).

[0009] The present invention also provides a gene encoding the TnpB nuclease.

[0010] Furthermore, when the amino acid sequence of the TnpB nuclease is shown as SEQ ID NO.1, the nucleotide sequence of the encoding gene is shown as SEQ ID NO.2.

[0011] The present invention also provides a biomaterial, wherein the biomaterial is any one of (B1) to (B3):

[0012] (B1) a gene expression cassette, the gene expression cassette comprising the above-mentioned coding gene;

[0013] (B2) a recombinant vector comprising the gene expression cassette;

[0014] (B3) A recombinant host cell comprising the recombinant vector.

[0015] The present invention also provides the use of the above-mentioned coding gene or biological material in the preparation of the above-mentioned TnpB nuclease.

[0016] The present invention also provides a composition for gene editing, comprising the above-mentioned TnpB nuclease and ωRNA;

[0017] The ωRNA includes a backbone portion and a targeting sequence portion;

[0018] The targeting sequence portion is complementary to the target sequence of the target gene.

[0019] Further, the nucleotide sequence of the backbone portion of the ω RNA is as shown in SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34 or SEQ ID NO.35.

[0020] The present invention also provides a gene editing system, comprising a recombinant vector expressing the above-mentioned TnpB nuclease and a recombinant vector expressing ω RNA;

[0021] The ωRNA includes a backbone portion and a targeting sequence portion;

[0022] The targeting sequence portion is complementary to the target sequence of the target gene;

[0023] The nucleotide sequence of the backbone portion of the ω RNA is as shown in SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34 or SEQ ID NO.35.

[0024] The present invention also provides the use of the above-mentioned TnpB nuclease, composition or gene editing system in nucleic acid recognition or gene editing for purposes other than disease diagnosis and treatment.

[0025] The gene editing includes gene modification of prokaryotic genomes, eukaryotic genomes or in vitro genes, gene knockout, alteration of gene product expression, repair of mutations or insertion of polynucleotides.

[0026] The present invention also provides a gene editing method, comprising the step of transfecting the above-mentioned gene editing system into a host cell for gene editing.

[0027] The present invention discloses the following technical effects:

[0028] The present invention conducted in-depth mining from the massive metagenomic sequencing data of public databases and discovered a new TnpB nuclease (ISBce3_TnpB) derived from the ISBce3 transposon family. The protein size is only 369 amino acids. The TAM sequence it recognizes is TAC, and it has cis- and trans-cutting activity, and can trans-cut ssDNA and ssRNA.

[0029] The present invention further improves the gene editing activity by engineering the ωRNA sequence of the ISBce3_TnpB nuclease, and has broad application prospects in the fields of in vitro detection of pathogenic microorganisms, molecular diagnosis, and precise modification of mammalian genomes. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 It is a schematic diagram of the domain structure of ISBce3_TnpB nuclease;

[0032] Figure 2 The figure is the result of agarose gel electrophoresis detection of the in vitro double-stranded DNA cleavage activity of ISBce3_TnpB nuclease; wherein S represents substrate; P represents product;

[0033] Figure 3 This is a fluorescence intensity detection result diagram of the trans-cleavage of ssDNA reporter by ISBce3_TnpB nuclease when it targets dsDNA and ssDNA at different temperatures;

[0034] Figure 4 The fluorescence intensity detection results of ISBce3_TnpB nuclease trans-cutting ssDNA and ssRNA reporter when targeting dsDNA at different temperatures; "+" represents the addition of dsDNA; "-" represents the absence of dsDNA;

[0035] Figure 5 The fluorescence intensity detection results of ISBce3_TnpB nuclease trans-cutting ssDNA and ssRNA reporter when targeting ssDNA at different temperatures; "+" represents the addition of ssDNA; "-" represents the absence of ssDNA;

[0036] Figure 6 The results of fluorescence intensity detection of ISBce3_TnpB nuclease trans-cutting AAAAA, TTTTT, GGGGG or CCCCC ssDNA-reporter when targeting dsDNA at different temperatures; "+" represents the addition of dsDNA; "-" represents the absence of dsDNA;

[0037] Figure 7 This is a graph showing the detection results of the cis-cleavage activity of ISBce3_TnpB nuclease after TAM mutation;

[0038] Figure 8 This is a graph showing the detection results of the cis-cleavage activity of the ωRNA sequence after sequential mutation when the ISBce3_TnpB nuclease targets the same target;

[0039] Fig. 9 The diagram is a test result of detecting the trans-cleavage activity of ωRNA after 5' end truncation when targeting dsDNA and ssDNA;

[0040] Fig.10 This is a graph showing the detection results of the trans-cleavage activity of the truncated Stem 1 sequence of 165-ωRNA;

[0041] Fig.11 The figure is a detection result of the trans-cleavage activity of the truncated Stem 2 and Stem 3 sequences of 165-ωRNA;

[0042] Fig.12 The best ωRNAs truncated at the 5' end, Stem1, Stem2 and Stem3 were combined to obtain the detection result of the trans-cleavage activity of two ωRNAs with lengths of 105nt and 97nt respectively;

[0043] Fig.13 A graph showing the results of evaluating the gene editing activity of ISBce3_TnpB nuclease in HEK293T cells; wherein A is the detection result of the gene editing activity of wild-type ISBce3_TnpB nuclease in HEK293T cells; B is the detection result of the gene editing activity of ISBce3_TnpB nuclease in HEK293T cells after engineering ωRNA. DETAILED DESCRIPTION

[0044] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0045] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0046] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in N-terminus (amino terminus) to C-terminus (carboxyl terminus) orientation.

[0047] Terminology Note:

[0048] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0049] TnpB Transposase: TnpB is a nuclease derived from bacteria and archaea, belonging to the IF-type CRISPR-associated protein family. It was originally discovered in transposons (mobile genetic elements), so it is called a transposase. TnpB plays an important role in gene editing. It can recognize specific DNA sequences and cut or insert them at these locations.

[0050] ωRNA (RNA-guided nuclease activity factor): ωRNA is a small RNA associated with TnpB, usually encoded by the host genome. It binds to the TnpB protein to form a complex for recognizing and targeting specific DNA sequences. This RNA-guided mechanism is similar to crRNA in the CRISPR-Cas system.

[0051] TAM (TnpB-Associated Motif): TAM is a specific DNA sequence that TnpB nuclease recognizes and binds to. These sequences are usually located near the target gene and are used to guide TnpB to precisely cut or edit in the genome.

[0052] Cis-cleavage: refers to the cleavage of the target DNA sequence that is directly paired with the TnpB nuclease after binding to its ω RNA.

[0053] Trans-cleavage: It means that after TnpB nuclease recognizes and binds to the target DNA, it not only cuts the DNA sequence paired with ωRNA, but also cuts adjacent or other DNA molecules.

[0054] Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0055] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0056] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0057] Example 1: Mining novel TnpB nucleases based on metagenomics strategy

[0058] The massive metagenomic sequencing data in public databases such as NCBI nrpsd (Non-Redundant Protein Sequence Database) and the Global Microbial Gene Catalog Database (GMGC) were used to deeply mine bacterial encoded proteins. The brief process is: for all contig sequences in the target database, use minced and prodigal software to search and locate RE (full name in English) and adjacent expressed proteins, then use CD-hit software to remove redundancy of these proteins, and finally use mega software to perform protein cluster analysis, hmmer software to identify and classify proteins with similar RuvC domains, and finally identify a new unknown bacterial protein, whose protein size is only 369 amino acids, the amino acid sequence is shown in SEQID NO.1, and the nucleic acid sequence of its encoding gene is shown in SEQ ID NO.2.

[0059] After the candidate protein was determined, multiple sequence homology alignment was performed on the RNA sequence derived from the transposon element at the right end of its genome to locate the end of the transposon. The corresponding ωRNA secondary structure was predicted using the RNAfold web server (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi) online website and compared with the secondary structure of the known TnpB nuclease ωRNA to determine the sequence of the candidate ωRNA. The structure of the ωRNA-protein-DNA complex was predicted using AlphaFold 3, and the predicted structural model was compared with the known cryo-EM structure of the ISDra2 nuclease, and the domain composition and characteristics of the novel ISBce3_TnpB nuclease were finally determined (such as Figure 1 shown).

[0060] Example 2 ISBce3_TnpB nuclease has nucleic acid cleavage activity in vitro

[0061] In this example, the ISBce3_TnpB protein was obtained by prokaryotic expression protein purification technology (the nucleic acid sequence of the coding gene after Escherichia coli codon optimization is shown in SEQ ID NO.3), and its corresponding ωRNA was obtained by in vitro transcription and purification, and the dsDNA cleavage activity of the ISBce3_TnpB protein was tested in vitro at different temperatures. The ωRNA paired with the target nucleic acid was used to guide the ISBce3 protein to recognize and bind to the target nucleic acid, thereby stimulating the cleavage activity of the ISBce3 protein on the target nucleic acid. Then, agarose gel electrophoresis was performed to observe the change in the size of the target band to identify its cleavage efficiency.

[0062] The target dsDNA selected in this example is a partial fragment of the ASFV p72 gene, and the nucleotide sequence is shown in SEQ ID NO. 4. The nucleotide sequence of the corresponding ωRNA is shown in SEQ ID NO. 5.

[0063] SEQ ID NO.4:

[0064] CTGTAACGCAGCACAGCTGAACCGTTCTGAAGAAGAAGAAAGTTAATAGCAGATGCCGATACCACAATCAGCCGTAGTGATAGACCCCACGTAATCCGTGTCCCAACTAATATAAAATTCTCTTGCTCTGGATACGTTAATATGACCACTGGGTTGGTATTCCT CCCGTGGCTTCAAAGCAAAG ; The reverse complementary sequence marked in bold is TAM, and the reverse complementary sequence of the underlined sequence is the targeting sequence.

[0065] SEQ ID NO.5:

[0066] GAAUAUUCGUUAUGCACCUGUGGUUGAUGGUAAAAGUCAAUCAGCAUAGGGAACUAUAUGUUCUGCCCUAUGAGGGGUAAUGAGAUACCCUAAUCUUGAGGACUGUAAAACAGAAAUGGACUGCGAACGCUUAGUCACUCAAGAAUCCCACCCGUUAAACCGUAAGGUUUAGGGCUUGCGUCUUUAGACGUGGGAGUCUCAA CUUUGCUUUGAAGCCA CGGG (Targeting sequence is underlined).

[0067] First, the previously constructed pMD18T-p72 plasmid (p72 fragment was amplified from ASFV genomic DNA and connected to the pMD-18T vector by TA cloning to construct the pMD18T-p72 plasmid) was used as a template, and p72-F (SEQ ID NO.6) and p72-R (SEQ ID NO.7) were used as primers for PCR amplification to obtain the p72 gene fragment. Secondly, the DNA sequence encoding ISBce3_TnpB was synthesized after E. coli codon optimization, cloned into the pET-28a prokaryotic expression vector, and transformed into the E. coli BL21 strain. After identifying the positive clones, IPTG induced expression was performed, and the target protein was purified by affinity chromatography. The in vitro cleavage reaction used the following system: 10×CutSmart Buffer 2μL, ISBce3_TnpB protein 500ng, ωRNA 300ng, and p72 target amplified purified product 200ng. The cells were incubated at 16°C, 25°C, 37°C and 55°C for 15 min. After the reaction was completed, 1 μL of proteinase K was added and the reaction was terminated by incubation at 60°C for 10 min. No ωRNA was added to the control group. After the reaction, the cells were detected by 1.5% agarose gel electrophoresis, and the cutting activity of the new ISBce3_TnpB nuclease at different temperatures was detected by gel imaging system.

[0068] The results are as follows Figure 2 As shown, compared with the control group, the ISBce3_TnpB protein can cut dsDNA between 16°C and 55°C. This shows that the ISBce3_TnpB protein has targeted nucleic acid cutting activity.

[0069] Example 3 ISBce3_TnpB activates trans-cleavage activity by targeting dsDNA or ssDNA

[0070] In this example, the complex-RNP formed by ISBce3_TnpB protein and ωRNA was used to evaluate the dsDNA or ssDNA targeting ability, wherein the dsDNA target and ωRNA were the same as those in Example 2. The ssDNA target sequence was: 5'-CCCGTGGCTTCAAAGCAAAG-3' (SEQ ID NO. 8).

[0071] The trans-cleavage activity test system was 20 μL in total, including 2 μL of 10×CutSmart Buffer, 500 ng of ISBce3_TnpB protein, 300 ng of ωRNA, 0.2 μL of 100 μM ssDNA-reporter (5'-ROX / GTATCCAGTGCG / BHQ2-3'), 200 ng of dsDNA target purified fragment or 5 μM of ssDNA target. The control group did not contain dsDNA or ssDNA targets. Three reaction temperatures of 16°C, 37°C and 55°C were set, and the reaction time was 60 min. After the reaction, 1 μL of proteinase K was added to each reaction tube, and the reaction was terminated by incubation at 60°C for 10 min. The solution after the reaction was transferred to the ELISA plate, and 80 μL of DEPC water was added to each well for dilution. The fluorescence intensity of each reaction at 561-601 nm was read by an ELISA reader.

[0072] The results are as follows Figure 3 As shown in the figure, at the three set temperatures, the fluorescence signal values ​​of ISBce3_TnpB nuclease when targeting dsDNA or ssDNA were significantly higher than those of the control group, indicating that ISBce3_TnpB nuclease can activate trans-cleavage activity by targeting dsDNA or ssDNA.

[0073] Example 4 Evaluation of reporter types for trans-cleavage when ISBce3_TnpB nuclease targets dsDNA

[0074] In this example, the reporter type of trans-cleavage of ISBce3_TnpB nuclease when targeting dsDNA was evaluated. ISBce3_TnpB protein was prepared by prokaryotic expression and purification technology, ωRNA was prepared by in vitro transcription, and dsDNA target was amplified and purified by PCR.

[0075] The dsDNA target and ω RNA in this example are the same as those in Example 2. The ssDNA-reporter sequence is 5'-ROX / GTATCCAGTGCG / BHQ2-3', and the ssRNA-reporter sequence is 5'-ROX / GUAUCCAGUGCG / BHQ2-3'.

[0076] The reaction system was 20 μL, including 10×CutSmart Buffer 2 μL, ISBce3 protein 500 ng, ωRNA 300 ng, dsDNA target 200 ng, 100 μM ssDNA-reporter or ssRNA-reporter 0.2 μL. No dsDNA target was added to the control group. A total of three temperatures were set, namely 16°C, 37°C and 55°C. The reaction time was 60 min. After the reaction, 1 μL of proteinase K was added to each reaction and incubated at 60°C for 10 min to terminate the reaction. The reaction solution was transferred to the ELISA plate and 80 μL of DEPC water was added to each well for dilution. The fluorescence intensity of each reaction at 561-601 nm was read by an ELISA reader.

[0077] The results are as follows Figure 4 As shown in the figure, only the ssDNA-reporter group can produce strong fluorescence signals at three temperatures. In summary, when the ISBce3_TnpB nuclease targets dsDNA under the conditions of 16℃-55℃, it can only trans-cleave the ssDNA-reporter.

[0078] Example 5 Evaluation of reporter types for trans-cleavage when ISBce3_TnpB nuclease targets ssDNA

[0079] In this example, the reporter type of trans-cleavage of ISBce3_TnpB nuclease when targeting ssDNA was evaluated. ISBce3 protein was prepared by prokaryotic expression and purification technology, and ωRNA was prepared by in vitro transcription.

[0080] The ssDNA target selected in this example is the same as that in Example 3. The ω RNA sequence is the same as that in Example 2. The ssDNA and RNA reporter sequences are the same as those in Example 4.

[0081] The reaction system was 20 μL, including 2 μL of 10×CutSmart Buffer, 500 ng of ISBce3_TnpB protein, 300 ng of ωRNA, 0.5 μL of synthetic ssDNA (10 μM) target, and 0.2 μL of 100 μM ssDNA reporter or ssRNA reporter. No ssDNA target was added to the control group. Three temperatures were set, namely 16°C, 37°C and 55°C. The reaction time was 60 min. After the reaction, 1 μL of proteinase K was added to each reaction and the reaction was terminated by incubation at 60°C for 10 min. The solution after the reaction was transferred to the ELISA plate and 80 μL of DEPC water was added to each well for dilution. The fluorescence intensity of each reaction at 561-601 nm was read by an ELISA reader.

[0082] The results are as follows Figure 5 As shown in the figure, when ISBce3_TnpB nuclease targets ssDNA, the ssDNAreporter group can produce strong fluorescence signals at three temperatures. However, the RNA reporter group only produces strong fluorescence signals at 55°C. In summary, when ISBce3_TnpB targets ssDNA, it can trans-cleave ssDNA reporter at 16°C-55°C, and can also trans-cleave RNA reporter at 55°C.

[0083] Example 6 Evaluation of base sequence preference of ISBce3_TnpB nuclease trans-cleavage of ssDNA reporter

[0084] The dsDNA target and ω RNA sequences used in this example are the same as those in Example 2. Four types of ssDNA reporter sequences were designed, namely: (1) 5'-ROX / AAAAA / BHQ2-3'; (2) 5'-ROX / TTTTT / BHQ2-3'; (3) 5'-ROX / GGGGG / BHQ2-3'; (4) 5'-ROX / CCCCC / BHQ2-3'.

[0085] The reaction system was 20 μL, including 10×CutSmart Buffer 2 μL, ISBce3_TnpB protein 500 ng, ωRNA 300 ng, dsDNA target 200 ng, and 10 μM ssDNA reporter 0.2 μL. No dsDNA target was added to the control group. A total of three temperatures were set, namely 16°C, 37°C, and 55°C. The reaction time was 60 min. After the reaction, 1 μL of proteinase K was added to each reaction and incubated at 60°C for 10 min to terminate the reaction. The solution after the reaction was transferred to the ELISA plate and 80 μL of DEPC water was added to each well for dilution. The fluorescence intensity of each reaction at 561-601 nm was read by an ELISA reader.

[0086] The results are as follows Figure 6 As shown, ISBce3_TnpB nuclease can trans-cleave ssDNA reporters with sequences of AAAAA, TTTTT, CCCCC or GGGGG in the temperature range of 16℃-55℃, but has lower trans-cleavage activity for ssDNA reporter with sequence of GGGGG at 16℃.

[0087] Example 7 Evaluation of ISBce3_TnpB nuclease compatibility with TAM

[0088] In this example, different types of TAMs are used in vitro to evaluate the cis-cleavage activity of the ISBce3_TnpB nuclease. Specifically, the target nucleic acid ASFV p72 gene selected in this example. First, p72-F1 / p72-R1 is used as a primer pair for PCR amplification to obtain fragment 1, followed by p72-F2 / p72-R2 as a primer pair for amplification to obtain fragment 2, and finally p72-F3 / p72-R3 is used as a primer pair for PCR amplification to obtain fragment 3. Using p72-F1 and p72-R3 as primers, fragment 1, fragment 2 and fragment 3 as templates, PCR amplification is performed to obtain targets containing different TAMs, and the ωRNA sequence used is the same as in Example 2.

[0089] The nucleotide sequences of p72-F1, p72-R1, p72-F2, p72-R2, p72-F3 and p72-R3 are shown in SEQ ID NOs. 9-14, respectively.

[0090] The reaction system was 20 μL, including 2 μL of 10×CutSmart Buffer, 500 ng of ISBce3_TnpB protein, 300 ng of ωRNA, and 200 ng of p72 amplification products of different types of TAM. No ωRNA was added to the control group. The reaction temperature was set at 37°C and the reaction time was 60 min. After the reaction, 1 μL of proteinase K was added to each reaction and incubated at 60°C for 10 min to terminate the reaction. The reaction products were detected by 1.5% agarose gel electrophoresis, and the gray value of the electrophoresis results was calculated using Image J software to evaluate the cutting efficiency.

[0091] The results are as follows Figure 7 As shown, changes in the 2nd, 3rd, and 4th bases of TAM reduce the cis-cleavage activity, while when the 1st base is changed, its activity is equivalent to that of the wild type. This indicates that the last 3 bases of ISBce3_TnpB nuclease TAM are crucial for the cis-cleavage activity, while the tolerance for the 1st base is higher.

[0092] Example 8 Evaluation of the mismatch tolerance of the ISBce3_TnpB nuclease guide sequence with the dsDNA target

[0093] In this example, the bases 1-20 of the ISBce3_TnpB nuclease guide sequence are mutated sequentially, and the mismatch tolerance between the guide sequence and the dsDNA target is evaluated by detecting the cis-cleavage activity. Specifically, the target nucleic acid ASFV p72 gene selected in this example. Fragment 1, fragment 2 and fragment 3 were obtained using the same primers in Example 7. Using p72-F1 and p72-R3 as primers, fragment 1, fragment 2 and fragment 3 as templates, PCR amplification was performed to obtain dsDNA targets with bases 1-20 mismatched sequentially, and the ωRNA sequence used was the same as in Example 2.

[0094] The reaction system was 20 μL, containing 2 μL of 10×CutSmart Buffer, 500 ng of ISBce3_TnpB protein, 300 ng of ωRNA, and 200 ng of p72 amplification products of different TAMs were added. No ωRNA was added to the control group. The reaction temperature was set at 37°C and the reaction time was 60 min. After the reaction, 1 μL of proteinase K was added to each reaction tube and incubated at 60°C for 10 min to terminate the reaction. The reaction products were detected by 1.5% agarose gel electrophoresis, and the gray value of the electrophoresis results was calculated using Image J software to evaluate the cutting efficiency. The cutting efficiency of the wild-type target was quantified as 1, and the proportion of the mismatched targets at other different positions in the cutting efficiency of the wild-type target was calculated as the cutting efficiency of the mismatched targets at different positions in sequence.

[0095] The results are as follows Figure 8 As shown, compared with the wild type and catalytically inactive ISBce3_TnpB variant (dTnpB), the mismatched bases at positions 1-12 significantly reduced the cis-cleavage activity of ISBce3_TnpB. However, when the mismatched bases were at positions 13-20, it still had a high cis-cleavage activity. The above results indicate that the cis-cleavage activity can be activated when the 1st to 12th bases of the guide sequence of the ISBce3_TnpB nuclease are fully matched with the target sequence.

[0096] Example 9 Engineered ω RNA scaffold improves ISBce3_TnpB nuclease trans-cleavage activity

[0097] In this example, the effect of truncated and optimized ωRNA scaffold sequences on the trans-cleavage activity of ISBce3_TnpB nuclease was evaluated. The wild-type ωRNA scaffold (WT-ωRNA) was 204 nt in length, and the nucleotide sequence was shown in SEQ ID NO.15.

[0098] First, the 5' end sequence of the ωRNA scaffold was truncated to 191nt (SEQ ID NO.16), 175nt (SEQ ID NO.17), 165nt (SEQ ID NO.18), 156nt (SEQ ID NO.19), 140nt (SEQ ID NO.20), 133nt (SEQ ID NO.21), 121nt (SEQ ID NO.22) and 110nt (SEQ ID NO.23) in length.

[0099] Specifically, the dsDNA target nucleic acid selected in this example is the CSFV E2 gene (nucleotide sequence is shown in SEQ ID NO. 24), and TAM is 5'-TTAC-3'.

[0100] SEQ ID NO.24:

[0101] ATCCACACCATCTGCATTGTCTTACTAGCCCCCCTGTGTAGACCACTGGTTCACCTTTGACCGCATGTCCAGTTGCCCCCCAACTTACAGTAGAATAAATCCTCATTTTCCACCGTGGTGGTCACGCAATCCGTTCTATGCGAAGGCTTATCTCTCCTAAAGGTCTTTAC CACTTCCGTTCTCAGAGTTG TAGGGCTCACCGCTGTGCACTCTACGACACCCGTCCACCCTATTGGGCAGACAAGATAGAAGGCACTGCCGTTCAATAAGGTTGTATTGTACTTCCCCTTGACAACAGGACTAGTATCGAAAGGGCACAGCCCGAACCCAAAGTCGTCTCCCATTTCCTCAGTAGATGGGTTGGTCCCGTCGAACAAGAGCTCAAATGTTACAGACGTGGGTAGAGCCCTCTTGTGTAATGATGCCAAGTACCTCCTGCTGACCACGCTGAGTGCAGTGACTTTAAAGGAGCCCGCCACGCAAATAGCCTTGACGGTCCCG; the bold sequence is TAM, and the underlined sequence is the targeting sequence. The selected ssDNA target sequence is a synthetic oligonucleotide containing 20 nt targeting CSFV, and its sequence is: 5'- CAACTCTGAGAACGGAAGTG -3' (SEQ ID NO. 25).

[0102] The reaction system was 20 μL, including 10×CutSmart Buffer 2 μL, ISBce3_TnpB protein 500 ng, different types of ωRNA variants 300 ng, CSFV-E2 amplification product 200 ng or synthetic 10 μM ssDNA target 1 μL, 100 μM ssDNA-reporter 0.2 μL. No dsDNA target was added to the control group. Incubate at 37°C for 5 min, 15 min, 30 min, 60 min, and 90 min. After the reaction, add 1 μL of proteinase K to each reaction and incubate at 60°C for 10 min to terminate the reaction. Transfer the reaction solution to the ELISA plate and dilute it with 80 μL of DEPC water per well. Read the fluorescence intensity of each reaction at 561-601 nm using an ELISA reader.

[0103] The results are as follows Fig. 9 As shown, when targeting dsDNA, when the length of ωRNA is truncated to 156nt, the activity of 156-ωRNA is significantly reduced compared with WT-ωRNA, the activity of 140-ωRNA is lost, and the activities of 165-ωRNA, 175-ωRNA and 191-ωRNA are similar to WT-ωRNA. When targeting ssDNA, the activity is reduced when the length of ωRNA is truncated to 133-ωRNA, and the activities of 140-ωRNA, 156-ωRNA, 165-ωRNA, 175-ωRNA and 191-ωRNA are comparable to WT-ωRNA. Therefore, ISBce3_TnpB nuclease is more flexible when targeting ssDNA than when targeting dsDNA, and is more tolerant to 5' truncation of ωRNA. In summary, combined with the performance of targeting ssDNA and dsDNA, the optimal ωRNA for 165-ωRNA truncated at the 5' end was determined and used in subsequent experiments.

[0104] Subsequently, AlphaFold3 was used to predict the three-dimensional structure of the TnpB-ωRNA-DNA complex, and the Stem1 stem-loop region of the ωRNAscaffold was truncated to 150nt (SEQ ID NO.26), 139nt (SEQ ID NO.27), 138nt (SEQ ID NO.28) and 131nt (SEQ ID NO.29), respectively.

[0105] The results are as follows Fig.10 As shown, the activities of Stem1-131-ωRNA and Stem1-138-ωRNA were similar to those of WT-ωRNA, while the activities of Stem1-150-ωRNA and Stem1-139-ωRNA were reduced compared with WT-ωRNA. In summary, Stem1-131-ωRNA is the best ωRNA for truncating the Stem1 region.

[0106] Then, the Stem2 and Stem3 regions were truncated using a similar method, and were truncated into Stem2-155-ωRNA (SEQ ID NO.30), Stem2-151-ωRNA (SEQ ID NO.31), Stem3-149-ωRNA (SEQ ID NO.32) and Stem2&Stem3-131-ωRNA (SEQ ID NO.33), respectively.

[0107] The results are as follows Fig.11 As shown, compared with the wild type, Stem3-149-ωRNA has the best activity, followed by Stem2-151-ωRNA and Stem2-155-ωRNA, and Stem2&Stem3-131-ωRNA has the lowest activity. Therefore, Stem2-155-ωRNA is the best ωRNA truncated in the Stem2 region, and Stem3-149-ωRNA is the best ωRNA truncated in the Stem3 region.

[0108] Furthermore, the best ωRNAs with 5' end, Stem1, Stem2 and Stem3 truncations were combined to obtain two ωRNAs with lengths of 105 nt (SEQ ID NO.34) and 97 nt (SEQ ID NO.35), respectively.

[0109] The results are as follows Fig.12 As shown, the activity of 105-ωRNA is significantly higher than that of wild type, while the activity of 97-ωRNA is lower than that of wild type. From the above results, it can be concluded that 105-ωRNA is the best ωRNA after engineering.

[0110] Example 10 Evaluation of the gene editing activity of ISBce3_TnpB nuclease in HEK293T cells

[0111] In this example, the ISBce3_TnpB sequence was firstly optimized for eukaryotic cell codons, and SV40 NLS and NLS nuclear localization signals were added to the N-terminus and C-terminus, respectively, and the nucleotide sequence was shown in SEQ ID NO. 36. It was cloned into a eukaryotic expression vector and co-transfected into HEK 293T cells with a vector expressing ω RNA by liposomes. After 72 hours, the cells were collected to extract genomic DNA, and the gene editing activity was detected by high-throughput sequencing after PCR amplification.

[0112] In this embodiment, the target genes selected are human FANCF gene, TAM sequence is TTAC, the nucleotide sequence of the amplicon is shown in SEQ ID NO.37, and the WT-ω RNA sequence is shown in SEQ ID NO.38. DNMT1 gene, TAM is TTAC, the nucleotide sequence of the amplicon is shown in SEQ ID NO.39, and the WT-ω RNA sequence is shown in SEQ ID NO.40; EMX1 gene, TAM is TTAC, the nucleotide sequence of the amplicon is shown in SEQ ID NO.41, and the WT-ω RNA sequence is shown in SEQ ID NO.42; RUNX1 gene, TAM is TTAC, the nucleotide sequence of the amplicon is shown in SEQ ID NO.43, and the WT-ω RNA sequence is shown in SEQ ID NO.44; B2M gene, TAM is TTAC, the nucleotide sequence of the amplicon is shown in SEQ ID NO.45, and the WT-ω RNA sequence is shown in SEQ ID NO.46.

[0113] Specifically, HEK293T cells were inoculated when the confluency reached 70-80%, and the number of cells inoculated in a 12-well plate was 8×10 4 cells / well. Transfection was performed for 8 hours, and each well was replaced with DMEM medium containing 2% FBS before transfection. 500ng of ISBce3_TnpB eukaryotic expression plasmid and 300ng of ωRNA expression plasmid were added to 200μL JetprimeBuffer in sequence, and after pipetting and mixing, 1.5μL Jetprime was added to mix, and the mixture was incubated at room temperature for 10 minutes and then dripped into the cell supernatant. After culturing at 37℃ for 72 hours, the medium was discarded, and the cells were resuspended with 100μL PBS to extract the cell genome. After PCR amplification, high-throughput sequencing was performed.

[0114] The results are as follows Fig.13 As shown in A, gene editing activity was detected in all five targets, indicating that the novel ISBce3_TnpB nuclease can perform targeted editing of mammalian genomes.

[0115] Further, the optimized ωRNA variants with enhanced trans-cleavage activity in vitro described in Example 9 were tested at three endogenous targets in HEK293T cells, as shown in FIG. Fig.13 As shown in B, the optimized 105-ωRNA has the shortest length and significantly improves the editing efficiency of ISBce3_TnpB.

[0116] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A TnpB nuclease, characterized in that The TnpB nuclease is any one of (A1), (A2) and (A3): (A1) TnpB nuclease, the amino acid sequence of which is shown in SEQ ID NO.1; (A2) replacing, deleting and / or adding one or more amino acid residues in the amino acid sequence of the TnpB nuclease to obtain a protein having more than 80% identity with the TnpB nuclease and having the same biological function as the TnpB nuclease; (A3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of (A1) or (A2).

2. A gene encoding the TnpB nuclease as claimed in claim 1.

3. The coding gene according to claim 2, characterized in that When the amino acid sequence of the TnpB nuclease is shown as SEQ ID NO.1, the nucleotide sequence of the encoding gene is shown as SEQ ID NO.

2.

4. A biomaterial, characterized in that: The biomaterial is any one of (B1)-(B3): (B1) a gene expression cassette comprising the coding gene according to claim 2 or 3; (B2) a recombinant vector comprising the gene expression cassette; (B3) A recombinant host cell comprising the recombinant vector.

5. Use of the coding gene according to claim 2 or 3 or the biological material according to claim 4 in the preparation of the TnpB nuclease according to claim 1.

6. A composition for gene editing, characterized in that: comprising the TnpB nuclease and ω RNA according to claim 1; The ωRNA includes a backbone portion and a targeting sequence portion; The targeting sequence portion is complementary to the target sequence of the target gene.

7. The composition according to claim 6, characterized in that The nucleotide sequence of the backbone portion of the ω RNA is shown in SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34 or SEQ ID NO.

35.

8. A gene editing system, characterized in that: Comprising a recombinant vector expressing the TnpB nuclease according to claim 1 and a recombinant vector expressing ω RNA; The ωRNA includes a backbone portion and a targeting sequence portion; The targeting sequence portion is complementary to the target sequence of the target gene; The nucleotide sequence of the backbone portion of the ω RNA is as shown in SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34 or SEQ ID NO.

35.

9. Use of the TnpB nuclease according to claim 1, the composition according to claim 6 or 7, or the gene editing system according to claim 8 in nucleic acid recognition or gene editing for purposes other than disease diagnosis and treatment.

10. A method for gene editing, characterized in that: The method comprises the step of transfecting the gene editing system described in claim 8 into a host cell for gene editing.

Images