Application of Osgep as a molecular target in the preparation of drugs for preventing and / or treating fatty liver

Abstract

The present invention discloses the use of Osgep as a molecular target in the preparation of a drug for preventing and / or treating fatty liver. The present invention confirms for the first time the key role of Osgep as a therapeutic target in treating fatty liver disease caused by a high-fat diet and verifies it in a mouse model. By using a method of overexpressing Osgep through viral transfection, it is proved that increasing the expression level of Osgep in the liver can effectively reduce lipid deposition in liver tissue, alleviate ballooning degeneration of the liver, and reduce lipid droplet accumulation. The present invention shows that Osgep can be used as a new molecular target for preventing and treating fatty liver and has important clinical application value in treating metabolic-related fatty liver disease.

Description

Technical Field

[0001] The embodiments of the present invention generally relate to the field of biomedical technology, and more specifically to the use of Osgep as a molecular target in the preparation of a drug for preventing and / or treating fatty liver. Background Art

[0002] Metabolic-dysfunction associated steatotic liver disease (MASLD), formerly known as non-alcoholic fatty liver disease (NAFLD), refers to a disease characterized by excessive lipid deposition in the liver and accompanied by metabolic disorders. With the rapid development of the economy and the continuous improvement of living standards, the prevalence of MASLD has shown an increasing and global trend year by year, and has become the world's number one liver disease. However, the pathogenesis of MASLD is relatively complex. So far, only one drug has been approved by the FDA for the treatment of MASLD. Therefore, the discovery of a possible intervention target is of great significance for the clinical treatment of MASLD.

[0003] N6-threonylcarbamoyladenosine (t6A) modification is a highly conserved nucleotide modification that is widely present in tRNA from bacteria, archaea and eukaryotes. O-sialoglycoprotein endopeptidase (Osgep) participates in t6A modification as a component of the KEOPS complex, transferring the enzyme-catalyzed product of threonine, bicarbonate and ATP, threonylcarbamoyl-AMP (TC-AMP) intermediate, to the sixth position of adenine in the 37th position of adenine nucleotide of tRNA, forming t6A modification and regulating the efficiency and accuracy of protein translation.

[0004] The human OSGEP gene is located on chromosome 14q11 and encodes a protein containing 335 amino acids with a molecular weight of 36.4kDa. Clinically, patients with OSGEP mutations suffer from Galloway-Mowat (GAMOS) syndrome, which involves the kidneys and central nervous system, and exhibits nephrotic syndrome, microcephaly and abnormal brain development. It has been considered the most common genetic cause of GAMOS. Therefore, OSGEP is currently mainly concerned in the field of GAMOS disease research, and the research direction is basically related to cell proliferation, protein translation accuracy, endoplasmic reticulum stress and DNA damage pathways. There is no report on the relationship between OSGEP and metabolism-related fatty liver disease. Summary of the invention

[0005] In view of the above problems, the present invention provides the use of Osgep as a molecular target in the preparation of a drug for preventing and / or treating fatty liver, and further provides a drug for preventing and / or treating fatty liver.

[0006] According to a first aspect of the present invention, there is provided use of Osgep as a molecular target in the preparation of a medicament for preventing and / or treating fatty liver.

[0007] In one embodiment, the drug comprises Osgep protein, Osgep Genes and promotion Osgep At least one of the agents for regulating gene expression, the drug is used to increase the content of Osgep protein in the liver.

[0008] In one embodiment, the drug comprises Osgep A gene overexpression vector; the overexpression vector comprises at least one of a plasmid vector, a phage vector, a viral vector, a non-viral vector, a lipid nanoparticle delivery system and a minicircular DNA.

[0009] In one embodiment, the overexpression vector comprises at least one of a lentivirus overexpression vector, an adenovirus overexpression vector and an adeno-associated virus overexpression vector.

[0010] In one embodiment, the fatty liver is fatty liver disease caused by a high-fat diet.

[0011] In one embodiment, the drug can reduce lipid deposition in liver tissue or hepatocytes, alleviate ballooning degeneration of the liver, and reduce lipid droplet accumulation.

[0012] In one embodiment, the drug can be in any one or more pharmaceutically feasible dosage forms, including but not limited to injections, oral preparations or genetically engineered drugs.

[0013] Specifically, the oral dosage form of the drug can be capsules, soft capsules, orodisintegrating tablets, chewable tablets, buccal tablets, sublingual tablets, pills, granules, granules, powders, suspensions, sustained-release tablets and sustained-release capsules, solutions, suspensions, pills, syrups, etc. These dosage forms contain various excipients, disintegrants, binders, lubricants, sweeteners, flavoring agents, colorants, emulsifiers, diluents, etc. The injection of the drug can be solution-type, suspension-type, emulsion-type, freeze-dried powder, etc.

[0014] According to a second aspect of the present invention, a drug for preventing and / or treating fatty liver is provided, the drug comprising Osgep protein, Osgep Genes and promotion OsgepAt least one of the agents for regulating gene expression, the drug is used to increase the content of Osgep protein in the liver.

[0015] In one embodiment, the drug comprises Osgep A gene overexpression vector; the overexpression vector comprises at least one of a plasmid vector, a phage vector, a viral vector, a non-viral vector, a lipid nanoparticle delivery system and a minicircular DNA.

[0016] In one embodiment, the overexpression vector comprises at least one of a lentivirus overexpression vector, an adenovirus overexpression vector and an adeno-associated virus overexpression vector.

[0017] The technical solution of the present invention has at least the following beneficial effects:

[0018] The present invention confirms for the first time the key role of Osgep as a therapeutic target in the treatment of fatty liver disease caused by a high-fat diet, and has been verified in animal models. Through the method of viral transfection, it is proved that increasing the expression level of Osgep in the liver can effectively reduce lipid deposition in liver tissue or hepatocytes, alleviate liver ballooning degeneration, and reduce lipid droplet accumulation; Osgep, as a new molecular target for the prevention and treatment of fatty liver, has important clinical application value in the treatment of metabolism-related fatty liver disease.

[0019] It should be understood that the contents described in this section are not intended to identify the key or important features of the embodiments of the present invention, nor are they intended to limit the scope of the present invention. Other features of the present invention will become easily understood through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The above and other features, advantages and aspects of the embodiments of the present invention will become more apparent with reference to the following detailed description in conjunction with the accompanying drawings. In the accompanying drawings, the same or similar reference numerals represent the same or similar elements.

[0021] Figure 1 The expression level of Osgep in the liver of the experimental mice of Example 1 of the present invention is shown, wherein:

[0022] A is a schematic diagram showing the comparison of Osgep mRNA levels in the livers of mice fed a high-fat diet and mice fed a normal diet;

[0023] B is a schematic diagram showing the comparison of Osgep protein levels in the livers of mice fed a high-fat diet and mice fed a normal diet;

[0024] C is a comparative diagram of the mRNA levels of Osgep in the liver of db / db mice and normal control mice in the same littermates;

[0025] D is a schematic diagram comparing the protein levels of Osgep in the livers of mice fed a high-fat diet and mice fed a normal diet.

[0026] Figure 2 Schematic diagram of comparison of triglyceride content in the liver of experimental mice in Example 2 of the present invention.

[0027] Figure 3 The ballooning degeneration and lipid droplet accumulation of the experimental mouse liver in Example 3 of the present invention are shown, wherein:

[0028] A is the hematoxylin-eosin staining of the liver of AAV-NC injected mice;

[0029] B is injection of AAV- Osgep Hematoxylin-eosin staining of mouse liver;

[0030] C is the Oil Red O staining image of the liver of AAV-NC injected mice;

[0031] D is injected with AAV- Osgep Oil red O staining of mouse liver.

[0032] Figure 4 Schematic diagram comparing the mRNA levels of Osgep in primary hepatocytes under normal conditions and under Osgep knockdown conditions according to Example 4 of the present invention.

[0033] Figure 5 The lipid droplet accumulation of primary hepatocytes after transfection with different adenoviruses in Example 4 of the present invention is shown, wherein:

[0034] A is the Oil Red O staining of primary hepatocytes transfected with control adenovirus and cultured under BSA stimulation for 24 h;

[0035] B is the Oil Red O staining of primary hepatocytes transfected with Osgep knockdown adenovirus and cultured under BSA stimulation for 24 hours;

[0036] C is the Oil Red O staining image of primary hepatocytes transfected with control adenovirus and cultured under palmitic acid stimulation for 24 h;

[0037] D is an Oil Red O staining image of primary hepatocytes transfected with Osgep knockdown adenovirus and cultured for 24 hours under palmitic acid stimulation.

[0038] Figure 6 Schematic diagram comparing the triglyceride content of primary hepatocytes in Example 4 of the present invention under normal conditions and under conditions of knockdown of Osgep. DETAILED DESCRIPTION

[0039] The following is a description of exemplary embodiments of the present invention in conjunction with the accompanying drawings, including various details of the embodiments of the present invention to facilitate understanding, which should be considered as merely exemplary. Therefore, it should be recognized by those of ordinary skill in the art that various changes and modifications may be made to the embodiments described herein without departing from the scope and spirit of the present invention. Similarly, for clarity and conciseness, the description of well-known functions and structures is omitted in the following description.

[0040] Unless otherwise defined, the technical terms used in the following examples have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. The test reagents used in the following examples are all conventional biochemical reagents unless otherwise specified; the experimental methods are all conventional methods unless otherwise specified.

[0041] The main reagent materials and their sources used in the examples are:

[0042] Osgep antibody was purchased from Santa Cruz Company, catalog number sc-393199.

[0043] β-Tubulin antibody was purchased from Proteintech Group, catalog number 10094-1-AP.

[0044] C57BL / 6 male mice were purchased from Hunan Slake Experimental Animal Co., Ltd.

[0045] db / db mice and littermate control normal mice were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.

[0046] The triglyceride determination kit was purchased from Nanjing Jiancheng Bioengineering Institute, catalog number A110-1-1.

[0047] High Fat Diet (HFD): including 60 kcal% fat, 20 kcal% carbohydrates and 20 kcal% protein, purchased from Research Diets, product number D12492.

[0048] Chow Diet (CD): includes 10 kcal% fat, 70 kcal% carbohydrates and 20 kcal% protein.

[0049] Oil Red O stock solution was purchased from Zhuhai Beso Biotechnology Co., Ltd.

[0050] Oil Red O working solution: Mix Oil Red O stock solution and double distilled water in a volume ratio of 3:2, let it stand for 10 minutes before use.

[0051] Osgep (gene sequence number: NM_133676, species: mouse) was overexpressed in the liver by adeno-associated virus (AAV- Osgep ) and control adeno-associated virus (AAV-NC) were purchased from Heyuan Biotechnology (Shanghai) Co., Ltd.

[0052] Osgep knockdown adenovirus and control adenovirus were purchased from Heyuan Biotechnology (Shanghai) Co., Ltd.

[0053] Hematoxylin staining solution, eosin staining solution, physiological saline, 4% paraformaldehyde solution, xylene, 70% ethanol, double distilled water, paraffin, 1% hydrochloric acid ethanol solution, PBS solution, and bovine serum albumin (BSA) are all conventional biological experimental reagents. Example 1

[0054] Eight-week-old C57BL / 6 mice were randomly divided into a high-fat diet group and a normal diet group. The high-fat diet group was fed with a high-fat diet, and the normal diet group was fed with a normal diet. The feeding cycle was 16 weeks, and body weight was recorded every week.

[0055] Eight-week-old leptin receptor-deficient (db / db) mice and littermate control normal mice were fed with normal diet for 6 weeks.

[0056] The mice were all raised in the Department of Experimental Animals of Central South University. The experimental animals were kept in an SPF environment with a 12-h day-night cycle, a temperature of 23-26°C, a humidity of 50±10%, and free access to water.

[0057] The mRNA expression level of Osgep in the liver of each group of mice was detected by real-time quantitative PCR experiment, and the β-actin gene was used as the internal reference gene of the real-time quantitative PCR experiment. The protein level of Osgep in the liver of each group of mice was detected by protein immunoblotting experiment, and the β-Tubulin protein was used as the internal reference of protein immunoblotting experiment.

[0058] The primers used in the real-time quantitative PCR experiment are as follows:

[0059] Mouse Osgep Primers:

[0060] Forward: CGTGTTTGCAATGCTAGTGG

[0061] Reverse: GCACATTGTCCCCATCATCT

[0062] Internal reference β-actin primers:

[0063] Forward: GGCTGTATTCCCCTCCATCG

[0064] Reverse: CCAGTTGGTAACAATGCCATGT

[0065] Test results such as Figure 1 As shown:

[0066] Osgep mRNA levels in the liver of mice with high-fat diet-induced fatty liver ( Figure 1 A) and protein levels ( Figure 1 B) were significantly lower than those of mice fed a normal diet. The mRNA levels of Osgep in the liver of db / db mice ( Figure 1 C) and protein levels ( Figure 1 D) were significantly lower than those of normal control mice.

[0067] The above results indicate that the expression level of Osgep is significantly reduced in the animal model of fatty liver, and Osgep may serve as a new target for the prevention and treatment of fatty liver. Example 2

[0068] Eight-week-old C57BL / 6 mice were fed a high-fat diet for two weeks. The mice were numbered and randomly divided into two groups to ensure that the weight of the experimental animals in each group was similar. One group was fed 2×10 11 PFU / injection volume AAV- Osgep , and the other group used 2×10 11 AAV-NC was injected into the tail vein at an injection dose of 10.0 PFU / mouse. The mice were fed with a high-fat diet for 8 weeks. Liver samples were taken to detect the triglyceride content in the liver.

[0069] The mice were all raised in the Department of Experimental Animals of Central South University. The experimental animals were kept in an SPF environment with a 12-h day-night cycle, a temperature of 23-26°C, a humidity of 50±10%, and free access to water.

[0070] Test results such as Figure 2 As shown:

[0071] Under high-fat diet conditions, injection of AAV- Osgep The triglyceride content in the liver of mice injected with AAV-NC was significantly lower than that in mice injected with AAV-NC.

[0072] The above results indicate that overexpression of Osgep gene can effectively improve fatty liver induced by high-fat diet. Example 3

[0073] The mouse liver in Example 2 was prepared into paraffin sections and frozen sections, and subjected to hematoxylin-eosin staining and Oil Red O staining, respectively, to observe the pathological changes of the liver and the accumulation of fat droplets in the liver.

[0074] Hematoxylin-eosin staining of liver tissue:

[0075] Fresh liver tissue was obtained, first washed with precooled saline, then fixed with 4% paraformaldehyde solution for 48 hours, dehydrated in an automatic dehydrator, and then embedded in paraffin and sliced. Before staining, the slices were baked in a 65°C oven for 1 hour, dewaxed with xylene, dehydrated with gradient alcohol, and rinsed with running water for 10 minutes. The slices were stained in hematoxylin staining solution for 5 minutes, washed once with double distilled water to remove excess dye, differentiated in hydrochloric acid alcohol differentiation solution for 3 seconds, rinsed with running water for 10 minutes, and then stained in eosin staining solution for 30 seconds, washed once with double distilled water to remove excess dye. After gradient alcohol dehydration and xylene transparency, the slices were placed in a fume hood to dry, sealed with neutral resin, and images were collected under a microscope.

[0076] Oil Red O staining of liver tissue:

[0077] Fresh liver tissue was obtained, embedded with OCT embedding reagent, sliced ​​with a frozen microtome, and fixed in fixative for 2 minutes. After washing with double distilled water 3 times, it was quickly rinsed once in 70% ethanol, and then the slices were stained with oil red O working solution for 10 minutes, then quickly rinsed with 70% ethanol 3 times, and washed again in double distilled water. Hematoxylin staining solution was added to the slices for 2 minutes, rinsed with running water for 1 minute, and sealed with sealing agent, and images were collected under a microscope.

[0078] Observation results such as Figure 3 As shown:

[0079] Under high-fat diet conditions, injection of AAV- Osgep The degree of ballooning in the liver of mice injected with AAV-NC was significantly lower than that of mice injected with AAV-NC ( Figure 3 A. Figure 3 B) Injection of AAV- Osgep The accumulation of lipid droplets in the liver of mice injected with AAV-NC was significantly better than that of mice injected with AAV-NC ( Figure 3 C. Figure 3 D).

[0080] The above results indicate that overexpression of Osgep gene can effectively improve the ballooning degeneration and lipid droplet accumulation of fatty liver induced by high-fat diet. Example 4

[0081] Mouse primary hepatocytes were inoculated in six-well plates, and Osgep knockdown adenovirus and control adenovirus were used to infect primary hepatocytes for 24 hours, respectively. Each group of infected cells was divided into two groups, one group of cells was stimulated with 400uM palmitic acid for 24 hours to construct an in vitro fatty liver model, and the other group of cells was treated with BSA for 24 hours as a control group. The cells were stained with Oil Red O and the intracellular triglyceride content was determined.

[0082] Oil Red O staining of cells:

[0083] After the treated cells, the culture medium was removed, the cells were washed 3 times with PBS solution, and fixed with 4% paraformaldehyde solution at room temperature for 15 minutes. After removing the 4% paraformaldehyde solution and washing 3 times with PBS, Oil Red O working solution was added for staining for 20 minutes. After 20 minutes, the excess stain was removed, the cells were washed 3 times with PBS, and images were collected under a microscope.

[0084] The mRNA expression level of Osgep in primary hepatocytes was detected by real-time quantitative PCR experiment. The primers used in the real-time quantitative PCR experiment in this example were consistent with those in Example 1.

[0085] Test results such as Figure 4-6 As shown:

[0086] The mRNA level of Osgep in primary hepatocytes transfected with Osgep knockdown adenovirus was significantly lower than that in primary hepatocytes transfected with control adenovirus ( Figure 4 ), proving that the Osgep knockdown adenovirus was successfully constructed and the goal of knocking down Osgep was achieved.

[0087] Oil Red O results showed that, in the absence of palmitic acid stimulation, lipid droplet deposition in primary hepatocytes transfected with Osgep knockdown adenovirus was aggravated compared with the control adenovirus transfected group ( Figure 5 A. Figure 5 B); Under palmitic acid stimulation conditions (free fatty acid-induced fatty liver), lipid droplet deposition in primary hepatocytes transfected with Osgep knockdown adenovirus was significantly aggravated compared with the control adenovirus transfection group ( Figure 5 C. Figure 5 D).

[0088] The quantitative detection results of intracellular triglyceride further showed that the triglyceride content in primary hepatocytes transfected with Osgep knockdown adenovirus increased compared with that in the control adenovirus transfected group ( Figure 6 ), especially under palmitic acid stimulation conditions (free fatty acid-induced fatty liver), the intracellular triglyceride content increased significantly.

[0089] The above results indicate that Osgep knockdown can promote lipid deposition in primary hepatocytes, further proving that Osgep overexpression has the effect of improving lipid deposition.

[0090] The embodiments of the present invention have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or technical improvements in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. Promote Osgep Use of a reagent for gene expression in the preparation of a drug for treating fatty liver, the reagent comprising Osgep A gene overexpression vector, wherein the fatty liver is fatty liver caused by a high-fat diet.

2. The use according to claim 1, characterized in that: The overexpression vector comprises at least one of a plasmid vector, a phage vector, a viral vector, a lipid nanoparticle delivery system and a minicircle DNA.

3. The use according to claim 2, characterized in that: The overexpression vector includes at least one of a lentivirus overexpression vector, an adenovirus overexpression vector and an adeno-associated virus overexpression vector.

4. The use according to any one of claims 1-3, wherein the drug can reduce lipid deposition in liver tissue or hepatocytes, alleviate ballooning degeneration of the liver, and reduce lipid droplet accumulation.

5. The use according to claim 4, characterized in that: The medicine is an injection.

6. The use according to claim 4, characterized in that: The drug is a genetically engineered drug.

Images