Composition and kit for detecting gastric cancer and application of composition and kit

Abstract

The invention relates to the field of molecular biological detection, in particular to the field of gastric cancer detection. The invention provides a composition for detecting gastric cancer. The composition comprises a detection reagent for detecting the following miRNA (micro Ribonucleic Acid): miR-20a-5p, miR-130a-3p and miR-421. Meanwhile, the invention further provides a kit comprising the composition and application of the composition. The composition can be used for clinically detecting the gastric cancer with high sensitivity and good specificity; clinically, the gastric cancer can be sensitively and specifically detected at the early stage.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology detection, specifically, to the field of gastric cancer detection, and more specifically, to the detection of gastric cancer miRNA markers. Background Art

[0002] Gastric cancer is a common malignancy in the world. In the global cancer statistics in 2020, there were more than 1 million new cases and 769,000 deaths. The incidence of gastric adenocarcinoma ranked sixth and the mortality rate ranked third. Gastric adenocarcinoma (STAD) is the most common pathological type of gastric cancer, and the incidence is particularly high in Asian countries such as China and Japan. The high mortality rate is mainly due to late presentation, because the early stages of gastric cancer are either asymptomatic or manifested with nonspecific symptoms. The survival rate depends on the stage of gastric cancer at diagnosis. In Western countries, the 5-year survival rate ranges from 5% to 20%, while in Japan, the survival rate is about 50% due to early diagnosis. At present, commonly used methods for gastric cancer detection include gastroscopy, tissue biopsy, serum tumor marker detection, etc., but these methods have some disadvantages, such as unsuitability for large-scale screening, complex operation, long detection time, low detection sensitivity and specificity, etc. At present, surgery remains the main means of potentially curative treatment of gastric cancer. However, more than 50% of patients may still relapse after radical resection. Good screening methods for early detection are the best way to reduce the mortality rate of gastric cancer. Endoscopic screening is not commonly performed in the community due to the side effects associated with endoscopy, including perforation, aspiration pneumonia, or bleeding. Therefore, there is an urgent need to discover biomarkers for noninvasive early detection of gastric cancer patients.

[0003] MicroRNA (miRNA) is an endogenous noncoding regulatory RNA with 17-25 nucleotides that plays an important role in post-transcriptional gene regulation. The ability to bind complementary sequences in the 3'-untranslated region (3'-UTR) of various target mRNAs leads to direct mRNA degradation or translational inhibition. miRNAs regulate gene expression and contribute to development, differentiation, inflammation, and carcinogenesis. Increasing evidence suggests that miRNA profiles are differentially expressed in cancer tissues and normal counterparts. In fact, miRNAs are very specific to different types of tissues and even cell types within these tissues, and many studies have analyzed miRNA patterns in various cancer types, which has raised the diagnostic and prognostic value of miRNAs in clinical applications.

[0004] There is an urgent need in this field for a more effective gastric cancer diagnostic product that can achieve high sensitivity and high specificity for early diagnosis of gastric cancer while being non-invasive and rapid. Summary of the invention

[0005] In view of this, the present invention provides a composition for detecting gastric cancer, comprising a detection reagent for detecting the following miRNA:

[0006] miR-20a-5p, miR-130a-3p, and miR-421.

[0007] In some specific embodiments, miR-20a is shown as SEQ ID NO:1, miR-130a is shown as SEQ ID NO:2, and miR-421 is shown as SEQ ID NO:3.

[0008] In the present invention, "sample" is a biological sample selected from an individual. Specifically, for example, selected from cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colon effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof.

[0009] Preferably, the "sample" of the present invention is plasma, ie, miRNA in plasma.

[0010] The miRNA in plasma can be used to detect tumors, with the characteristics of little harm to patients and good specificity. However, due to its extremely low content in plasma, it has the problem of low sensitivity. Using the detection reagent of the present invention, the miRNA in plasma can be used as a sample, and can be detected clinically with a sensitivity of 85.0% and a specificity of 97.5%.

[0011] In the present invention, "detection reagent" refers to a reagent for detecting miRNA in a sample, wherein the detection is measured by a chip or fluorescent quantitative PCR.

[0012] In some specific embodiments, the detection reagent includes but is not limited to a chip, wherein the chip is a miRNA chip having probes that specifically bind to miRNA.

[0013] In some specific embodiments, the detection reagents include, but are not limited to, nucleic acid primers and nucleic acid probes for measuring miRNA by fluorescent quantitative PCR.

[0014] Furthermore, the detection reagent also includes an internal standard primer and an internal standard probe.

[0015] In a specific embodiment, the target of the internal standard primer and probe is RNU6-2.

[0016] In a specific embodiment, RNU6-2 is as shown in SEQ ID NO:4.

[0017] In a specific embodiment, SEQ ID NOs: 1 to 4 are as follows:

[0018] miR-20a-5p: UAAAGUGCUUAUAGUGCAGGUAG (SEQ ID NO: 1);

[0019] miR-130a-3p: CAGUGCAAUGUUAAAAGGGCAU (SEQ ID NO: 2);

[0020] miR-421: AUCACAGACAUUAAUUGGGCGC (SEQ ID NO: 3);

[0021] RNU6-2:

[0022] GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAG CGUUCCAUAUUUUU (SEQ ID NO: 4).

[0023] When the detection reagent includes nucleic acid primers and nucleic acid probes, the detection reagent detects miRNA in the nucleic acid in the sample by fluorescent quantitative PCR.

[0024] In the present invention, "fluorescence quantitative PCR" refers to the first stage of designing a specific stem-loop primer whose 3' end is complementary to the miRNA target sequence, and reverse transcription is performed to form cDNA under the action of reverse transcriptase; the second stage is to perform probe method qPCR, such as Figure 1 shown.

[0025] Preferably, the first stage and the second stage are performed in one step in one tube, that is, miRNA stem-loop reverse transcription and PCR amplification are completed in the same reaction tube.

[0026] Furthermore, the above composition may further include other reagents, specifically, for example, various reagents required for pre-treatment or pre-processing of the sample, for example, a nucleic acid releasing agent for extracting nucleic acid from the sample, etc.

[0027] In some specific embodiments, the detection reagents are shown in Table 1 and Table 2:

[0028] Table 1

[0029]

[0030]

[0031] Table 2

[0032]

[0033] In some specific embodiments, the four fluorescence channels adopted by the present invention are FAM, HEX, CY5 and ROX channels, but the actual application is not limited to this, and it can be a combination of any other fluorescence channels; at the same time, different targets can also correspond to different fluorescence channels, such as any fluorescence channel can be used as an internal standard detection channel.

[0034] In a second aspect, the present invention provides use of the above composition in preparing a kit for detecting gastric cancer.

[0035] Furthermore, the present invention provides use of the above reagent combination in preparing a kit for detecting gastric cancer using plasma free nucleic acids.

[0036] In particular, the free nucleic acid comprises miRNA.

[0037] In a third aspect, the present invention provides a kit for detecting gastric cancer, wherein the kit comprises the composition as described above.

[0038] Furthermore, the kit also includes, but is not limited to, at least one of a reagent for extracting nucleic acid and a reagent for purifying nucleic acid.

[0039] Furthermore, the kit also includes a negative control and a positive control.

[0040] Specifically, the negative control was RNU6-2 synthesized in vitro; the positive control was miRNA synthesized in vitro.

[0041] Furthermore, the reagents for extracting nucleic acid are reagents for extracting tissue nucleic acid and reagents for extracting plasma free nucleic acid.

[0042] Furthermore, the reagent for extracting nucleic acid is a reagent for extracting plasma free nucleic acid.

[0043] Furthermore, the kit also includes dNTPs, Mg 2+ , Rnasin, reverse transcriptase, PCR buffer, and hot start enzyme.

[0044] In a fourth aspect, a method for preparing a reagent for detecting gastric cancer is provided, wherein the detection comprises the following steps:

[0045] 1) Extracting or releasing nucleic acid from the sample to be tested;

[0046] 2) using the composition of the present invention or the kit of the present invention as described above to perform fluorescent quantitative PCR on the nucleic acid obtained in step 1);

[0047] 3) Obtain and analyze the results.

[0048] Furthermore, the reaction conditions of the fluorescent quantitative PCR are:

[0049] Reverse transcription, temperature is 40-60℃, time is 10-20 minutes, 1 cycle; Taq enzyme activation and reverse transcriptase inactivation, temperature is 90-97℃, time is 3-6min, 1 cycle; denaturation, temperature is 95℃, time is 5-20 seconds, annealing, temperature is 55℃-60℃, time is 10-60 seconds, 30-50 cycles, and fluorescence is collected.

[0050] In a specific embodiment, a method for detecting gastric cancer for non-diagnostic purposes is provided, the method comprising the following steps:

[0051] 1) Extracting or releasing nucleic acid from the sample to be tested;

[0052] 2) using the composition of the present invention or the kit of the present invention as described above to perform fluorescent quantitative PCR on the nucleic acid obtained in step 1);

[0053] 3) Obtain and analyze the results.

[0054] Furthermore, the reaction conditions of the fluorescent quantitative PCR are:

[0055] Reverse transcription, temperature is 40-60℃, time is 10-20 minutes, 1 cycle; Taq enzyme activation and reverse transcriptase inactivation, temperature is 90-97℃, time is 3-6min, 1 cycle; denaturation, temperature is 95℃, time is 5-20 seconds, annealing, temperature is 55℃-60℃, time is 10-60 seconds, 30-50 cycles, and fluorescence is collected.

[0056] In this article, the term "non-diagnostic purpose" refers to not being intended to obtain information on whether an individual suffers from gastric cancer. For example, the method may require detection of information on miRNA in a test culture. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 This is a graph showing the test results of the composition of the present invention;

[0058] Figure 2 It is a specific result diagram of the composition of the present invention;

[0059] Figures 3 to 5 ROC analysis for the detection of the composition of the present invention (miR-20a-5p, miR-130a-3p, and miR-421, respectively);

[0060] Figure 6 This is the ROC analysis of the combined detection of the composition of the present invention (combined detection of miR-20a-5p, miR-130a-3p, and miR-421). DETAILED DESCRIPTION

[0061] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are used to illustrate the present invention, rather than to limit the present invention.

[0062] Example 1: Primers and probes used in the present invention

[0063] The present invention mines data in TCGA and GEO databases and constructs a large data set related to gastric cancer, uses bioinformatics methods to construct differential analysis of miRNA expression levels in gastric cancer samples, intestinal metaplasia and other pathological samples, and normal samples, screens out valuable specific miRNA markers, and uses high-throughput sequencing of clinical samples to further screen out miRNA markers with high sensitivity and strong specificity, and finally determines that the combination of hsa-miR-20a-5p, hsa-miR-130a-3p, and hsa-miR-421 three miRNAs is the best marker combination for early diagnosis of gastric cancer, and uses RNU6-2 as the detection internal standard. The composition used in the present invention is shown in Tables 1 and 2.

[0064] Example 2: Detection of miRNA of reference product

[0065] Positive samples: miR-20a-5p, miR-130a-3p, miR-421, RNU6-2; 100 copies / mL;

[0066] Negative samples: RNU6-2;

[0067] Testing process:

[0068] PCR system configuration: Prepare PCR reaction solution according to the reagent formula in Table 3 below

[0069] Table 3

[0070]

[0071]

[0072] The sample was added to the PCR reaction tube at 20 μL / reaction, and then 30 μL of PCR reaction solution was added in sequence. The PCR tube was capped, vortexed to mix, and then centrifuged for 5 seconds.

[0073] Fluorescence PCR reaction and result analysis

[0074] 1) Place the PCR reaction tube into the sample slot of the thermal amplification instrument and set the names of the samples to be tested in the corresponding order.

[0075] 2) Fluorescence detection channel selection: select the ROX channel (Reportere: ROX, Quencher: None) to detect miR-130a-3p; select the FAM channel (Reportere: FAM, Quencher: None) to detect miR-20a-5p; select the HEX channel (Reportere: HEX, Quencher: None) to detect miR-421; select the CY5 channel (Reportere: CY5, Quencher: None) as the internal standard to detect the internal reference RNU6-2;

[0076] 3) Fluorescence quantitative PCR reaction conditions are as shown in Table 4:

[0077] Table 4

[0078]

[0079] 4) Result analysis

[0080] After the reaction is finished, the instrument automatically saves the results, and the instrument's own software can be used for automatic analysis (you can also manually adjust the baseline start value, end value, and threshold line value for analysis). The intersection of the amplification curve and the threshold line is called Ct (i.e., cycle threshold, which refers to the cycle value experienced when the fluorescence signal in the PCR reaction tube reaches the set threshold). Figure 1 As shown, the sensitivity of the detection reagent provided by the present invention can reach 100 copies / mL, and the RNU6-2 amplification curve is as follows Figure 2 shown.

[0081] Example 3: Results of testing clinical samples with the composition of the present invention

[0082] A total of 80 clinical plasma samples were collected, including 40 plasma samples from gastric cancer patients and 40 plasma samples from healthy subjects.

[0083] The plasma miRNA was extracted using the miRcute serum / plasma miRNA extraction and separation kit. According to the process of Example 1, the miRNA stem-loop reverse transcription and PCR amplification detection were performed in the same reaction tube, and the three targets were jointly detected. The clinical results were interpreted in the following manner: the Ct value of the internal reference gene U6 was used to determine whether the experimental results met the quality control requirements. If the Ct value was <27, the quality control requirements were met. In this study, ΔCt was used to reflect the difference in expression levels, where ΔCt = Ct target - Ct internal reference. The ΔCt of each target was calculated by the sample test results, and the logistic regression model logistics = 10.0493 + 11.143 * miR-130a-3p + 7.2644 * miR-421 -0.1097 * miR-20a-5p. When the test calculation result is <0.117, it is considered that gastric cancer is present. If the test result is ≥0.117, the probability of gastric cancer is considered to be low.

[0084] Using the composition of Table 1, the specificity and sensitivity of plasma sample detection were 97.5% and 85.0%, respectively, as shown in Table 5 below.

[0085] Table 5

[0086]

[0087] Plasma sample detection sensitivity (%) = number of positive detections / total number of positive cases*100% = 85.0%;

[0088] Specificity of plasma sample detection (%) = total number of negative detections / total number of negative samples*100%=97.5%;

[0089] The ROC analysis of the three targets of miR-20a-5p, miR-130a-3p and miR-421 and the combined detection of the three targets is as follows Figures 3 to 6 shown.

[0090] Using the composition of Table 2, the specificity and sensitivity of plasma sample detection were 92.5% and 82.5%, respectively, as shown in Table 6 below.

[0091] Table 6

[0092]

[0093] Comparative Example 1: Results of testing clinical samples using the comparative example composition of the present invention

[0094] In order to further demonstrate the superiority of the present invention, the inventors further used additional gastric cancer-related miRNAs reported previously and some of the targets of the present invention to form a composition for detection. The specific detection results are shown in Table 7. It can be seen from the results that its sensitivity is much lower than that of the composition of the present application, indicating the superiority of the detection effect of the composition of the present invention.

[0095] Table 7

[0096]

Claims

1. A composition for detecting gastric cancer, characterized in that: The composition includes detection reagents for detecting the following miRNAs: miR-20a-5p, miR-130a-3p, and miR-421.

2. The composition according to claim 1, characterized in that The detection reagent is a chip, or a detection reagent used in fluorescent quantitative PCR.

3. The composition according to claim 2, characterized in that The detection reagents are nucleic acid primers and nucleic acid probes used in fluorescent quantitative PCR.

4. The composition according to claim 3, characterized in that The fluorescent quantitative PCR is to complete the miRNA stem-loop reverse transcription and PCR amplification in the same reaction tube.

5. The composition according to claim 3 or 4, characterized in that The detection reagent also includes an internal standard upstream primer, an internal standard downstream primer and an internal standard probe for monitoring.

6. The composition according to claim 5, characterized in that The nucleic acid primers and nucleic acid probes are: The nucleic acid primers and probes shown in SEQ ID NOs: 5 to 17, or Nucleic acid primers and probes shown in SEQ ID NOs: 14 to 26.

7. Use of the composition according to any one of claims 1 to 6 in preparing a kit for detecting gastric cancer.

8. A kit for detecting gastric cancer, characterized in that: The kit comprises the composition according to any one of claims 1 to 6.

9. The kit according to claim 8, characterized in that The kit also includes dNTPs, Mg 2+ , Rnasin, reverse transcriptase, PCR buffer, hot start enzyme.

10. A method for preparing a reagent for detecting gastric cancer, the detection comprising the following steps: 1) Extracting or releasing nucleic acid from the sample to be tested; 2) using the composition according to any one of claims 1 to 6 to perform fluorescent quantitative PCR on the nucleic acid obtained in step 1); 3) Obtain and analyze the results.

Images