Escherichia coli gene deletion strain, construction method, application and vaccine

Abstract

The invention relates to the field of veterinary biological products, and discloses a construction method of an avian pathogenic Escherichia coli gene deleted strain, a primer group is designed according to an hfq gene sequence published on an NCBI website, the primer group comprises an upstream primer hfq-kan-F and a downstream primer hfq-kan-R, the nucleotide sequence of the upstream primer hfq-kan-F is shown as SEQ ID NO: 1, the nucleotide sequence of the downstream primer hfq-kan-R is shown as SEQ ID NO: 2, and the nucleotide sequence of the downstream primer hfq-kan-R is shown as SEQ ID NO: 3. The nucleotide sequence of the downstream primer hfq-kan-R is as shown in SEQ ID NO: 2, and a targeting DNA fragment for knocking out the hfq gene is obtained by combining a pKD4 plasmid as a template with the primer group obtained in the step 1 through a Red recombination technology; then, the targeted DNA fragment is introduced into avian pathogenic escherichia coli, the avian pathogenic escherichia coli is sequentially placed in a kanamycin-containing culture medium and an ampicillin-containing culture medium to be cultured, a converter without ampicillin and kanamycin at the same time is selected after culture, and an avian pathogenic escherichia coli gene deletion strain is obtained; the invention further discloses an avian pathogenic Escherichia coli gene deletion strain, application of the avian pathogenic Escherichia coli gene deletion strain and an avian pathogenic Escherichia coli vaccine.

Description

Technical Field

[0001] The present invention relates to the field of veterinary biological products, and in particular to an Escherichia coli gene-deficient strain and its construction method, application and vaccine. Background Art

[0002] Escherichia coli is the common name for Escherichia coli, a member of the Enterobacteriaceae family and the genus Escherichia. It was first isolated by the German scientist Entero, bacteriaceae from infant feces with the help of a microscope in 1885. By the mid-20th century, relevant scholars began to discover that some special serotypes of Escherichia coli are pathogenic to animals and humans. There are many serotypes of Escherichia coli in nature, but most of them are normal intestinal flora of animals and humans, and have a certain regulatory effect on intestinal physiological functions. Only a small number of serotypes are pathogenic, usually manifesting as severe diarrhea and sepsis, pneumonia, urinary tract infections, etc. for young livestock and children. Escherichia coli is a Gram-negative short rod, without spores and capsules. Most strains move by peritrichous flagella with blunt ends, and exist in pairs or scattered distribution. It is a facultative anaerobic bacterium and can grow well on ordinary culture media. After culturing at 37°C and pH between 7.2 and 7.4 for 18 to 24 hours, it can form smooth, moist, light gray, transparent colonies with neat edges. It generally grows poorly or not on Salmonella and Shigella agar medium (SS), and those that grow may show red colonies. It will produce black colonies with metallic luster when grown on eosin-methylene blue agar.

[0003] It grows vigorously in the nutrient medium, making the broth medium highly turbid and easily dispersed by shaking; the biochemical reaction is relatively active, the VP test is negative, the indole and MR tests are both positive, it cannot utilize sodium malonate and citrate, does not liquefy gelatin, does not produce urease, phenylalanine dehydrogenase and hydrogen sulfide, and cannot grow on potassium cyanide medium.

[0004] In addition, APEC-infected poultry often presents with air sac inflammation, perihepatitis, pericarditis, head swelling, and respiratory fibrinous exudation as the main characteristic symptoms. In severe cases, it can lead to systemic bacteremia, decreased egg production in laying hens, and increased mortality rates in broiler chickens. It often forms mixed infections with other poultry respiratory diseases, aggravating the condition and causing serious economic losses. In recent years, under the general environment of "antibiotic reduction and restriction" in the livestock and poultry farming industry, the incidence of APEC has increased. APEC has many virulence factors and a complex immune mechanism. The preparation and use of traditional inactivated vaccines are cumbersome and cannot meet clinical needs. Antigenic drift can easily lead to immune failure. The use of modern genetic engineering technology to prepare APEC attenuated live vaccines can provide an effective technical means for the prevention and control of the disease.

[0005] In bacteria, regulatory non-coding RNA is usually called small RNA (sRNA). The size of this type of RNA molecule is usually between 50 and 300 nt. Most of them do not encode proteins, but act as RNA regulators to regulate gene expression in bacteria under specific environments. Hfq plays an important mediating role in the regulation of sRNA, especially in trans-action, and is one of the most important sRNA binding proteins known so far. Although the specific mechanism of action of Hfq is not yet fully understood, existing data show that Hfq plays an important role at least in the translation process and the stability of RNA. At the translation level, Hfq mainly has two regulatory modes: positive and negative. The first way (negative regulation): the target mRNA can be translated normally. After Hfq binds to the sRNA that regulates the mRNA, it acts on the ribosome-binding site (RBS) of the mRNA, preventing the ribosome from being in place, thereby hindering the normal translation. In addition, some bases on the 5' untranslated region of the target mRNA can self-complementarily pair, and the secondary structure formed masks the ribosome binding site, hindering the translation of mRNA. The second way of action of Hfq (positive regulation): Hfq first forms a complex with the sRNA that regulates the target mRNA. The complex can open the secondary structure on the 5' untranslated region of the mRNA, thereby exposing the ribosome binding site, activating the inhibited mRNA, and promoting the normal translation.

[0006] Chinese patent application 202011402244.4 discloses an avian Escherichia coli vaccine strain, which is a attenuated strain prepared by removing the aroA gene. The attenuated strain retains the natural immunogenicity of the prevalent strain Escherichia coli O78, while its toxicity is significantly weakened, and can be used to prepare live vaccines.

[0007] Li Rongxu from Foshan University of Science and Technology knocked out the hfq gene of goose-derived Salmonella Typhimurium in his master's thesis "Construction of crp and hfq gene deletion strains of goose-derived Salmonella Typhimurium and determination of its biological and immune characteristics". The scheme used the full gene sequence of Salmonella Typhimurium LT2 strain obtained from NCBI (NC_003197.2) as a reference template to design primers hfq-Cm-F and hfq-Cm-R. The nucleotide sequence of hfq-Cm-F is TTGGTGAATGGTATTAAGCTGCAAGGTCAAATCGAGTCCTTTA TTGCAGCATTACACGTC, and hfq-Cm-RTTGGTGAATGGTATTAAGCTGCAAGGT CAAATCGAGTCCTTTATTGCAGCATTACACGTC, this scheme knocks out the hfq gene through the above-mentioned primers combined with RED homologous recombination technology to obtain the A29Δcrp strain lacking the hfq gene, and in the subsequent experiments, it was found that the virulence of A29Δhfq was 202.2 times lower than that of the wild-type strain. It can be seen that the technical inspiration that the above scheme can give us is that the knockout of the hfq gene in goose-derived Salmonella Typhimurium can reduce the virulence of goose-derived Salmonella Typhimurium to a certain extent.

[0008] The problem that this scheme needs to solve is: how to provide a gene-deficient strain of avian pathogenic Escherichia coli with weaker toxicity and extremely weak resistance to some antibiotics. Summary of the invention

[0009] The purpose of the present application is to provide a gene-deficient strain of avian pathogenic Escherichia coli with weak virulence and no resistance to ampicillin and kanamycin.

[0010] Unless otherwise specified in this application: nM represents nanomoles / liter, uM represents micromoles / liter, mM represents millimoles / liter, and M represents moles / liter;

[0011] To achieve the above object, the present application discloses a method for constructing a gene-deficient strain of avian pathogenic Escherichia coli, comprising the following steps:

[0012] Step 1: Design a primer set according to the hfq gene sequence published on the NCBI website, the primer set comprising an upstream primer hfq-kan-F and a downstream primer hfq-kan-R, the nucleotide sequence of the upstream primer hfq-kan-F is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer hfq-kan-R is shown in SEQ ID NO: 2;

[0013] Step 2: Using Red recombination technology with pKD4 plasmid as template and the primer set obtained in step 1, a target DNA fragment for knocking out the hfq gene is obtained;

[0014] Step 3: Introduce the targeting DNA fragment obtained in step 2 into avian pathogenic Escherichia coli, and culture it in culture media containing kanamycin and ampicillin in turn. After culture, select the transformants that do not contain both ampicillin and kanamycin to obtain avian pathogenic Escherichia coli gene-deficient strains.

[0015] Preferably, in step 3, the method for introducing the pKD4 plasmid after knocking out the hfq gene into avian pathogenic Escherichia coli is electroporation, and the parameters during the electroporation process are 1.8KV, 2.0mA, and 3.0ms.

[0016] Preferably, in the culture medium containing ampicillin, the concentration of ampicillin is 100 μg / mL;

[0017] The concentration of kanamycin in the kanamycin-containing medium was 50 μg / mL.

[0018] In addition, the present application also discloses an avian pathogenic Escherichia coli gene-deficient strain, which is prepared by the above-mentioned method for constructing the avian pathogenic Escherichia coli gene-deficient strain.

[0019] Preferably, the resistance of the gene-deficient strain of avian pathogenic Escherichia coli to streptomycin, sulfamethoxazole and tetracycline is no more than 2 μg / mL.

[0020] In addition, the present application also discloses a use of the above-mentioned avian pathogenic Escherichia coli gene-deficient strain as an active ingredient of an avian pathogenic Escherichia coli vaccine.

[0021] In addition, the present application also discloses an avian pathogenic Escherichia coli vaccine, which contains the above-mentioned avian pathogenic Escherichia coli gene-deficient strain.

[0022] The beneficial effects of this application are:

[0023] The present application obtains an APEC genetically engineered attenuated strain without resistance gene markers by knocking out the hfq gene in avian pathogenic Escherichia coli through targeted DNA fragments, and provides an effective technical means for the prevention of diseases caused by the bacteria and the preparation of vaccines. In addition, experiments have shown that the attenuated strain (Escherichia coli gene-deficient strain) has a significant immune protection effect on the parent strain. DETAILED DESCRIPTION

[0024] Example 1

[0025] 1.1 Amplification of hfq gene deletion targeting fragment

[0026] The APEC hfq gene deletion strain was constructed using Red recombination technology. The primers designed according to the hfq gene sequence published on the NCBI website were used to amplify the homologous recombination targeting fragment of the hfq gene. The primer sequences are shown in Table 1. A DNA fragment of about 1578 bp can be amplified using the pKD4 plasmid as a template.

[0027] Table 1: Primer information

[0028]

[0029]

[0030] 1.2 Construction of hfq gene deletion strain

[0031] Prepare APEC competent cells containing pKD46 plasmid, resuscitate waterfowl pathogenic Escherichia coli on LB plates, and shake culture in LB medium until the logarithmic growth phase. 1 μg of pKD46 plasmid was introduced into APEC in the form of electrotransformation (1.8KV, 2.3mA, 2.1ms), and then the transformed bacterial solution was coated on a resistance plate containing 100 μg / mL ampicillin, placed in a 30°C incubator for overnight culture, and transformants containing ampicillin resistance were screened. Pick a single colony and inoculate it in LB medium containing 100 μg / mL ampicillin, shake and culture at 30°C until OD600 is 0.2, add 0.5% L-arabinose, induce for 2h, until OD600 reaches 0.5, take 1mL of bacterial solution and centrifuge at 5000rpm for 5min, collect the bacteria and resuspend them in 100 μL LB medium for standby use.

[0032] Take 100 μL of APEC competent cells containing pKD46 plasmid, introduce 1 μg of the target gene fragment into APEC by electroporation (1.8KV, 2.0 mA, 3.0 ms), and quickly add 3 mL of LB liquid culture medium containing 0.5% L-arabinose after electroporation, transfer to a 15 mL shaking bacterial tube after mixing, and place in a 30°C incubator for overnight culture. Then take an appropriate amount of bacterial liquid and spread it on a resistance plate containing 50 μg / mL kanamycin, place it in a 37°C incubator for 1 day, and screen the transformants with kanamycin resistance.

[0033] Pick a single APEC colony transformed with the targeted gene fragment, culture it at 37°C until the logarithmic phase of growth, introduce 1 μg of pCP20 plasmid into APEC by electroporation (1.8KV, 2.0mA, 3.0ms), spread it on a plate containing 100 μg / mL ampicillin, culture it at 30°C overnight, then transfer it to 42°C for culture, take an appropriate amount of bacterial solution and spread it on a resistance plate to verify whether the resistance is eliminated, and pick the transformants without ampicillin and kanamycin resistance for PCR identification and sequencing verification.

[0034] 1.3 Virulence of wild-type APCE strains and hfq gene mutants to chicks

[0035] The APEC wild-type strain and the hfq gene-deficient strain were cultured in LB medium with shaking until the logarithmic growth phase. 6 CFU / chicken, intramuscular injection of 7-day-old SPF chickens, 10 in each group, and continuous observation for 10 days, statistically analyzing the mortality and morbidity of APEC wild strains and hfq gene deletion strains in SPF chickens. The results showed that the morbidity and mortality caused by APEC wild strains in 7-day-old chicks reached 100%, while the hfq gene deletion strain only caused 50% morbidity and 0% mortality, indicating that the virulence of the hfq gene deletion strain was significantly reduced.

[0036] Table 2

[0037] Challenge strain Challenge dose Incidence mortality rate wild strain <![CDATA[1×10 6 CFU / per animal]]> 100％(10 / 10) 100％(10 / 10) hfq gene deletion strain <![CDATA[1×10 6 CFU / per animal]]> 0％(50 / 10) 0％(0 / 10)

[0038] 1.4 Immune protection of hfq gene mutants against wild-type virus

[0039] Twenty 7-day-old SPF chickens were randomly divided into two groups, with 10 chickens in each group. 5 CFU / each mouse was inoculated with hfq gene deletion strain solution, and the control group was inoculated with the same dose of PBS. 6 The SPF chickens were challenged with the virus by intramuscular injection at a dose of 100 CFU / each, and the mortality and morbidity of the immunized and control groups were calculated. The results are shown in Table 3. SPF chickens orally immunized with the hfq gene-deficient strain can resist the challenge with the lethal dose of APEC wild-type virus 14 days after immunization.

[0040] Table 3

[0041]

[0042] The drug resistance of APCE wild strain and hfq gene mutant strain was further verified, and the results are shown in Table 4:

[0043] Table 41.5 Comparison of drug resistance between wild-type APCE strains and hfq gene mutants

[0044]

[0045] According to the results in Table 4, after the hfq gene mutation, the resistance of the hfq gene mutant to ampicillin and kanamycin was comparable to that of the APCE wild-type strain, but surprisingly, the resistance of the hfq gene mutant to streptomycin, sulfisoxazole, and tetracycline showed a significant downward trend;

[0046] The reason for this phenomenon may be that Hfq is involved in regulating the expression of many genes related to antibiotic resistance. The loss of the hfq gene may lead to a decrease in the expression level of these genes, thereby reducing bacterial resistance;

[0047] It is also possible that Hfq affects the expression or function of membrane proteins related to drug efflux pumps. Drug efflux pumps are one of the important mechanisms for bacteria to resist antibiotics, and the loss of Hfq may lead to impaired function of these pumps;

[0048] In addition, Hfq plays a role in bacterial response to environmental stress (such as antibiotic pressure), and the loss of hfq may weaken the stress response ability of bacteria, making them more susceptible to antibiotics;

[0049] Hfq may also affect certain metabolic pathways, which may be related to the mechanism of action of antibiotics. Changes in metabolic pathways may make bacteria more sensitive to antibiotics.

Claims

1. A method for constructing a gene-deficient strain of avian pathogenic Escherichia coli, characterized in that: The following steps are involved: Step 1: Design a primer set according to the hfq gene sequence published on the NCBI website, the primer set comprising an upstream primer hfq-kan-F and a downstream primer hfq-kan-R, the nucleotide sequence of the upstream primer hfq-kan-F is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer hfq-kan-R is shown in SEQ ID NO: 2; Step 2: Using Red recombination technology with pKD4 plasmid as template and the primer set obtained in step 1, a target DNA fragment for knocking out the hfq gene is obtained; Step 3: Introduce the targeting DNA fragment obtained in step 2 into avian pathogenic Escherichia coli, and culture it in culture media containing kanamycin and ampicillin in turn. After culture, select the transformants that do not contain both ampicillin and kanamycin to obtain avian pathogenic Escherichia coli gene-deficient strains.

2. The method for constructing a gene-deficient strain of avian pathogenic Escherichia coli according to claim 1, characterized in that: In step 3, the method for introducing the pKD4 plasmid after knocking out the hfq gene into avian pathogenic Escherichia coli is electroporation, and the parameters during the electroporation process are 1.8KV, 2.0mA, and 3.0ms.

3. The method for constructing a gene-deficient strain of avian pathogenic Escherichia coli according to claim 1, characterized in that: In the medium containing ampicillin, the concentration of ampicillin was 100 μg / mL; The concentration of kanamycin in the kanamycin-containing medium was 50 μg / mL.

4. A gene-deficient strain of avian pathogenic Escherichia coli, characterized in that: The method is prepared by the construction method of the avian pathogenic Escherichia coli gene-deficient strain described in any one of claims 1-3.

5. The avian pathogenic Escherichia coli gene-deficient strain according to claim 4, characterized in that: The resistance of the avian pathogenic Escherichia coli gene-deficient strain to streptomycin, sulfamethoxazole and tetracycline is no more than 2 μg / mL.

6. Use of the gene-deficient strain of avian pathogenic Escherichia coli as claimed in any one of claims 4 to 5 as an active ingredient of an avian pathogenic Escherichia coli vaccine.

7. An avian pathogenic Escherichia coli vaccine, characterized in that: A gene-deficient strain of avian pathogenic Escherichia coli comprising any one of claims 4-5.

Images