Rice OsTCP11 Gene and Its Application in Rice Disease Resistance

The OsTCP11 gene of rice was knocked out through CRISPR/Cas9 technology, which solved the problems caused by traditional disease-resistant breeding time and chemical prevention and control, and cultivated rice mutants that resist rice blast and white leaf blight, achieving efficient and environmentally friendly disease-resistant variety screening.

CN119193618BActive Publication Date: 2025-08-05JILIN AGRICULTURAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411569286.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-05
Publication Date
2025-08-05
Estimated Expiration
2044-11-05

AI Technical Summary

Technical Problem

Traditional disease-resistant breeding methods take a long time and rely on chemical control, making it difficult to efficiently cultivate rice varieties that are resistant to rice blast and white leaf blight, and chemical control brings problems of pesticide residues and drug resistance.

Method used

The OsTCP11 gene of rice was knocked out using CRISPR/Cas9 gene editing technology, and the OsTCP11 gene knockout mutant ostcp11 was constructed. Gene editing was achieved through the CRISPR/Cas9 system to obtain rice mutants that were resistant to rice blast and white leaf blight.

Benefits of technology

The resistance of rice to rice blast and white leaf blight is significantly enhanced, and the area of lesions and bacterial amounts are significantly reduced, providing an efficient and environmentally friendly basis for screening disease-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119193618B_ABST
    Figure CN119193618B_ABST
Patent Text Reader

Abstract

The present invention discloses a rice OsTCP11 gene and its application in rice disease resistance. The OsTCP11 gene has a nucleotide sequence as shown in SEQ ID NO.1. The OsTCP11 gene is knocked out by utilizing CRISPR / Cas9 gene editing technology. The present invention knocks out the OsTCP11 gene using CRISPR / Cas9 technology to obtain a knockout mutant, ostcp11. Rice blast resistance testing revealed that the mutant ostcp11 is more resistant to the disease, has a smaller lesion area, and carries less blast fungi on diseased leaves than wild-type rice, indicating that OsTCP11 negatively regulates rice resistance to rice blast. Bacterial blight resistance testing revealed that the mutant ostcp11 is more resistant to the disease and has shorter lesions than wild-type rice, indicating that OsTCP11 negatively regulates rice resistance to rice blast.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of biological agriculture, and particularly relates to the application of the OsTCP11 gene and the encoded protein in improving the disease resistance of rice. Background Art

[0002] Rice is one of the world's most important food crops, ranking second in terms of crop area in Jilin Province. However, due to its scale, planting patterns, and frequency, it remains susceptible to various pests and diseases. Rice blast, bacterial leaf blight, and sheath blight pose a serious threat to China's rice fields. They are the three most important diseases in rice cultivation, and their control is essential. While chemical control plays a key role in combating rice diseases, it can lead to the "three Rs" of pesticides, resulting in pesticide residues, resurgence, and resistance, which remain unresolved. Therefore, finding effective and environmentally friendly methods for rice disease control has become a pressing challenge. To address this challenge, breeding disease-resistant varieties is the most economically and environmentally friendly strategy. Traditional breeding for disease resistance primarily involves field hybridization and backcrossing, combined with field resistance identification and selection for agronomic traits. This requires years and multiple generations of screening to identify resistant varieties. CRISPR / Cas9 technology is a gene-editing technique that has been widely used in recent years, characterized by high efficiency, ease of operation, and low cost. The principle of this technology is to use the specific recognition of the target sequence by the guide RNA to guide the nuclease Cas9 to cleave DNA at the target site, causing double-strand breaks, thereby stimulating the intracellular DNA repair system and causing gene mutations, including base insertions, deletions, and substitutions. In recent years, this system has been used to genetically improve relevant traits in plants such as rice. In the breeding process, the use of CRISPR / Cas9 technology can quickly generate safe and stable homozygous mutants, which can be used to improve and cultivate disease-resistant rice varieties and promote the creation of excellent germplasm resources. Summary of the Invention

[0003] The present invention aims to solve the technical difficulties of traditional disease-resistant breeding and provides a rice OsTCP11 gene and its application in rice disease resistance.

[0004] A method for breeding disease-resistant rice is achieved by knocking out the rice OsTCP11 gene;

[0005] The nucleotide sequence of the OsTCP11 gene is shown in SEQ ID NO.1;

[0006] The knockout is achieved by using CRISPR / Cas9 gene editing technology;

[0007] The target nucleotide sequence of the OsTCP11 gene is: AAGCTTGTCGATCTCGGCCTggg.

[0008] A gene knockout vector is a vector that inserts the target nucleotide sequence of the OsTCP11 gene into the vector pYLCRISPR / Cas9P ubi -H built;

[0009] The target nucleotide sequence of the OsTCP11 gene is: AAGCTTGTCGATCTCGGCCTggg.

[0010] The present invention provides the rice OsTCP11 gene and its application in rice disease resistance. This is achieved by knocking out the rice OsTCP11 gene; the nucleotide sequence of the OsTCP11 gene is shown in SEQ ID NO. 1; the knockout is achieved using CRISPR / Cas9 gene editing technology; the target nucleotide sequence of the OsTCP11 gene is: AAGCTTGTCGATCTCGGCCTggg. The present invention uses CRISPR / Cas9 technology to knock out the OsTCP11 gene, obtaining a knockout mutant, ostcp11. Rice blast resistance testing revealed that compared with wild-type rice, the knockout mutant ostcp11 was more resistant to the disease, with smaller lesions and fewer blast fungi on diseased leaves, indicating that OsTCP11 negatively regulates rice resistance to rice blast. The knockout mutant ostcp11, lacking the OsTCP11 gene, exhibits enhanced resistance to rice blast. Resistance to rice bacterial blight was identified in the OsTCP11 knockout mutant, which was more resistant than wild-type rice, with significantly shorter lesions than the wild-type. This suggests that OsTCP11 negatively regulates rice resistance to bacterial blight. The knockout mutant, ostcp11, lacks the OsTCP11 gene and exhibits enhanced resistance to bacterial blight, suggesting potential for widespread practical application. This invention facilitates the development of rice varieties resistant to both rice blast and bacterial blight, providing a basis for the subsequent screening of rice varieties with high and broad-spectrum resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 Schematic diagram of knocking out the gene OsTCP11 in the rice Nipponbare (NIP) background using CRISPR / Cas9 gene editing technology;

[0012] Figure 2 Analysis of the resistance of the OsTCP11 mutant to rice blast; A shows the phenotypes of the wild-type Nipponbare (NIP) and the ostcp11 mutant after inoculation with rice blast fungus; B shows the results of the detection of the amount of rice blast fungus in the leaves of the wild-type Nipponbare (NIP) and the ostcp11 mutant after inoculation with rice blast fungus.

[0013] Figure 3 Analysis of the resistance of OsTCP11 mutants to bacterial blight; A shows the phenotypes of wild-type Nipponbare (NIP) and the ostcp11 mutant after inoculation with bacterial blight pathogen; B shows the statistical results of leaf lesion length of wild-type Nipponbare (NIP) and the ostcp11 mutant after inoculation with bacterial blight pathogen. DETAILED DESCRIPTION

[0014] Example 1 Cloning of OsTCP11 gene

[0015] Cloning primers for the target gene OsTCP11 (base sequence shown in SEQ ID NO. 1, amino acid sequence shown in SEQ ID NO. 2) were designed using Primer Premier 5.0. The specific sequences are as follows. RNA was extracted from the rice variety Nipponbare (Oryza sativa L. var. Nipponbare) and reverse transcribed into cDNA. Using this cDNA as a template, PCR amplification with cloning primers yielded an 885-bp PCR product containing nucleotides 1 to 885 of the sequence shown in SEQ ID NO: 1.

[0016] OsTCP11-F: ATGACAAGCAATAACAGC;

[0017] OsTCP11-R: TCATCCCTGGCTTCCAGAG.

[0018] The PCR amplification system was prepared according to the Phusion DNA Polymerase instruction manual, specifically: 10 μL of 2× PhantaMax Buffer, 0.4 μL of dNTP Mix, 0.8 μL of upstream primer (10 μM), 0.8 μL of downstream primer (10 μM), 400 ng of cDNA template, 0.4 μL of Phusion DNA Polymerase, and ddH2O to 20 μL.

[0019] The PCR reaction system was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 60 s, for 32 cycles; and full extension at 72°C for 5 min.

[0020] Example 2 Construction of OsTCP11 gene mutants

[0021] 1. Construction of OsTCP11 gene mutants using CRISPR / Cas9 gene editing technology

[0022] Using the website http: / / skl.scau.edu.cn / , the editing target site of the target gene OsTCP11 (base sequence as shown in the sequence list SEQID NO.1) was designed. The target site location is as follows: Figure 1 The target nucleotide sequence is shown in Figure 2, where the target nucleotide sequence is: AAGCTTGTCGATCTCGGCCTggg (the last three bases are PAM sites). The candidate target nucleotide sequence was inserted into the intermediate vector pYLsgRNA-OsU6a, and then the OsU6a-target-sgRNA fragment was inserted into the final vector pYLCRISPR / Cas9P using the BsaI restriction site through Golden Gate cloning. ubi -H (for specific construction steps, please refer to: MaXingliang, Zhang Qunyu, Zhu Qinlong, Liu Wei, Chen Yan, Qiu Rong, Wang Bin,Yang Zhongfang, et al. (2015) A robust CRISPR / Cas9 system for convenient,high-efficiency multiplex genome editing in monocot and dicot plants.Molecular Plant, 8(8), 1274-1284.). The successfully constructed CRISPR / Cas9 vector was transformed into callus induced from immature embryos of wild-type Nipponbare by Agrobacterium-mediated method, and positive transgenic plants were obtained by hygromycin screening.

[0023] 2. Molecular identification of editing forms in positive transgenic plants

[0024] Using rice leaf genomic DNA as a template, PCR amplification was performed with the following identification primers. The amplified products were subjected to Sanger sequencing to analyze the editing form of the mutant.

[0025] The primers for identifying OsTCP11 gene mutants are:

[0026] OsTCP11-CRISPR-F:ATAACAGCACGAATGAGGAGCT;

[0027] OsTCP11-CRISPR-R:GCGAGTTGTGAGCCGAAG.

[0028] The PCR amplification system was prepared according to the instruction manual of 2×Es Taq MasterMix (Dye), specifically: 10 μL of 2×Es Taq MasterMix (Dye), 0.8 μL of upstream primer (10 μM), 0.8 μL of downstream primer (10 μM), 1 μg of DNA template, and ddH2O to 20 μL.

[0029] The PCR reaction system was as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, for 35 cycles; and extension at 72°C for 2 min.

[0030] The results are as follows Figure 1 As shown, two homozygous knockout mutant lines, ostcp11-14 and ostcp11-15, were obtained. In ostcp11-14 and ostcp11-15, a G and A were inserted 332 bp downstream of the ATG start codon of the OsTCP11 gene, respectively, resulting in a frameshift mutation and a premature stop codon at 655-657 bp.

[0031] Example 3 Identification of Rice Blast Resistance by Spray Inoculation

[0032] The wild-type Nipponbare (NIP) and knockout mutant lines ostcp11-14 and ostcp11-15 were planted in seedling trays and inoculated with rice blast fungus when they grew to the five-leaf stage.

[0033] The TCB strain of the rice blast fungus preserved on filter paper was inoculated onto a tomato oatmeal solid medium plate for activation. Mycelia were scraped and transferred to a new tomato oatmeal medium plate for expansion. The mycelia were broken and placed in a 26°C blacklight incubator to induce sporulation. The plate was washed with 0.1% Tween and filtered to obtain the rice blast spore eluate. The spore concentration was adjusted to 3.0×10 5 / mL, set aside.

[0034] During inoculation, rice leaves were evenly sprayed with 0.1% Tween, followed by a suspension of rice blast fungi. After inoculation, the leaves were incubated in the dark for 24 hours. After removing the shade cloth, the spores were incubated under normal light conditions. Six days after inoculation, photos were taken to record the disease. Simultaneously, the bacterial load on diseased leaves was determined using real-time fluorescence quantitative PCR. Genomic DNA was extracted from equal amounts of leaves from the wild-type Nipponbare (NIP) and the knockout mutant ostcp11. Real-time fluorescence quantitative PCR was performed using the following primers to compare the blast load on leaves from the wild-type NIP and the knockout mutant ostcp11, thereby completing the evaluation of the knockout mutant's resistance to rice blast.

[0035] Real-time fluorescence quantitative PCR primers are:

[0036] MoPot2-F: ACGACCCGTCTTTACTTATTTGG;

[0037] MoPot2-R:AAGTAGCGTTGGTTTTGTTGGAT;

[0038] OsUbi-F:GCCCAAGAAGAAGATCAAGAAC;

[0039] OsUbi-R: AGATAACAACGGAAGCATAAAAGTC.

[0040] The fluorescence quantitative PCR amplification system was prepared according to the 2×SYBR qPCR Mixture instruction manual: 5 μL of 2×SYBR qPCR Mixture, 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), 0.6 μL of DNA template, and ddH2O to 10 μL. Each sample was replicated three times.

[0041] The fluorescence quantitative PCR reaction system was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 30 s, annealing at 60°C for 1 min, 40 cycles; and extension at 72°C for 2 min.

[0042] The results are as follows Figure 2 As shown, compared with the wild type, the amount of rice blast fungi in the leaves of the homozygous knockout mutant lines ostcp11-14 and ostcp11-15 was significantly lower than that of the wild type, indicating that after the gene OsTCP11 was knocked out, the wild type's resistance to rice blast was significantly enhanced.

[0043] Example 4 Identification of resistance to bacterial blight using the leaf clipping inoculation method

[0044] The wild-type Nipponbare (NIP) and knockout mutant lines ostcp11-14 and ostcp11-15 were grown in a greenhouse, and the rice was inoculated with bacterial blight pathogen after 6 weeks of growth.

[0045] First, streak the PXO99A bacterial blight pathogen frozen at -80°C onto a beef extract peptone solid medium plate containing cephalexin and incubate at 28°C for one day. Then, pick a single colony and transfer it to beef extract peptone liquid medium containing cephalexin. After incubating at 28°C with shaking for 48 hours, harvest the cells by centrifugation at 9000 rpm for 3 minutes. Resuspend the cells in 0.1 M MgCl₂ solution, centrifuge at 9000 rpm for 3 minutes, discard the supernatant, repeat this process, and finally resuspend the cells in 0.1 M MgCl₂ solution. Adjust the suspension to an OD value of 0.8 using a spectrophotometer before use.

[0046] For inoculation, six-week-old rice plants were moved to a location with adequate sunlight and no rain. Sterile scissors were used to shave the bacterial suspension approximately 10 cm below the tip of the penultimate leaf of each rice plant. The leaves were then left to rest for two weeks, periodically sprayed with distilled water to keep them moist. After two weeks, the length of the lesions was measured and compared on leaves of the wild-type NIP and knockout mutant lines ostcp11-14 and ostcp11-15, thereby completing the evaluation of the knockout mutants' resistance to bacterial blight.

[0047] The results are as follows Figure 3 As shown, compared with the wild type, the length of the lesions on the leaves of the knockout mutant lines ostcp11-14 and ostcp11-15 was significantly shorter than that of the wild type, indicating that the knockout mutant lines ostcp11-14 and ostcp11-15 had significantly enhanced resistance to bacterial blight.

Claims

1. Use of the rice OsTCP11 gene having a nucleotide sequence as shown in SEQ ID NO. 1 in preparing or breeding rice varieties resistant to rice blast and rice bacterial blight; The application is to knock out the OsTCP11 gene in a rice variety whose nucleotide sequence is shown as SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The knockout is performed using CRISPR / Cas9 technology, and the nucleotide sequence of the knockout target is: AAGCTTGTCGATCTCGGCCTggg.

3. The use according to claim 2, characterized in that: The gene knockout vector used for the knockout is constructed by inserting the nucleotide sequence: AAGCTTGTCGATCTCGGCCTggg into the vector pYLCRISPR / Cas9Pubi-H.