Primer group, kit and detection method for detecting pathogenic bacteria of stem rot of passion fruit

Abstract

The invention discloses a primer group, a kit and a detection method for detecting pathogenic bacteria of stem rot of passion fruits, the primer group comprises a forward inner primer FIP, a reverse inner primer BIP, a forward outer primer F3 and a reverse outer primer B3, and the invention further provides the kit comprising the primer group. The invention also discloses a method for detecting the pathogenic bacteria of the stem rot of the passion fruit by using the kit. The method can be used for rapidly detecting the pathogenic bacteria of the stem rot of the passion fruit, and is strong in specificity and high in sensitivity.

Description

Technical Field

[0001] The invention relates to the technical field of crop disease detection and identification, in particular to a primer set, a kit and a detection method for detecting pathogenic bacteria of passion fruit base stem rot. Background Art

[0002] Passion fruit has a fragrant aroma, sweet and sour taste, and is rich in amino acids, proteins, vitamins, and various nutrients such as calcium, phosphorus, iron, and potassium. Therefore, it has gradually been sought after by consumers. As a result, large-scale passion fruit cultivation has become increasingly popular. However, in the process of passion fruit cultivation, disease problems have become increasingly prominent. For example, anthracnose, stem base rot, and gray mold occur frequently in various production areas. Among them, the damaged part of stem base rot is mainly the base of the plant stem 5-10 cm away from the bottom surface. In the early stage of infection, brown to dark brown spots appear at the base of the passion fruit stem. As the disease progresses, the cortex of the diseased part gradually cracks, softens, and rots, and the diseased tissue is easily separated from the wood. When the lesions develop horizontally to form a ring cut, the aboveground part will immediately show symptoms such as yellowing and falling leaves, deformed and wrinkled fruits, and finally the whole plant dies. If the stem base rot is not prevented and controlled in time at the early stage of infection, it will be difficult to save the plant after the disease becomes serious. Therefore, it is of great significance to carry out detection and identification research on the pathogen of passion fruit stem base rot to prevent and control the disease and ensure the yield of passion fruit.

[0003] At present, there are no reports on the detection and identification of the pathogens of passion fruit stem rot. Summary of the invention

[0004] The invention discloses a primer set, a kit and a detection method for detecting the pathogenic bacteria of passion fruit base stem rot, which can quickly detect the pathogenic bacteria of passion fruit base stem rot with strong specificity and high sensitivity.

[0005] To achieve the above object, the technical solution of the present invention is:

[0006] A primer set for detecting the pathogen of passion fruit stem base rot, the primer set includes a forward inner primer FIP, a reverse inner primer BIP, a forward outer primer F3, and a reverse outer primer B3, specifically:

[0007] FIP: CGCTTGAGGGCTGAACAGCCGAATTGGGCACCGTCCTC

[0008] BIP:AATACACCTCGCTTTGGAGCGGTCCGAGGTCAACCTTGAGAA

[0009] F3:TTACAACCCTCAAGCTCTGC

[0010] B3:TCAGCGGGTATCCCTACC.

[0011] The present invention also provides a kit for detecting the pathogenic bacteria of passion fruit stem base rot, and the kit comprises the primer set described above.

[0012] Preferably, in the above-mentioned kit for detecting the pathogen of passion fruit stem rot, the primer group is made into a LAMP mixture, and the LAMP mixture includes 1.6 μM FIP primer and BIP primer, 0.2 μM F3 primer and B3 primer.

[0013] Preferably, the above-mentioned kit for detecting the pathogen of passion fruit stem rot comprises: 4 μL each of 1.6 μM FIP primer and BIP primer, 0.5 μL each of 0.2 μM F3 primer and B3 primer, 12.5 μL of 2×BcaBestBuffer, 0.25 μL of Tween-20, 1 μL of DNA Polymerase ver.2.0, 1 μL of Sample, and 25 μL of ddH2O.

[0014] The present invention also provides a detection method for detecting the pathogenic bacteria of passion fruit stem rot, comprising the following steps:

[0015] S1. Take the pathogen hyphae, soak them in lysis buffer, heat denature at 80℃ for 15min, centrifuge and collect the supernatant;

[0016] S2. Use 5 μL of supernatant as template, 0.4 μM of IT1 / IT4 primers each, and a total reaction volume of 50 μL for PCR amplification; the reaction conditions are: (1) thermal denaturation at 94°C for 30 s; (2) 30 cycles of the following: 94°C, 20 s; 55°C, 20 s, and 72°C, 40 s; (3) insulation at 16°C.

[0017] S3. Recover the PCR amplification product, and the final elution volume is 30 μL to obtain the purified product;

[0018] S4. Take 1 μL of the purified product and use it for LAMP detection reaction. The detection reaction system uses the kit described in any one of claims 2 to 4. The reaction conditions are: (1) 65°C, 30 min; (2) 85°C, 5 min; (3) storage at 16°C.

[0019] The primer set for detecting the pathogen of passion fruit base rot disease of the present invention takes the gene of the pathogen of passion fruit base rot disease of L. theobromae as a target gene, designs and screens a LAMP primer set of the pathogen of passion fruit base rot disease of the present invention, can realize the rapid and reliable detection and identification of the diseased plants, and has important significance for preventing and controlling the occurrence and spread of passion fruit base rot disease.

[0020] The detection method of the present invention has strong specificity and high sensitivity, and the detection method is simple and can be completed by a simple water bath. The result can be judged by conventional electrophoresis or by color change, and the operation is simple.

[0021] The detection speed is fast and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a diagram of the amplification-specific color development results in Example 3.

[0023] Figure 2 This is the electrophoresis detection diagram of amplification specificity in Example 3.

[0024] Figure 3 This is the color development result diagram of Example 4.

[0025] Figure 4 These are branches infected with passion fruit stem base rot sampled in Example 5.

[0026] Figure 5 It is the color development result figure of the shallowly infected branches of Example 5.

[0027] Figure 6 It is the color development result diagram of the deeply infected branches in Example 5. DETAILED DESCRIPTION

[0028] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited to the following embodiments.

[0029] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0030] Example 1

[0031] LAMP primers were designed based on the specific sequence regions (6 regions: F3, F2, F1, B3c, B2c, and B1c) of the ITS region genomic sequence of Lasiodiplodia theobromae (hereinafter referred to as L. theobromae).

[0032] >Sequence of L.theobromae

[0033] ggctcgactctcccaccctttgtgaacgtacctctgttgctttggcggctccggccgccaaa

[0034] ggaccttcaaactccagtcagtaaacgcagacgtctgataaacaagttaataaactAAAACT

[0035] TTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT

[0036] GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTC

[0037] CGGGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAagctctgcttggaattgggcaccg

[0038] tcctcactgcggacgcgcctcaaagacctcggcggtggctgttcagccctcaagcgtagtag

[0039] aatacacctcgctttggagcggttggcgtcgcccgccggacgaaccttctgaacttttctca

[0040] aggttGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCata

[0041] F3(1):TTACAACCCTCAagctctgc

[0042] F2:gaattgggcaccgtcctc

[0043] F1:ggctgttcagccctcaagcg

[0044] B3c:aatacacctcgctttggagcgg

[0045] B2c:ttctcaaggttGACCTCGGA

[0046] B1c:GGTAGGGATACCCGCTGA

[0047] Using the online software PrimerExplorer V5 (https: / / primerexplorer.jp / e / ), primers were designed with the following sequences as templates, and a total of 25 candidate primer sets were obtained. After multiple rounds of experimental screening, a primer set for detecting the pathogen of passion fruit stem rot was determined, including the forward inner primer FIP, the reverse inner primer BIP, the forward outer primer F3, and the reverse outer primer B3. The specific primer sequences are:

[0048] FIP: 5'-CGCTTGAGGGCTGAACAGCCGAATTGGGCACCGTCCTC-3'

[0049] BIP:5'-AATACACCTCGCTTTGGAGCGGTCCGAGGTCAACCTTGAGAA-3'

[0050] F3:5'-TTACAACCCTCAAGCTCTGC-3'

[0051] B3:5'-TCAGCGGGTATCCCTACC-3'

[0052] Example 2

[0053] Detection method:

[0054] S1. Use a toothpick to scrape a small amount of hyphae, soak it in 50 μL lysis buffer (Lysis Buffer for Microorganism to Direct PCR, Takara, Japan), heat denature at 80°C for 15 min, centrifuge the product, and collect the supernatant; the sources of hyphae include fungal isolates cultured on plates and wounds of infected branches.

[0055] S2. The supernatant of the lysate was directly used as a template for PCR amplification using IT1 / IT4 as primer pair. Reaction system: 0.4 μM of each primer of IT1 / IT4, 5 μL of supernatant as template, total volume of 50 μL. Reaction conditions: (1) 94°C heat denaturation for 30 s; (2) 30 cycles of the following: 94°C, 20 s; 55°C, 20 s, 72°C, 40 s; (3) 16°C insulation.

[0056] S3. Recover the PCR amplification product, and the final elution volume is 30 μL to obtain the purified product.

[0057] S4. Take 1 μL of the purified product and use it for LAMP detection reaction. The reaction system is shown in Table 1. The reaction conditions are: (1) 65°C, 30 min; (2) 85°C, 5 min; (3) 16°C storage.

[0058] Table 1. LAMP reaction system

[0059]

[0060]

[0061] *HNB:Hydroxy naphthol blue

[0062] Example 3

[0063] The samples to be tested were amplified by conventional PCR using ITS-1 / ITS-4 as primer pairs and each fungal genomic DNA as template, and the products were recovered and purified. For specific steps, see Example 2. The product concentration was determined using a NanoDrop ultra-micro spectrophotometer, and the stock solution was uniformly diluted to 10 ng / μL with 1×TE Buffer.

[0064] The fungal genomes were grouped as follows: Fungal group 1: Fusariumfujikuroi-like ITS; Fungal group 2: Talaromyces sp-like ITS; Fungal group 3: Fusarium solani-melongenae-like ITS; Fungal group 4: Fusarium oxysporum-like ITS; Fungal group 5: Fusarium cf.solani-like ITS; Fungal NC group: unrelated sequences; Fungal PC group: L.theobromae ITS; Fungal NTC group: deionized water.

[0065] Test results such as Figure 1 and 2 As shown, Figure 1 As shown, the fungal PC group was fluorescent blue, and the other groups were blue-purple. According to the color development results, the fungal PC group was positive, and the other groups were negative. Figure 2 As shown, M: DS2000 Marker, the bands indicate sizes of 2.0 kb, 1.0 kb, 0.75 kb, 0.5 kb, 0.25 kb and 0.1 kb from top to bottom; the lane where the fungal PC group is located can observe the characteristic ladder band of LAMP, which is positive, and no amplified bands appear in other groups, which are negative. It shows that the primer set of this example can be used for specific detection of L. theobromae.

[0066] Example 4

[0067] The sample to be tested was amplified by conventional PCR using ITS-1 / ITS-4 as a primer pair and L. theobromae genomic DNA as a template, and then the product was recovered and purified. For specific steps, see Example 2. The product concentration was determined using a NanoDrop ultra-micro spectrophotometer, and the stock solution was diluted with 1×TE Buffer to different concentrations, specifically grouped as follows: concentration group 1: 10 ng / μL; concentration group 2: 1 ng / μL; concentration group 3: 0.1 ng / μL; concentration group 3: 0.01 ng / μL; concentration NTC group: deionized water.

[0068] Test results such as Figure 3 As shown, concentration group 1 and concentration group 2 were fluorescent blue, indicating positive, and the other groups were blue-purple, indicating negative, indicating that the primer set of this example can distinguish "L. theobromae ITS conserved region amplification product" with a DNA amount as low as 1 ng under the naked eye.

[0069] Example 5

[0070] Cut off the branches infected with passion fruit stem rot and classify them into two types according to the severity of infection: one is the shallowly infected branches ( Figure 4 A), and the other is deeply infected branches ( Figure 4 B), shallowly infected branches were divided into shallowly infected group 1, shallowly infected group 2, shallowly infected group 3, shallowly infected group 4, shallowly infected group 5, shallowly infected PC group (positive control, 1 ng of "L. theobromae ITS conservative region amplification product"), shallowly infected NC group (negative control), and shallowly infected NTC group (deionized water). Deeply infected branches were divided into deeply infected group 1, deeply infected group 2, deeply infected group 3, deeply infected group 4, deeply infected group 5, deeply infected PC group (positive control, 1 ng of "L. theobromae ITS conservative region amplification product"), deeply infected NC group (negative control), and deeply infected NTC group (deionized water).

[0071] The samples to be tested were amplified by conventional PCR using ITS-1 / ITS-4 as primer pairs and hyphae isolated from wounds of infected branches as templates, and the products were recovered and purified. For specific steps, see Example 2. The product concentration was determined using a NanoDrop ultra-micro spectrophotometer, and the stock solution was uniformly diluted to 10 ng / μL with 1×TE Buffer.

[0072] Test results such as Figure 5 and Figure 6 As shown, Figure 5 As shown, the superficial infection group 1, superficial infection group 2, superficial infection group 3, superficial infection group 4, superficial infection group 5, and superficial infection PC group were fluorescent blue and positive, while the other groups were negative. Figure 6As shown, deep infection group 1, deep infection group 2, deep infection group 3, deep infection group 4, deep infection group 5, and deep infection PC group were fluorescent blue, indicating positive, while the other groups were negative.

Claims

1. A primer set for detecting the pathogenic bacteria of passion fruit stem rot, characterized in that: The primer set includes a forward inner primer FIP, a reverse inner primer BIP, a forward outer primer F3, and a reverse outer primer B3, specifically: FIP: CGCTTGAGGGCTGAACAGCCGAATTGGGCACCGTCCTC BIP:AATACACCTCGCTTTGGAGCGGTCCGAGGTCAACCTTGAGAA F3:TTACAACCCTCAAGCTCTGC B3:TCAGCGGGTATCCCTACC.

2. A kit for detecting the pathogenic bacteria of passion fruit stem rot, characterized in that: The kit comprises the primer set as claimed in claim 1.

3. The kit for detecting the pathogenic bacteria of passion fruit stem rot according to claim 2, characterized in that, The primer set was prepared into a LAMP mixed solution, which included 1.6 μM FIP primer and BIP primer, and 0.2 μM F3 primer and B3 primer.

4. The kit for detecting the pathogenic bacteria of passion fruit stem rot according to claim 2, characterized in that, The kit includes: 4 µL of 1.6 µM FIP primer and BIP primer, 0.5 µL of 0.2 µM F3 primer and B3 primer, 2× Bca Best Buffer12.5 µL, Tween-20 0.25 µL, DNA Polymerase ver.2.0 1µL, Sample1 µL, ddH2O make up 25 µL.

5. A detection method for detecting the pathogenic bacteria of passion fruit stem rot, characterized in that The following steps are involved: S1. Take the pathogen hyphae, immerse them in lysis buffer, heat denature at 80℃ for 15 min, centrifuge and collect the supernatant; S2. Use 5 µL of supernatant as template, 0.4 µM of each primer IT1 / IT4, and a total reaction volume of 50 µL for PCR amplification. The reaction conditions are as follows: (1) thermal denaturation at 94°C for 30 s; (2) 30 cycles of the following: 94°C, 20 s; 55°C, 20 s; 72°C, 40 s; (3) incubation at 16°C; S3. Recover the PCR amplification product, and the final elution volume is 30 µL to obtain the purified product; S4. Take 1 µL of the purified product and use it for LAMP detection reaction. The detection reaction system uses the kit described in any one of claims 2 to 4. The reaction conditions are: (1) 65°C, 30 min; (2) 85°C, 5 min; (3) storage at 16°C.

Images