Application of single nucleotide polymorphism marker related to pig body length

Abstract

The invention discloses application of a single nucleotide polymorphism marker related to pig body length, the single nucleotide polymorphism marker is located at a site with C / T polymorphism at the 26447347bp of chromosome 10 of a pig reference genome Sscrofa11.1 version sequence, and an individual with the genotype of CC at the site has an obviously larger body length phenotypic value. The molecular marker remarkably related to the pig body length can be used for early selection of individuals with large pig bodies, so that the breeding speed of excellent pig breeds is increased, and the economic benefits of pig production enterprises are improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and livestock breeding and relates to a method for evaluating the body length of pigs. PTCH1 Gene single nucleotide polymorphism markers and their detection methods. Background Art

[0002] Pig body size directly affects meat production performance and is closely related to reproductive performance. It is an important trait in domestic pig breeding. Body length is a complex quantitative trait that is affected by both environmental and genetic factors. However, at present, there is very limited information on the main effect genes and causal mutations that control the pig body length trait.

[0003] Single nucleotide polymorphism (SNP) refers to a polymorphism caused by a single base mutation in the genomic DNA sequence. This mutation includes single base transversion, conversion, insertion and deletion. Discovering SNP markers related to pig body length is of great significance for the improvement of pig body length traits and the breeding of excellent pig breeds. For example, Xu Pan et al. reported NR6A1 Gene g.299084751 C>T site and VRTN The combined genotype of the gene InDel locus has a significant effect on the body length trait of Sujiang pig (see reference: Sujiang pig NR6A1 and VRTN Analysis of gene polymorphism and its association with production traits. Animal Husbandry and Veterinary Medicine, 2022, 54(04): 10-16.).

[0004] Genome-wide association analysis is one of the main methods to identify the genetic relationship between phenotype and genotype. For example, Wang et al. reported 13 candidate genes ( ATP5O , GHRHR , TRIM55 , eIF2AK1 , PLEKHA1、BRAP , COL11A2 , HMGA1 , NHLRC1 , SGSM1、NFATC2 , MAML1 , PSD3 ) is associated with pig growth traits (see reference: Genome-WideAssociation Study of Growth Traits in a Four-Way Crossbred Pig Population.Genes,2022,13(11).). PTCH1 Genetic variation is reported to be associated with body size. PTCH1The gene contains 24 exons (23 of which are coding exons), located between 9q22.3 and 31, and encodes a twelve-transmembrane protein consisting of 1447 amino acids. It is the membrane receptor of the Hedgehog protein in the Hedgehog signaling pathway. The Hedgehog signaling pathway plays an important role in early embryonic development, but it cannot be determined based on this signaling pathway. PTCH1 It is the main gene that determines the growth traits of pigs such as body length. Summary of the invention

[0005] The purpose of the present invention is to provide an application of a single nucleotide polymorphism marker related to pig body length.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: A sort of PTCH1 The method for detecting gene single nucleotide polymorphism comprises the following steps: The genomic DNA of the pig individual to be tested is extracted, and the genotype of the single nucleotide polymorphism site located at 26447347 bp of chromosome 10 of the pig reference genome Sscrofa11.1 version sequence in the genomic DNA is identified.

[0007] Preferably, the identification specifically comprises the following steps: using the genomic DNA as a template, amplifying the sequence containing the single nucleotide polymorphism site by PCR PTCH1 The amplified fragments are sequenced, and the genotype of the single nucleotide polymorphism site is determined according to the sequencing results.

[0008] Preferably, the amplification primers used in the PCR are: Upstream primer F1: 5`-TGGACCATTGGGTCAAGTT-3` Downstream primer R1: 5`-GACTAGCTGTTGAGCCAGAT-3`.

[0009] A sort of PTCH1 A detection kit for gene single nucleotide polymorphism, the kit comprising amplification of the single nucleotide polymorphism site PTCH1 Primers for partial gene fragments, such as the above-mentioned upstream primer F1 and downstream primer R1.

[0010] A sort of PTCH1 The invention discloses an application of a gene single nucleotide polymorphism site in pig molecular marker-assisted selection breeding, wherein the single nucleotide polymorphism site is located at the 26447347 bp position of chromosome 10 of the pig reference genome Sscrofa11.1 version sequence.

[0011] Above PTCH1Application of gene single nucleotide polymorphism sites in evaluating pig body length.

[0012] Above PTCH1 Application of gene single nucleotide polymorphism sites in evaluating pig growth rate.

[0013] Above PTCH1 Application of gene single nucleotide polymorphism detection methods in pig molecular marker-assisted selection breeding.

[0014] Preferably, the single nucleotide polymorphism site has a C / T polymorphism, the two alleles are C and T, and C is the reference base.

[0015] Preferably, individuals with a CC genotype have a greater body length phenotypic value than individuals with a CT or TT genotype.

[0016] Preferably, the pig individuals to be tested are Sujiang pigs or Henan black pigs, among which individuals with genotype CC have better body length. For example, in the Sujiang pig population, individuals with genotype CC have significantly better body length than individuals with genotype TT.

[0017] The beneficial effects of the present invention are embodied in: The present invention detects the PTCH1 The SNP site of the gene can be used to select pig individuals with large body length phenotype values ​​at an early stage according to the SNP markers corresponding to the site, thereby quickly establishing a pig population with excellent genetic resources, accelerating the selection and breeding of excellent pig breeds, and shortening the pig molecular breeding time. The SNP markers related to the pig body length trait provided by the present invention not only enrich the molecular markers in marker-assisted selection and breeding, but also can be used to screen fast-growing pig groups, thereby improving the economic value of the pig group, saving breeding costs, and being conducive to improving the economic benefits of pig production enterprises. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a box plot of the CC and CT genotype effects of the SNP site at 26447347bp on chromosome 10 of Henan black pig.

[0019] Figure 2 This is a box plot of the CC, CT and TT genotype effects of the SNP site at 26447347bp on chromosome 10 of Sujiang pig. DETAILED DESCRIPTION

[0020] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. The embodiments are only used to explain the present invention, but not to limit the scope of protection of the present invention.

[0021] 1. Acquisition of SNP loci 1. Experimental pig population and sampling Thirty Yunan black pigs from the Yunan black pig breeding farm in Gushi County, Xinyang City, Henan Province were used as the experimental pig group. Ear tissues of individuals in the experimental pig group were collected (sampled in July 2022) and brought back to the laboratory for low-temperature storage; A total of 164 Sujiang pigs from Sujiang Breeding Pig Co., Ltd. in Taixing City, Taizhou City, Jiangsu Province were used as the experimental pig group. Ear tissues of individuals in the experimental pig group were collected (sampled in February 2021) and brought back to the laboratory for low-temperature freezing.

[0022] 2. DNA Extraction and SNP Detection The ear tissues collected from the experimental pig population were used to extract genomic DNA using a kit (Genome DNA Extraction Kit, Tiangen Biochemical Technology Co., Ltd.).

[0023] The genomic DNA for the SNP chip test should meet the following conditions: OD value was measured by NanoDrop2000 UV spectrophotometer, A260 / A280 was between 1.8 and 2.1; 1% agarose gel electrophoresis was performed to ensure clear bands.

[0024] Qualified DNA (genomic DNA from individuals in the Henan black pig experimental pig population) was taken, and individual whole-base group SNP detection was performed using the pig 80K functional site gene chip, and genotyping was performed using the software GenCall Version7.0.0. During the genotyping process, the sequence of the polymorphic site was extracted by R language, the genotype frequency and allele frequency distribution of the SNP site were statistically analyzed, and the SNP sites with a genotype detection rate of less than 95% were removed; the SNP sites with a Hardy-Weinberg equilibrium chi-square test P value less than 1.0E-6 were removed; and the SNP sites on the sex chromosomes were removed. The typing results of the SNP site located at the 26447347bp of chromosome 10 of the pig reference genome Sscrofa11.1 version sequence are shown in Table 1: Table 1. Gene frequency statistics of the SNP locus at 26447347bp in the experimental pig population (Yunan black pig)

[0025] The qualified DNA (genomic DNA from individuals in the Sujiang pig experimental pig population) was taken for PCR amplification, gel electrophoresis, gel recovery and sequencing to obtain the typing results of the SNP site located at 26447347bp on chromosome 10 of the pig reference genome Sscrofa11.1 version sequence, as shown in Table 2: Table 2. Gene frequency statistics of the SNP locus at 26447347bp in the experimental pig population (Sujiang pig)

[0026] As can be seen from Table 1 and Table 2, for the experimental pig population, the SNP site at 26447347bp (this site in pig PTCH1 The dominant allele in genes is C, and CC is the dominant genotype.

[0027] 2. Genome-wide association analysis and large-scale cohort validation 1. Determination of phenotypic values ​​of body size Body length refers to the distance from the pig's occipital ridge to the base of the tail, that is, the total length of the cervical, thoracic, lumbar, sacral and anterior coccygeal vertebrae measured from the midpoint of the line connecting the upper edges of the left and right ears.

[0028] According to the methods specified in the "Procedure for Determination of Production Performance of Breeding Pigs" (NY / T 822-2019) and the "Technical Regulations for Determination of Performance of Lean Breeding Pigs" (GBT 8467-1987), the body length of individual pigs (specifically individuals in the above-mentioned experimental pig groups of Henan Black Pigs and Sujiang Pigs) was measured at around 150 days of age, as follows: When the pig (live) is relatively still and standing flat, use a soft tape measure to measure along the midline of the back close to the body surface in centimeters (cm).

[0029] In the process of determining the body length phenotypic value, eliminate individuals with corresponding phenotypic values ​​when the number of individuals of a certain genotype is too small (for example, 1); eliminate individuals whose deviation from the mean value is greater than 3 times the standard deviation; and eliminate individuals with missing phenotypic values.

[0030] 2. Genome-wide association analysis GEMMA Version 0.98.3 was used to conduct genome-wide association analysis between all SNP loci genotyped by SNP chip test and body length of pigs (including Henan black pigs). R language was used to perform a significant difference test on genotype data and phenotypic data using the Bonferroni method, among which, P -value<0.05 / SNP site number indicates significant difference. The results of association analysis between different genotypes of the SNP site located at 26447347bp of chromosome 10 in the pig reference genome Sscrofa11.1 version sequence and body length of Henan black pig are shown in Table 3: Table 3. Trait association analysis results of the SNP locus at 26447347 bp in Henan Black Pig

[0031] The analysis results show (Table 3) that the different genotypes of the SNP locus at 26447347bp (specifically CC and CT) are significantly correlated with the body length trait of Henan black pigs. The two genotypes of Henan black pigs have significant differences in body length traits. The body length of Henan black pigs with CC genotype is statistically significantly greater than that of Henan black pigs with CT genotype. The ggplot2, ggpubr and magrittr function packages of R language were further used to analyze the effects of the two genotypes. The results are as follows Figure 1 As shown. Figure 1 It can be seen that the body length phenotype value of the Henan black pig individuals with the CC genotype is 2.7 cm larger than that of the Henan black pig individuals with the CT genotype.

[0032] 3. Association analysis between different genotypes of SNP loci and body length in the validation population The preliminary analysis results showed that there was no significant difference in the body length trait of Sujiang pigs among the three genotypes at the SNP site at 26447347bp (Table 4-1). However, considering that both Henan Black Pig and Sujiang Pig are hybrid strains, it was only necessary to determine whether another homozygous genotype (i.e., TT) had application value as a molecular marker. Further association analysis of the body length trait between Sujiang pig individuals with CC and TT genotypes, between Sujiang pig individuals with CT and TT genotypes, and between Sujiang pig individuals with CT and CC genotypes showed that: (1) The body length of Sujiang pig individuals with CC genotype was statistically significantly greater than that of Sujiang pig individuals with TT genotype (Table 4-2); (2) The body length of Sujiang pig individuals with CT genotype was statistically significantly greater than that of Sujiang pig individuals with TT genotype (Table 4-3); (3) There was no statistically significant difference in body length between Sujiang pig individuals with CC genotype and CT genotype (P=0.731).

[0033] Table 4-1. Results of trait association analysis of the SNP locus at 26447347bp in Sujiang pig

[0034] Table 4-2. Results of trait association analysis of the SNP locus at 26447347bp in Sujiang pig

[0035] Table 4-3. Results of trait association analysis of the SNP locus at 26447347bp in Sujiang pig

[0036] The three genotype effects were further analyzed using the R language ggplot2, ggpubr, and magrittr function packages. The results are as follows: Figure 2 As shown. Figure 2It can be seen that the body length phenotype value of the Sujiang pig individuals with CC genotype is 8.68cm larger than that of the Sujiang pig individuals with TT genotype.

[0037] It was concluded that the CC genotype of the SNP locus at 26447347bp was a candidate SNP marker associated with pig body length.

[0038] (III) Application of SNP markers in evaluating pig body length traits and genetic improvement of traits and breed selection Step i: Taking the rapid establishment of a fattening pig population with an advantage in body length at an early stage (e.g., at birth) as an example, extracting genomic DNA from the Sujiang pig individuals to be tested; Step ii: Using a primer pair to perform PCR amplification on the genomic DNA of the Sujiang pig individual to be tested to obtain an amplified product; wherein the primer pair sequence is as follows: F1: 5`-TGGACCATTGGGTCAAGTT-3` (ie SEQ.ID.NO.1) R1: 5`-GACTAGCTGTTGAGCCAGAT-3` (ie SEQ.ID.NO.2) Step iii: Perform electrophoresis on the amplified product, recover the target fragment, and sequence it to obtain a fragment containing the SNP site (the SNP site at 26447347 bp on chromosome 10 of the pig reference genome Sscrofa11.1 version sequence). PTCH1 The nucleotide sequence of the partial gene fragment (i.e., the 565 bp target fragment) is as follows (i.e., SEQ.ID.NO.3): 5`-TGGACCATTGGGTCAAGTTTGACAACGAAGTGGAATTTCTTCCAGAAACCTAAAAAGAAAAAAAAAAAAAGAATAAAATCCTATGCAGTCAGTTTCATTCCTTAACCTTTAAAATGCTCTATCCAGAATAAAATTGACAG CACTTGCCAACTTTTAATGGTGTTCCTCAAGCCAAGCATGAGCAAATTTGGCTTTCTTGTGGTAGCTGGAAGCCAAGAGCAGGTTCGGAGAATGACACACAGGGCTGAAGTCCTCCGGGCAAAAGAGGAAGATCCCAGTTCTAT CCCAGGGAGAAGGTCAGACACCTGACAGGCA[C / T]GCTGGCCCCAAGCGATGCAGCGGAGAATGGCAGGGCCGTGTGCAGATGGTCACAGATGAACCTCCCAGGGAGAAGGGCAGTGGGACTGGGCAGAGATGAGTATCTGAA CAGACTAGTTTATAGCTTGCAGAGGGTTACAAAGTAGCCGTGGCGCTCTGCTCACATACAGAGAGGGGCCTTTCAAATGGAAAAGAACTACCCTATGCAAGAAATCTCCTTTAAGACCCCAAATCTGGCTCAACAGCTAGTC-3` Step iv: According to the sequencing results, the genotype of the Sujiang pig individual to be tested at the SNP site is obtained; Step v: When the genotype of the Sujiang pig individual to be tested is CC, it indicates that it has a large body length phenotype value; when the genotype is TT, it indicates that it has a relatively small body length phenotype value; Step vi Repeat the above steps and retain the individuals with genotype CC in the detected Sujiang pig population, and eliminate the individuals with genotype TT (the individuals with genotype CT detected can be retained or not).

[0039] In summary, the SNP site located at 26447347bp on chromosome 10 of the pig reference genome Sscrofa11.1 version sequence discovered by the present invention has a molecular marker (specifically a SNP marker) that can be used as a pig body length assessment, and can be used in molecular breeding to improve the growth traits of pigs. At the same time, by selecting pig individuals carrying the SNP marker, fast-growing pig groups can be screened out (individuals with large body length phenotypic values ​​specifically grow fast in pig production), thereby achieving the purpose of improving pig production efficiency.

Claims

1. A PTCH1 A method for detecting gene single nucleotide polymorphism, characterized in that: The following steps are involved: Pig genomic DNA was extracted, and the genotype of the single nucleotide polymorphism site located at 26447347 bp of chromosome 10 in the pig reference genome Sscrofa11.1 version sequence in the genomic DNA was identified.

2. According to claim 1 PTCH1 A method for detecting gene single nucleotide polymorphism, characterized in that: The identification specifically comprises the following steps: using the genomic DNA as a template, amplifying the single nucleotide polymorphism site by PCR PTCH1 The amplified fragments are sequenced, and the genotype of the single nucleotide polymorphism site is determined according to the sequencing results.

3. A method according to claim 2 PTCH1 A method for detecting gene single nucleotide polymorphism, characterized in that: The amplification primers used in the PCR are: Upstream primer: 5`-TGGACCATTGGGTCAAGTT-3` Downstream primer: 5`-GACTAGCTGTTGAGCCAGAT-3`.

4. A PTCH1 A detection kit for gene single nucleotide polymorphism, characterized in that: The kit includes a method for amplifying a single nucleotide polymorphism site. PTCH1 Primers for partial gene fragments, the single nucleotide polymorphism site is located at 26447347bp on chromosome 10 of the pig reference genome Sscrofa11.1 version sequence.

5. The method according to any one of claims 1 to 3. PTCH1 Application of gene single nucleotide polymorphism detection methods in pig molecular marker-assisted selection breeding.

6. The use according to claim 5, characterized in that: The single nucleotide polymorphism site has a C / T polymorphism, and the two alleles are C and T respectively; the body length of individuals with a genotype of CC is greater than that of individuals with a genotype of CT or TT.

7. The use according to claim 5, characterized in that: The pig is Sujiang pig or Henan black pig.

8. A PTCH1 The application of gene single nucleotide polymorphism sites in pig molecular marker-assisted selection breeding is characterized by: The single nucleotide polymorphism site is located at 26447347bp on chromosome 10 of the pig reference genome Sscrofa11.1 version sequence.

9. A PTCH1 The application of gene single nucleotide polymorphism sites in evaluating pig body length is characterized by: The single nucleotide polymorphism site is located at 26447347bp on chromosome 10 of the pig reference genome Sscrofa11.1 version sequence.

10. A PTCH1 The application of gene single nucleotide polymorphism sites in evaluating pig growth rate is characterized by: The single nucleotide polymorphism site is located at 26447347bp on chromosome 10 of the pig reference genome Sscrofa11.1 version sequence.

Images