Tobacco CBL family gene NtCBL10, biological base materials containing the same, and applications thereof

Abstract

The present invention discloses an application of a tobacco CBL family gene NtCBL10 in regulating chloride ion accumulation in tobacco leaves. The nucleotide sequence of the gene NtCBL10 is shown as SEQ ID NO.1 or SEQ ID NO.3, and the amino acid sequence encoded by the gene is shown as SEQ ID NO.2 or SEQ ID NO.4. By using transgenic technology to cultivate a new high-quality tobacco variety with the ability to regulate chloride ion absorption, the invention has great scientific significance and application value in improving tobacco combustibility, improving tobacco quality, and other aspects.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and more specifically, to the application of tobacco CBL family gene NtCBL10 in regulating chloride ion accumulation in tobacco leaves. Background Art

[0002] Tobacco is a chlorine-sensitive crop, and both low and high chlorine levels can have adverse effects on tobacco. Excessively high chlorine content in tobacco leaves results in shorter plants, smaller leaf area, duller leaf color, and less oil. It also reduces the potassium-to-chlorine ratio, directly impacting the aroma, flavor, hygroscopicity, and combustibility of the leaves, making them difficult to store and prone to spoilage. Excessively low chlorine content can lead to insufficient tobacco content, reduced elasticity, and reduced thread yield. Therefore, controlling the chloride ion content in tobacco leaves is crucial for ensuring quality.

[0003] Recent research on the chlorine content of domestic tobacco leaves has shown an imbalance in chlorine content across tobacco regions nationwide. The tobacco growing season in southern China coincides with the rainy season, resulting in low soil chlorine content in most tobacco fields in the south, which is the main reason for the low chlorine content in southern tobacco. In contrast, northern tobacco regions, particularly the Huanghuai region, have excessively high chloride ion content, a major factor affecting the smoking quality of tobacco leaves in the north. Therefore, the present invention simulates a high-chlorine environment, discovers genes that regulate chloride ion content in tobacco leaves, and applies these genes. This has great scientific significance and application value for cultivating new high-quality tobacco varieties with the ability to regulate chloride ion absorption, improving tobacco combustibility, and improving tobacco quality. Summary of the Invention

[0004] To solve the problems existing in the prior art, the present invention proposes a new application of a tobacco CBL family gene NtCBL10 in tobacco. Through identification, it is found that this gene has a new function of regulating chlorine accumulation in tobacco leaves, and expands the new use of this gene in tobacco in regulating chloride ion absorption.

[0005] The technical problem to be solved by the present invention is achieved through the following technical solutions:

[0006] The present invention provides a tobacco CBL family gene NtCBL10 for use in regulating chloride ion accumulation in tobacco leaves, wherein the nucleotide sequence of the gene comprises any one of the following (1) to (4):

[0007] (1) the nucleotide sequence shown in SEQ ID NO. 1 or SEQ ID NO. 3; or

[0008] (2) a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO. 1 or SEQ ID NO. 3; or

[0009] (3) a nucleotide sequence that adds, replaces, deletes or modifies one or more bases in the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.3 and expresses a protein with the same function; or

[0010] (4) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 3 under stringent conditions.

[0011] Preferably, the amino acid sequence of the protein encoded by the NtCBL10 gene comprises any one of the following (5) to (7):

[0012] (5) the amino acid sequence shown in SEQ ID NO. 2 or SEQ ID NO. 4; or

[0013] (6) an amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO. 2 or SEQ ID NO. 4; or

[0014] (7) Add, replace, delete or modify one or more amino acid residues in the amino acid sequence shown in SEQ ID NO. 2 or SEQ ID NO. 4, and express the amino acid sequence of a protein with the same function.

[0015] The present invention also provides a biological material comprising the NtCBL10 gene, wherein the biological material is a recombinant expression vector, an expression cassette or a recombinant bacterium.

[0016] The present invention also provides application of the above biological material in transgenic plants for regulating chlorine accumulation.

[0017] Preferably, the tobacco CBL family gene NtCBL10 gene can affect the chloride ion content in tobacco leaves, and knocking out the NtCBL10 gene can reduce the chloride ion content in tobacco leaves.

[0018] Preferably, the transgenic plant is tobacco.

[0019] The present invention also provides a method for cultivating transgenic plants with improved potassium accumulation capacity, wherein the transgenic plants are obtained by introducing the recombinant expression vector of the NtCBL10 gene into a recipient plant, or by using CRISPR / Cas9-mediated gene editing technology, a CRISPR / Cas9 gene editing vector for knocking out the NtCBL10 gene is constructed, and the transgenic plants in which the NtCBL10 gene is edited are obtained through genetic transformation.

[0020] Preferably, the promoter contained in the recombinant expression vector is a 35S promoter, and the recombinant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment; the recombinant expression vector contains the 3' untranslated region of the exogenous gene.

[0021] Preferably, the recombinant expression vector is pCAMBIA-1300-221, pGreen0029, pCAMBIA3301, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN, pORE-Cas9, pYLCRISPR / cas9-MT, pCas9gRNA7, pCas9gRNA7-GFP or other derived plant expression vectors.

[0022] When using the gene to construct a recombinant expression vector, any enhancing, constitutive, tissue-specific or inducible promoter can be added before its transcription start nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiquitin promoter (pUbi), the stress-inducible promoter rd29A, etc. They can be used alone or in combination with other plant promoters.

[0023] Furthermore, when constructing recombinant expression vectors using the genes of the present invention, enhancers, including translational enhancers and transcriptional enhancers, may also be used. These enhancer regions may be located within the ATG start codon or adjacent start codons, but must be in frame with the coding sequence to ensure proper translation of the entire sequence. The sources of translational control signals and start codons are diverse and may be natural or synthetic.

[0024] The translation initiation region can be derived from a transcription initiation region or a structural gene. To facilitate identification and screening of transgenic plant cells or plants, the recombinant expression vector can be modified, such as by adding a gene encoding a color-changing enzyme or luminescent compound that can be expressed in plants, an antibiotic resistance marker, or a chemical resistance marker gene. Alternatively, the transformed plants can be directly screened for stress without adding any selectable marker genes.

[0025] More specifically, the recombinant expression vector is a pDC45-NtCBL10 gene knockout vector.

[0026] The present invention also provides a tobacco variety, which is cultivated by using the above method.

[0027] The beneficial effects of the present invention are:

[0028] The tobacco CBL family gene NtCBL10 of the present invention is a positive regulatory factor for the chloride ion content in tobacco leaves.

[0029] The present invention can regulate the chloride ion content in tobacco leaves by adjusting the expression level of the NtCBL10 gene, and genetically engineered transgenic crops with varying NtCBL10 gene expression levels can be obtained. This invention meets the needs of modern agricultural development and has significant practical value and market prospects for regulating the chloride content in tobacco leaves, improving cigarette combustibility, and improving tobacco quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and, together with the description, serve to explain the principles of the invention.

[0031] Figure 1 Alignment of NtCBL10A and NtCBL10B protein sequences.

[0032] Figure 2 Phylogenetic tree and protein sequence alignment of CBL10 proteins. (A) Phylogenetic analysis of AtCBLs and NtCBL10A, NtCBL10B, EsCBL10a, EsCB110b, PtCBL10A, PtCBL10B, and S1CBL10 proteins. (B) Sequence alignment of CBL10 proteins from different plant sources, with identical amino acids shown in black.

[0033] Figure 3 Editing sites and sequencing peak diagram for NtCBL10 gene knockout material.

[0034] Figure 4 Figure 2 shows the phenotypes of tobacco leaves of wild-type material (WT) and double mutant (Nt-cbl10a10b) on the 8th day after high chloride treatment (the day after the NaCl concentration reached 100 mM). Scale bar = 10 cm.

[0035] Figure 5 Analysis of chloride ion content in tobacco leaves of wild-type (WT) and double mutant (Nt-cbl10a10b) plants under high chloride treatment (100 mM NaCl) and normal treatment (1 / 2 Hoagland's nutrient solution). Statistical significance was analyzed using one-way ANOVA with LSD test (*p<0.05).

[0036] Figure 6 The phenotypes of the wild-type material (WT) and the double mutant material (Nt-cbl10a10b) at different time points (0-5 days) under high chloride treatment (100 mM NaCl) conditions.

[0037] Figure 7Figure 3 shows the chloride ion content in leaves of wild-type and double mutant materials at different time points (0-5 days) under high chloride treatment (100 mM NaCl). Statistical significance was analyzed using one-way ANOVA with LSD test (*p<0.05). DETAILED DESCRIPTION

[0038] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0039] Example 1: Construction of NtCBL10 gene knockout material

[0040] 1. The NtCBL10 gene includes NtCBL10A and NtCBL10B.

[0041] The NtCBL10A gene is the CDS and UTR fragments in the LOC107817068 gene sequence (GenBank No. XM 016642847.1), as shown below:

[0042]

[0043]

[0044] The amino acid sequence of the NtCBL10A protein encoded by the NtCBL10A gene is shown below:

[0045]

[0046] The nucleotide sequence of the NtCBL10B gene is the CDS and UTR fragments in the LOC107831597 gene sequence (GenBank No. XM_016659380.1), as shown below:

[0047]

[0048]

[0049] The amino acid sequence of the NtCBL10B protein encoded by the NtCBL10B gene is shown below:

[0050]

[0051] 2. Based on the obtained NtCBL10A (SEQ ID NO: 1) and NtCBL10B sequences (SEQ ID NO: 3), the sgRNA was determined to be: CGTCCCAACAAGAAGAAGTT, and the knockout primers pDC45-NtCBL10-F / pDC45-NtCBL10-R were designed. The pDC45 plasmid was digested with BsaI restriction endonuclease to knock out the pDC45 plasmid and construct the pDC45-NtCBL10 gene knockout vector.

[0052]

[0053] Example 2: Screening and identification of NtCBL10 knockout materials

[0054] 1. Screening of NtCBL10 knockout materials. The pDC45-NtCBL10 knockout vector constructed in Example 1 was transformed into tobacco Zhongyan 100 using the Agrobacterium-mediated leaf disc method to obtain C0 generation transgenic materials. PCR amplification and sequencing were performed using primers pDC45-NtCBL10A-JCF / pDC45-NtCBL10A-JCR and pDC45-NtCBL10B-JCF / pDC45-NtCBL10B-JCR to screen for plants with different editing patterns.

[0055]

[0056] 2. To further characterize the mutational event, PCR products were deep sequenced, and data were collected and analyzed using the Hi-TOM platform. These methods were used to identify primary transformants (T1) carrying the mutant allele, which were then self-pollinated to generate T2 progeny. Homologous plants were selected from two T2 biallelic lines and used in high chloride treatment experiments.

[0057] Example 3: Tobacco material planting, cultivation, high chlorine treatment and sampling

[0058] Tobacco Planting and Cultivation: The plant material used in this example was Nicotiana tabacum (N. tabacum) variety Zhongyan 100. Tobacco plants were cultivated in a greenhouse. Greenhouse conditions were: 16 hours of light / 8 hours of darkness, a temperature of 23-25°C, and a relative humidity of 70%. Tobacco seeds were first sown in soil. Twenty days after germination, tobacco seedlings were transplanted onto rockwool cuttings in a floating tray (1 / 2 Hoagland nutrient solution) for hydroponics.

[0059] Tobacco high chlorine treatment test: After a 6-day adaptation period (approximately 26 days), the plants were transplanted into a circulation hydroponic system filled with 1 / 2 Hoagland nutrient solution (500L). The water used to prepare the 1 / 2 Hoagland nutrient solution contains trace amounts of Na + and Cl -(5.51 μg / mL and 7.88 μg / mL, respectively.) After a 6-day acclimatization period (approximately 32 days), to avoid hyperchloremia shock, 50 mM NaCl was added to the nutrient solution on the first day, 100 mM NaCl was added on the second day, and 200 mM NaCl was added on the second day after the 100 mM NaCl treatment.

[0060] Chloride index determination sampling: The ion content was measured using three biological replicates, each consisting of three plants. The leaves of the whole plant (excluding the veins) were collected and dried at 105°C until a stable weight was reached, and then the dried tissue was ground into powder. About 30-50 mg of the dried sample was placed in a test tube. 1 mL of 3 M formic acid was added to the test tube, and then shaken at 99.9°C at 5000 rpm for 20 minutes. Subsequently, 9 mL of Water and mix. Take 0.2mL sample and use 9.8mL The samples were diluted with water at a dilution ratio of 50. The chloride ion content in the diluted samples was measured using an ion chromatography (IC) system Professional (Metrohm, Switzerland).

[0061] like Figure 5 As shown, under normal conditions, the Cl of WT and Nt-cbl10a10b - There was no significant difference in the content of Cl in the double mutant Nt-cbl10a10b after high chloride treatment. - The content was significantly lower than that of WT. In order to study the phenotype of double mutant Nt-cbl10a10b and Cl - The phenotypes and Cl content of Nt-cbll0a10b double mutant and WT tobacco plants were monitored daily after application of 100 mM NaCl. - The results showed that Cl - The contents in Nt-cbl10a10b double mutant were significantly lower than those in WT.

[0062] In summary, the present invention has discovered the tobacco CBL family gene NtCBL10 and found that knocking out this gene can reduce the chloride ion content in tobacco leaves.

[0063] Although the present invention has been disclosed above by way of embodiments, they are not intended to limit the present invention. Any person skilled in the art may make various choices and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention is defined by the claims and their equivalents.

Claims

1. Application of tobacco CBL family genes NtCBL10A and NtCBL10B to reduce chloride ion content in tobacco leaves under high chloride conditions, characterized in that: The application is to knock out the genes NtCBL10A and NtCBL10B to reduce the chloride ion content of tobacco leaves in a high-chloride environment. The nucleotide sequence of the NtCBL10A gene is shown in SEQ ID NO.1, and the nucleotide sequence of the NtCBL10B gene is shown in SEQ ID NO.

3.

2. The use of tobacco CBL family genes NtCBL10A and NtCBL10B in reducing the chloride ion content of tobacco leaves in a high chloride environment according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the NtCBL10A gene is shown in SEQ ID NO.2, and the amino acid sequence of the protein encoded by the NtCBL10B gene is shown in SEQ ID NO.4.

Images