Bimolecular fluorescence complementation system for testing interaction of plant proteins and application of bimolecular fluorescence complementation system

Abstract

The invention provides a bimolecular fluorescence complementation system for testing interaction of plant proteins, which comprises a pBiFC-NLS-DsRED2-Enc vector integrated with an NLS-DsRed2 expression cassette and an nEYFP expression cassette, and a pBiFC-Ecc vector containing a cEYFP expression cassette. When the nEYFP expression cassette and the cEYFP expression cassette are respectively subjected to fusion expression with interacting proteins, the two non-fluorescent expression cassettes are pulled close to generate YFP fluorescence, the NLS-DsRed2 expression cassette simultaneously generates red fluorescence capable of specifically indicating cell nucleus positioning, and the two types of fluorescence are clear and stable in imaging effect and are mutually independent. Therefore, the system can be used for carrying out convenient, low-cost and safe plant bimolecular fluorescence complementation experiment operation.

Description

Technical Field

[0001] The invention relates to a bimolecular fluorescence complementation system for testing plant protein interaction and application thereof, belonging to the technical fields of molecular biology, biotechnology and genetic engineering. Background Art

[0002] Protein interaction is an important part of studying protein biological functions and signaling pathway networks. Bimolecular fluorescence complementation (BiFC) experiments are a common and powerful method for detecting protein interactions using the luminescent properties of fluorescent proteins. They can directly and quickly determine the interaction and subcellular localization of proteins. Determining the subcellular localization of target proteins by fusion with the expression of fluorescent protein reporter genes is also the most widely used method. The principle of bimolecular fluorescence complementation experiments is to split fluorescent proteins (such as EYFP) into N-terminal and C-terminal and form corresponding complete expression cassettes. After connecting them to the proteins to be detected, the recombinant vectors are co-transfected into tobacco mesophyll cells. If the two proteins can interact, the N-terminal fragment and C-terminal of the fluorescent protein will be close to each other, so that the fluorescent protein will re-emit fluorescence. If there is no interaction between the two proteins, fluorescence cannot be excited. Conducting bimolecular fluorescence complementation experiments usually requires markers located in the cell nucleus. Generally, the control empty vector located in the cell nucleus or the fluorescent dye DAPI can be used to indicate the location of the cell nucleus. However, both methods have certain limitations. The former requires co-transfection of an additional Agrobacterium containing a nuclear localization control vector, and the latter is hazardous because DAPI is a highly toxic carcinogen that can penetrate biological membranes. Therefore, it is necessary to provide a low-cost, safe and convenient method for conducting bimolecular fluorescence complementation experiments. Summary of the invention

[0003] The technical problem to be solved by the present invention is to overcome the shortcomings of the prior art and provide a bimolecular fluorescence complementation system and application for examining the interaction between plant proteins. By introducing the nuclear-localized DsRED2 red fluorescent marker into the bimolecular fluorescence complementation system, the use of the highly toxic and carcinogenic DNA fluorescent dye DAPI and the use of a nuclear localization control vector alone can be avoided, and the system is suitable for studying the interaction between plant proteins.

[0004] The present invention provides a bimolecular fluorescence complementation system for testing plant protein interactions, comprising a pBiFC-NLS-DsRED2-Enc vector and a pBiFC-Ecc vector, wherein the pBiFC-NLS-DsRED2-Enc vector comprises a red fluorescent protein expression cassette NLS-DsRed2 that can specifically indicate nuclear localization and an nEYFP expression cassette DNA molecule that cannot generate fluorescence alone; The red fluorescent protein expression cassette NLS-DsRed2 is an expression cassette composed of a SuperPromoter promoter sequence, a COR47-5′UTR sequence, a cell nuclear localization signal NLS sequence, a red fluorescent protein DsRed2 coding region sequence and a terminator HSP-T878 sequence connected in sequence; The nEYFP expression cassette DNA molecule is an expression cassette composed of 2×CaMV 35S promoter sequence, Translational enhancer sequence, NC Frame sequence, nEYFP coding region sequence and CaMV 35S terminator sequence connected in sequence; The pBiFC-Ecc vector contains a cEYFP expression cassette DNA molecule that cannot generate fluorescence alone. The cEYFP expression cassette DNA molecule is an expression cassette composed of 2×CaMV 35S promoter sequence, translational enhancer sequence, NC Frame sequence, cEYFP coding region sequence and CaMV 35S terminator sequence connected in sequence.

[0005] The present invention improves the BiFC expression vector for testing plant protein interactions by using NLS-DsRED2 fusion protein that can specifically indicate cell nuclear localization, SuperPromoter with stronger initiation activity, translation initiation enhancer COR47-5′UTR and HSP-T878 terminator that can significantly increase gene expression. The bimolecular fluorescence complementation system pBiFC-NLS-DsRED2-Enc vector and pBiFC-Ecc vector of the present invention are integrated with NLS-DsRed2 fluorescent protein with enhanced expression. After being fused with a group of interacting proteins respectively, clear and stable red DsRED2 fluorescent signals and green YFP fluorescent signals can be emitted respectively under different excitation lights, and there is no signal cross-interference. The red fluorescent signal can be accurately and specifically located in the cell nucleus, and the YFP fluorescent signal can detect the localization of the interaction between the two proteins.

[0006] The present invention provides a bimolecular fluorescence complementation system for testing plant protein interactions, including a pBiFC-NLS-DsRED2-Enc vector and a pBiFC-Ecc vector. Studies have found that the nuclear localization signal NLS can stably and specifically localize proteins to the nucleus. Therefore, a stronger SuperPromoter promoter, a translation initiation enhancer COR47-5′UTR, and an HSP-T878 terminator that can significantly increase the amount of gene expression are used to enhance the fluorescent protein signal, and the fluorescent protein DsRed2 is specifically localized to the nucleus through the nuclear localization signal NLS, and the DsRed2 expression cassette is co-expressed in series in the pBiFC-Enc vector. The nEYFP and cEYFP in the two vectors can be fused to the interacting proteins respectively and then brought close to regenerate YFP fluorescence, which can realize the innovative development and application of plant protein interaction detection expression vectors with nuclear localization markers. By cloning the interacting protein encoding gene fragments into the pBiFC-NLS-DsRED2-Enc vector and the pBiFC-Ecc vector respectively, the red fluorescent signal specifically localized in the cell nucleus can be used as a nuclear localization marker under a laser confocal / fluorescence microscope. The interaction and subcellular localization of the two proteins can be detected based on the YFP fluorescent signal, without the need for contact with the highly toxic and carcinogenic DNA fluorescent dye DAPI, and the need for the additional use of a nuclear localization control vector.

[0007] The technical solution further optimized as the present invention is as follows: In the above-mentioned bimolecular fluorescence complementation system for detecting plant protein interactions, the red fluorescent protein expression cassette NLS-DsRed2 produces red fluorescence and is used to specifically indicate nuclear localization. After the nEYFP expression cassette and cEYFP expression cassette DNA molecules are fused with a protein to be detected, they are pulled closer through the interaction of the two proteins to be detected to produce YFP fluorescence, and the expression of red fluorescent protein and green fluorescent protein is detected by laser confocal / fluorescence microscopy. The two fluorescent imaging effects are clear, stable, and independent of each other. Therefore, this system can be used to perform convenient, low-cost and safe plant bimolecular fluorescence complementation experimental operations.

[0008] The nEYFP expression cassette and the cEYFP expression cassette can be fused with interacting proteins and then brought into close proximity to regenerate green YFP fluorescence. The red DsRed2 fluorescence and the green YFP fluorescence can be detected as two independent fluorescent protein signals by laser confocal / fluorescence microscopy.

[0009] In the above-mentioned bimolecular fluorescence complementation system for detecting plant protein interactions, the red fluorescent protein expression box NLS-DsRed2 has a nucleotide sequence as shown in 1-2928 nt in SEQ NO. 1, the nEYFP expression box DNA molecule has a nucleotide sequence as shown in 1-2315 nt in SEQ NO. 2, and the cEYFP expression box DNA molecule has a nucleotide sequence as shown in 1-1988 nt in SEQ NO. 3.

[0010] The pBiFC-NLS-DsRED2-Enc vector plasmid and pBiFC-Ecc vector plasmid contained in the bimolecular fluorescence complementation system for detecting plant protein interactions and their construction methods.

[0011] The pBiFC-NLS-DsRED2-Enc vector plasmid contains a red fluorescent protein NLS-DsRed2 expression cassette that specifically indicates nuclear localization and a nEYFP expression cassette gene coding sequence that cannot produce fluorescence alone, and the pBiFC-Ecc vector contains a cEYFP expression cassette gene coding sequence that cannot produce fluorescence alone.

[0012] A recombinant expression vector, recombinant bacteria, transgenic cells or expression cassette containing the pBiFC-NLS-DsRED2-Enc vector and the pBiFC-Ecc vector in the bimolecular fluorescence complementation system for detecting plant protein interactions.

[0013] The present invention is based on the starting vector pBiFC-Enc. Hin d III restriction site from 5' to 3' direction to insert the enhanced expression framework SuperPromoter-COR47-5'UTR-NLS-DsRed2-HSP-T878 DNA molecule, which is composed of SuperPromoter promoter sequence, COR47-5'UTR sequence, cell nuclear localization signal NLS sequence, red fluorescent protein DsRed2 coding region sequence and terminator HSP-T878 sequence connected in sequence. The NLS-DsRed2 fusion expression cassette DNA molecule was obtained by PCR amplification and then fused with the homologous recombination enzyme. HinThe starting vector pBiFC-Enc was connected with the single enzyme digestion of d III, and the enhanced NLS-DsRed2 expression cassette was inserted in series in the same direction on the basis of the nEYFP expression cassette to obtain the final vector pBiFC-NLS-DsRED2-Enc. The two target proteins were fused to the NC Frame sites of the pBiFC-NLS-DsRED2-Enc vector and the pBiFC-Ecc vector respectively, and the tobacco leaf flesh cells were instantly transformed after transformation of Agrobacterium. The fluorescence signal was observed by laser confocal / fluorescence microscopy to judge the protein interaction. The fusion expression cassette based on the red fluorescent protein DsRed2 has the nucleotide sequence shown in 1-2928 nt in SEQ NO. 1, the nEYFP expression cassette has the nucleotide sequence shown in 1-2315 nt in SEQ NO. 2, and the cEYFP expression cassette has the nucleotide sequence shown in 1-1988 nt in SEQ NO. 3.

[0014] The present invention also provides a DNA molecule comprising the pBiFC-NLS-DsRED2-Enc and pBiFC-Ecc recombinant expression vectors in the above-mentioned bimolecular fluorescence complementation system for detecting plant protein interactions, and a transgenic recombinant bacterium or cell containing the DNA molecule and the recombinant reporter gene expression vector.

[0015] The application of the above-mentioned bimolecular fluorescence complementation system for detecting plant protein interactions is used to detect the interaction between plant proteins.

[0016] The application of the above-mentioned bimolecular fluorescence complementation system for detecting plant protein interactions is that when Agrobacterium containing recombinant expression vectors of target protein encoding genes fused in the bimolecular fluorescence complementation system are co-transformed into tobacco mesophyll cells instantaneously, it can be observed through laser confocal / fluorescence microscopy that the two non-fluorescent expression cassettes are brought together to produce green YFP fluorescence, and the NLS-DsRed2 expression cassette simultaneously produces red DsRed2 fluorescence that can specifically indicate cell nuclear localization.

[0017] The above application uses laser confocal / fluorescence microscopy to observe the fluorescence signal of Agrobacterium transiently transformed into tobacco mesophyll cells with pBiFC-NLS-DsRED2-Enc and pBiFC-Ecc recombinant expression vectors fused with a group of target protein encoding genes, and uses the red fluorescence signal located in the cell nucleus as a nuclear localization marker, and judges the interaction of plant proteins according to the generation and position of the YFP fluorescence signal, specifically including: (1) For pBiFC-NLS-DsRED2-Enc and pBiFC-Ecc empty vector plasmids that do not contain fused exogenous genes in the NC Frame, when observed using a laser confocal / fluorescence microscope, if the DsRED2 red fluorescence signal specifically localized in the cell nucleus is distributed in the tobacco mesophyll cells and there is no YFP green fluorescence signal, then the DsRED2 fluorescent protein is expressed normally; (2) For the pBiFC-NLS-DsRED2-Enc and pBiFC-Ecc recombinant vectors, which respectively contain the gene sequences encoding the interacting proteins fused in the NC Frame, when observed using a laser confocal / fluorescence microscope, if the tobacco mesophyll cells contain a red fluorescent signal specifically localized in the cell nucleus and a YFP green fluorescent signal localized according to the interaction characteristics of the target protein, then the two fluorescent proteins are expressed normally; the red fluorescent signal is a nuclear localization marker signal, and the YFP fluorescent signal is a subcellular localization signal of the proteins interacting with each other.

[0018] The pBiFC-NLS-DsRED2-Enc vector of the bimolecular fluorescence complementation system for detecting plant protein interactions of the present invention is based on the starting vector pBiFC-Enc. After the nucleotide fragment SuperPromoter-COR47-5′UTR-NLS-DsRed2-HSP-T878 is obtained by PCR amplification, it is combined with the homologous recombination enzyme Hin The starting vector pBiFC-Enc was ligated with d III single enzyme digestion, and the enhanced NLS-DsRed2 expression cassette was inserted in the same direction in series on the basis of the nEYFP expression cassette to obtain the final vector pBiFC-NLS-DsRED2-Enc. The gene coding sequences of the two target proteins to be detected for interaction were cloned into the NC Frame sites of the final vectors pBiFC-NLS-DsRED2-Enc and pBiFC-Ecc respectively through homologous recombination reaction. The obtained recombinant plasmids were transformed into Agrobacterium and can be used to detect the protein interaction after transient transformation of tobacco. The red fluorescent DsRed2 light signal located in the cell nucleus and the green YFP fluorescent signal generated according to the interaction of the target protein can be observed by laser confocal / fluorescence microscopy.

[0019] Compared with the prior art, the present invention utilizes a stronger SuperPromoter promoter, a translation initiation enhancer COR47-5′UTR and a HSP-T878 terminator that can significantly increase the amount of gene expression to improve the signal intensity of the fluorescent protein, and utilizes the cell nucleus localization signal NLS to achieve stable and specific expression of the red fluorescent protein in the cell nucleus, and comprehensively improves the application of the existing fluorescent protein in plant molecular biology. The improved bimolecular fluorescent complementary vector for detecting plant protein interactions of the present invention has the ability to connect the target DNA molecule to the NC Frame site of the nEYFP and cEYFP expression cassettes respectively through simple operations such as direct enzyme cutting and connection, to construct a recombinant reporter gene vector inserted with the target gene, and after being transferred into Agrobacterium, it can be transiently genetically transformed into tobacco through operations such as co-transfection for detecting plant protein interactions. It has been verified that the two fluorescent reporter genes DsRed2 and YFP can be stably and clearly expressed, indicating that the two promoters of the vector have transcriptional activity, and the DsRed2 red fluorescent signal specifically positioned in the cell nucleus and the YFP fluorescent signal generated according to the protein interaction can be expressed simultaneously, and are independent of each other and do not interfere with each other; the present invention can conveniently, sensitively and efficiently reflect the interaction of proteins by detecting the position of the fluorescent signal, and compared with the traditional cell nucleus localization method, the red fluorescent signal specifically positioned in the cell nucleus is used as a nuclear localization Marker, which can avoid contact with highly toxic carcinogens, and there is no need to use a nuclear localization control vector separately, which can realize the efficient detection of plant protein interaction with dual fluorescence indication of one vector and one bacteria, save the use cost and improve the safety and convenience of operation.

[0020] In summary, the present invention inserts the enhanced NLS-DsRed2 expression cassette in the same direction in series on the basis of the starting vector pBiFC-Enc to obtain the pBiFC-NLS-DsRED2-Enc vector, and together with the pBiFC-Ecc vector, forms a bimolecular fluorescence complementation system for detecting plant protein interactions. The target protein encoding gene sequence to be analyzed is cloned into the NC Frame site of the nEYFP expression cassette of the pBiFC-NLS-DsRED2-Enc vector and the cEYFP expression cassette of the pBiFC-Ecc vector, respectively. The obtained recombinant plasmid is transformed into Agrobacterium and then transiently transfected into tobacco leaf flesh cells to detect protein interactions. Under a laser confocal / fluorescence microscope, the red DsRED2 fluorescent signal is located in the cell nucleus, and the green YFP fluorescent signal produces corresponding fluorescence according to the protein interaction. The imaging effect is clear, stable, and independent of each other. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is a schematic diagram of the construction process of the plant protein interaction detection expression vector pBiFC-NLS-DsRED2-Enc and the protein interaction detection process in the present invention.

[0022] Figure 2 Fluorescence micrographs of the infected area after the empty vectors pBiFC-NLS-DsRED2-Enc and pBiFC-Ecc for plant protein interaction detection in the present invention were respectively transferred into Agrobacterium and transiently transformed in tobacco leaves. In the figure: A is bright field; B is YFP fluorescence signal detection; C is DsRed2 fluorescence signal detection; D is DAPI-labeled cell nucleus; E is the overlay of A, B and C; F is the overlay of A, B and D; G is the overlay of A, B, C and D; the scale is 100 μm.

[0023] Figure 3 The interaction between tomato SlVOZ1 and SlVOZ2 proteins was analyzed using the plant protein interaction detection vectors pBiFC-NLS-DsRED2-Enc and pBiFC-Ecc in the present invention. In the figure: A is bright field; B is YFP fluorescence signal detection; C is DsRed2 fluorescence signal detection; D is DAPI-labeled cell nucleus; E is the overlay of A, B and C; F is the overlay of A, B and D; G is the overlay of A, B, C and D; the scale is 100 μm. DETAILED DESCRIPTION

[0024] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings: This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and specific operation process are given, but the protection authority of the present invention is not limited to the following embodiments.

[0025] Unless otherwise specified, the specific methods used in the following examples are conventional methods, and the reagents used can be obtained from commercial sources, such as the conditions described in Molecular Cloning Laboratory Manual (3rd edition, J. Sambrook et al., translated by Huang Peitang et al., Science Press, 2002), or the experimental conditions guided by the manufacturer.

[0026] The plants used in the present embodiment are tomato varieties Micro-Tom ( Solanum lycopersicum ) and Nicotiana benthamiana varieties ( Nicotiana benthamiana), the seeds were stored in Jiangsu Normal University in September 2023, and the starting vectors pBiFC-Enc and pBiFC-Ecc can be purchased from BioVector Plasmid Vector Bacteria Cell Gene Collection Center and Jiangsu Normal University. Escherichia coli DH5α competent cells and Agrobacterium tumefaciens GV3101 competent cells were purchased from Beijing Bomed Gene Technology Co., Ltd.; DNA purification kits, restriction endonucleases, Taq DNA polymerase, and PrimeSTARHS DNA polymerase were all purchased from Dalian TaKaRa Company; homologous recombination reagent ClonExpress II One Step Cloning Kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd.; primer synthesis and sequencing were completed by Qingke Biotechnology Co., Ltd. (Zhengzhou), and the remaining reagents were analytical grade reagents. Example 1 Construction of the intermediate vector pCAMBIA1300-PSuper-COR47-5′UTR-NLS-DsRed2-HSP-T878

[0027] pass Bss The vector pCAMBIA1300-PSuper-COR47-5′UTR-DsRed2-HSP-T878 (for the vector preparation method, see CN117187296A) was digested with H II, and homologous recombination primers containing NLS sequences were designed: 1300-NLS-F: TAAAGCCCGGGACTGCGCGCATGCCCAAGAAGAAGAGGAAAGTC (SEQ ID No. 4) 1300-NLS-R: TCGGAGGAGGCCATGCGCCGACTTTCCTCTTCTTCTTGGGCAT (SEQ ID No. 5) The primers were resuspended in TE buffer to a final concentration of 100 μM, and then annealed after 1:1 mixing. The PCR reaction program was: 95℃ 30 s, 72℃ 2 min, 37℃ 2 min, 25℃ 2 min. The PCR product was ligated to the purified and recovered enzyme-cut starting vector pCAMBIA1300-PSuper- COR47-5′UTR-DsRed2-HSP-T878 by homologous recombinase to obtain the recombinant intermediate vector pCAMBIA1300-PSuper- COR47-5′UTR-NLS-DsRed2-HSP-T878. Example 2 Construction of vector pBiFC-NLS-DsRED2-Enc

[0028] pass HinThe starting vector pBiFC-Enc containing the nEYFP expression cassette was digested with d III and purified and recovered. The intermediate vector pCAMBIA1300-PSuper-COR47-5′UTR-NLS-DsRed2-HSP-T878 was used as a template to design homologous recombination primers for PCR amplification of the NLS-DsRed2 recombinant expression cassette, the nucleotide fragment of which was composed of the SuperPromoter promoter sequence, the COR47-5′UTR translation initiation enhancer sequence, the nuclear localization signal NLS sequence, the red fluorescent protein DsRed2 coding region sequence and the terminator HSP-T878 sequence connected in sequence.

[0029] BiFC-EnC-F: AGGTCGACGGTATCGATAAGCTTATGTGCTGCAAGGCGAT (SEQ ID No. 6) BiFC-EnC-R:GGCCGTCGTTTTACAACAAGCTTTGTGTACAGATATATGTTGAAT (SEQ ID No. 7) The PCR reaction system was: 21 μL ddH2O, 25 μL PrimeSTAR HS, 2 μL DNA template, 1 μL each of downstream primers, a total of 50 μL; the PCR reaction program was: 98 ℃ 10 s, 56 ℃ 5 s, 72 ℃ 3 min, 30 cycles.

[0030] After the PCR amplification product was detected by agarose gel electrophoresis to be of correct size, it was purified and recovered, and then connected to the purified and recovered enzyme-cut starting vector pBiFC-Enc using a homologous recombinase to obtain the recombinant vector pBiFC-NLS-DsRED2-Enc.

[0031] The construction process is as follows Figure 1 As shown, the enhanced NLS-DsRed2 recombinant fluorescent protein expression cassette has a nucleotide sequence as shown in nucleotides 1 to 2928 in SEQ NO. 1.

[0032] Example 3 Containing target protein encoding gene SvZ1 Construction of recombinant expression vector pass S The pBiFC-NLS-DsRED2-Enc vector was digested with I and purified. Using the cDNA of tomato variety Micro-Tom as a template, homologous recombination primers were designed for PCR amplification: pBiFC-NLS-Enc-F:AGTGGTCTCTGTCCAGTCCTATGGGGAAGGGTTCGAA (SEQ ID No. 8) pBiFC-NLS-Enc-R:GGTCTCAGCAGACCACAAGTCGTTATGTAGTAGCCACCTATAT (SEQ IDNo.9) The PCR reaction system was: 21 μL ddH2O, 25 μL PrimeSTAR HS, 2 μL DNA template, 1 μL each of downstream primers, a total of 50 μL; the PCR reaction program was: 98 ℃ 10 s, 56 ℃ 5 s, 72 ℃ 1 min 30 s, 30 cycles.

[0033] The PCR amplification product was purified and recovered after the size was confirmed by agarose gel electrophoresis, and then connected to the purified and recovered restriction vector pBiFC-NLS-DsRED2-Enc by homologous recombinase. After being sent to Qingke Biotechnology Co., Ltd. (Zhengzhou) for sequencing verification, pBiFC-NLS-DsRED2-Enc- SvZ1 Recombinant vector.

[0034] Example 4 Containing target protein encoding gene SvZ Construction of recombinant expression vector pass S The pBiFC-Ecc vector containing the cEYFP expression cassette was digested with I and purified and recovered. Using the cDNA of the tomato variety Micro-Tom plant as a template, homologous recombination primers were designed for PCR amplification: pBiFC-Ecc-F: AGTGGTCTCTGTCCAGTCCTATGAGGAAGGTTTCGAAG (SEQ ID No. 10) pBiFC-Ecc-R:GGTCTCAGCAGACCACAAGTCGTTATGAAGTAGCCATCCA (SEQ ID No. 11) The PCR reaction system was: 21 μL ddH2O, 25 μL PrimeSTAR HS, 2 μL DNA template, 1 μL each of downstream primers, a total of 50 μL; the PCR reaction program was: 98 ℃ 10 s, 56 ℃ 5 s, 72 ℃ 1 min 30 s, 30 cycles.

[0035] The PCR amplification product was purified and recovered after the size was confirmed by agarose gel electrophoresis, and then connected to the purified and recovered restriction vector pBiFC-Ecc by homologous recombinase. After being sent to Qingke Biotechnology Co., Ltd. (Zhengzhou) for sequencing verification, pBiFC-Ecc- SvZ Recombinant vector. Example 5 Transformation of competent cells of Agrobacterium tumefaciens GV3101, transient transformation of tobacco leaves and observation of protein interactions

[0036] According to the Agrobacterium tumefaciens competent cell transformation method, pBiFC-NLS-DsRED2-Enc empty vector, pBiFC-Ecc empty vector, pBiFC-NLS-DsRED2-Enc- SvZ1 Recombinant vector and pBiFC-Ecc- SvZ The recombinant vectors were transformed into Agrobacterium tumefaciens GV3101 strains, and then the bacterial solution was evenly spread on LB solid medium containing 50 mg / L rifampicin and 30 mg / L kanamycin, and inverted and cultured at 28°C in the dark for 2 days until a single colony grew. The positive transformation single colony was cultured in LB liquid medium containing 30 mg / L rifampicin and 50 mg / L kanamycin at 28°C, dark, and 200 rpm until the bacterial solution OD 600 After centrifugation, the cells were resuspended in an infiltration buffer containing 10 mmol / L MgCl2, 10 mmol / L MES (PH5.5) and 100 µmol / L acetosyringone and the OD value of the bacterial solution was adjusted. 600 The value reaches 0.5-0.8 and then incubate in the dark at 28℃ for 3 h.

[0037] The obtained Agrobacterium resuspension was mixed evenly according to the control verification group and the experimental test group: (1) Empty vector control verification group: The Agrobacterium resuspension containing the pBiFC-NLS-DsRED2-Enc empty vector and the Agrobacterium resuspension containing the pBiFC-Ecc empty vector were mixed evenly in a ratio of 1:1 to verify the feasibility of the modified vector; (2) Interaction protein test group: The pBiFC-NLS-DsRED2-Enc- SvZ1 Agrobacterium resuspension containing the recombinant vector and pBiFC-Ecc- SvZ The recombinant vector and Agrobacterium resuspension were mixed evenly in a 1:1 ratio to detect whether there was an interaction between the two. Use a 1 mL syringe without a needle to inject the mixed bacterial solution into the epidermal tissue on the back of different tobacco leaves. After culturing in the smart greenhouse at 27°C (16 h light) / 18°C (8 h dark) for 2 days, tear off the epidermis of the infected area of ​​the tobacco leaves transformed with the mixed Agrobacterium, stain with DAPI dye in the dark for about 7 min, and observe under a fluorescence microscope.

[0038] The observation results show that both sets of red fluorescence signals can overlap with the DAPI signal (see Figure 2 , 3), indicating that the nuclear localization signal NLS successfully localizes the red fluorescent protein DsRed2 in the cell nucleus. No YFP fluorescence signal was observed in the empty vector control group (see Figure 2 ), while the YFP fluorescence signal in the interaction protein experimental group overlapped with the red fluorescence signal and DAPI signal (see Figure 3 ), indicating that SlVOZ1 and SlVOZ2 proteins interact in the nucleus. In summary, the pBiFC-NLS-DsRED2-Enc vector in the bimolecular fluorescence complementation system for detecting plant protein interactions can localize the red fluorescent protein DsRed2 in the nucleus through NLS as a nuclear localization marker. Therefore, in the subsequent use of the vector, there is no need to use the highly toxic and carcinogenic DNA fluorescent dye DAPI, nor is there a need to use a nuclear localization control vector to achieve nuclear localization labeling. At the same time, by fusing the interacting protein encoding genes to the NC Frame sites of the pBiFC-NLS-DsRED2-Enc vector nEYFP expression cassette and the pBiFC-Ecc vector cEYFP expression cassette, dual fluorescence can be used to indicate the subcellular localization of the nuclear localization signal and the detection of protein interaction, saving use costs and improving operational safety and convenience.

[0039] The above description is only a specific implementation of the present invention, but the protection scope of the present invention is not limited thereto. Any person familiar with the technology can understand and think of any changes or substitutions within the technical scope disclosed by the present invention, which should be included in the scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A bimolecular fluorescence complementation system for testing plant protein interactions, characterized in that: It includes pBiFC-NLS-DsRED2-Enc vector and pBiFC-Ecc vector, wherein the pBiFC-NLS-DsRED2-Enc vector contains red fluorescent protein expression box NLS-DsRed2 and nEYFP expression box DNA molecules; The red fluorescent protein expression cassette NLS-DsRed2 is an expression cassette composed of a SuperPromoter promoter sequence, a COR47-5′UTR sequence, a cell nuclear localization signal NLS sequence, a red fluorescent protein DsRed2 coding region sequence and a terminator HSP-T878 sequence connected in sequence; The nEYFP expression cassette DNA molecule is an expression cassette composed of 2 × CaMV 35S promoter sequence, Translational enhancer sequence, NC Frame sequence, nEYFP coding region sequence and CaMV 35S terminator sequence connected in sequence; The pBiFC-Ecc vector comprises a cEYFP expression cassette DNA molecule, which is an expression cassette composed of 2×CaMV 35S promoter sequence, Translational enhancer sequence, NC Frame sequence, cEYFP coding region sequence and CaMV 35S terminator sequence connected in sequence.

2. A bimolecular fluorescence complementation system for testing plant protein interactions according to claim 1, characterized in that: The red fluorescent protein expression box NLS-DsRed2 generates red fluorescence and is used to specifically indicate cell nuclear localization. After the nEYFP expression box and cEYFP expression box DNA molecules are fused with a protein to be detected respectively, they are pulled closer through the interaction of the two proteins to be detected to generate YFP fluorescence. The expression of red fluorescent protein and green fluorescent protein is detected by laser confocal / fluorescence microscopy.

3. A bimolecular fluorescence complementation system for testing plant protein interactions according to claim 1, characterized in that: The red fluorescent protein expression cassette NLS-DsRed2 has a nucleotide sequence as shown in 1-2928 nt in SEQ NO. 1, the nEYFP expression cassette DNA molecule has a nucleotide sequence as shown in 1-2315 nt in SEQ NO. 2, and the cEYFP expression cassette DNA molecule has a nucleotide sequence as shown in 1-1988 nt in SEQ NO.

3.

4. The pBiFC-NLS-DsRED2-Enc vector plasmid and the pBiFC-Ecc vector plasmid contained in the bimolecular fluorescence complementation system for detecting plant protein interactions according to claim 1, 2 or 3, and a method for constructing the same.

5. The pBiFC-NLS-DsRED2-Enc vector and the pBiFC-Ecc vector contained in the bimolecular fluorescence complementation system for detecting plant protein interactions according to claim 4, characterized in that: The pBiFC-NLS-DsRED2-Enc vector plasmid contains a red fluorescent protein NLS-DsRed2 expression cassette that specifically indicates cell nuclear localization and a nEYFP expression cassette gene coding sequence that cannot generate fluorescence alone, and the pBiFC-Ecc vector contains a cEYFP expression cassette gene coding sequence that cannot generate fluorescence alone.

6. A recombinant expression vector, recombinant bacteria, transgenic cell or expression cassette containing pBiFC-NLS-DsRED2-Enc and pBiFC-Ecc in the bimolecular fluorescence complementation system for detecting plant protein interactions according to claim 5.

7. The DNA molecules of the pBiFC-NLS-DsRED2-Enc and pBiFC-Ecc recombinant expression vectors in the bimolecular fluorescence complementation system for detecting plant protein interactions as described in claim 6, and transgenic recombinant bacteria or cells containing the DNA molecules and recombinant reporter gene expression vectors.

8. Use of the bimolecular fluorescence complementation system for detecting plant protein interactions according to any one of claims 1 to 5, characterized in that: The system is used to detect plant protein interactions.

9. The use of the bimolecular fluorescence complementation system for detecting plant protein interactions according to claim 8, characterized in that: When Agrobacterium containing recombinant expression vectors of target protein encoding genes fused separately in the bimolecular fluorescence complementation system were co-transformed into tobacco mesophyll cells transiently, laser confocal / fluorescence microscopy revealed that the two non-fluorescent expression cassettes were brought together to produce YFP fluorescence, and the NLS-DsRed2 expression cassette simultaneously produced red fluorescence that could specifically indicate nuclear localization.

10. The use of the bimolecular fluorescence complementation system for detecting plant protein interactions according to claim 9, characterized in that: The fluorescence signals of Agrobacterium transiently transformed into tobacco mesophyll cells with pBiFC-NLS-DsRED2-Enc and pBiFC-Ecc recombinant expression vectors fused with a group of target protein encoding genes were observed by laser confocal / fluorescence microscopy. The red fluorescence signal located in the cell nucleus was used as a nuclear localization marker, and the interaction of plant proteins was judged according to the generation and location of the YFP fluorescence signal, including: (1) For pBiFC-NLS-DsRED2-Enc and pBiFC-Ecc empty vector plasmids that do not contain fused exogenous genes in the NC Frame, when observed using a laser confocal / fluorescence microscope, if the DsRED2 red fluorescence signal specifically localized in the cell nucleus is distributed in the tobacco mesophyll cells and there is no YFP green fluorescence signal, then the DsRED2 fluorescent protein is expressed normally; (2) For the pBiFC-NLS-DsRED2-Enc and pBiFC-Ecc recombinant vectors, which respectively contain the gene sequences encoding the interacting proteins fused in the NC Frame, when observed using a laser confocal / fluorescence microscope, if the tobacco mesophyll cells contain a red fluorescent signal specifically localized in the cell nucleus and a YFP green fluorescent signal localized according to the interaction characteristics of the target protein, then the two fluorescent proteins are expressed normally; the red fluorescent signal is a nuclear localization marker signal, and the YFP fluorescent signal is a subcellular localization signal of the proteins interacting with each other.

Images