SNP molecular marker combinations associated with corn kernel traits and uses thereof

Abstract

The application discloses a SNP molecular marker combination related to corn kernel traits and application thereof, and belongs to the technical field of molecular genetics. The application develops a SNP molecular marker related to the hundred-kernel weight of corn by studying the relationship between a Zm00001d014723 gene and the kernel weight of corn, and further realizes early prediction of the yield of inbred lines through direct and rapid identification of seedlings by PCR amplification and agarose gel electrophoresis, so that a new thought is provided for molecular breeding.

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, specifically to a combination of SNP molecular markers related to maize kernel traits and their applications. Background Technology

[0002] Maize is an important food, economic, and feed crop. High yield is one of the most important goals in maize breeding. Kernel-related traits such as kernel length, kernel width, and 100-kernel weight are key factors determining maize yield per unit area and have high heritability. Therefore, elucidating the genetic basis of maize kernel-related traits has theoretical guiding significance for the innovation of high-yield maize germplasm resources and the breeding of new varieties.

[0003] Unlike traditional breeding methods for increasing yield, molecular marker technology is more efficient and reliable, significantly shortening the maize breeding process. In recent years, various molecular markers, such as RFLP (restriction fragment length polymorphism), SSR (simple sequence repeats), and SNP (single nucleotide polymorphism), have been used in maize breeding, which has facilitated the rapid identification of maize kernel weight and promoted yield increases. Among them, SNPs, as a common form of genetic variation, are ubiquitous in biological genomes, accounting for approximately 90% of all known variations. Although SNP loci occur frequently, not all SNP loci can become candidate markers for traits; this is mainly related to the location of the SNP. The Zm00001d014723 gene is located on chromosome 5 of maize. Currently, there are no reports on SNPs at the Zm00001d014723 gene location. Therefore, mining and identifying superior allelic variations related to maize kernel traits at the Zm00001d014723 gene location, and developing corresponding molecular markers, has important production application value for the breeding of high-yield maize. Summary of the Invention

[0004] In view of the above-mentioned prior art, the purpose of this invention is to provide a combination of SNP molecular markers related to maize kernel traits and their applications.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention provides a combination of SNP molecular markers related to maize kernel traits, including a first molecular marker and a second molecular marker;

[0007] The nucleotide sequence of the first molecular marker is shown in SEQ ID No. 1. The 65th base from the 5' end of the sequence shown in SEQ ID No. 1 is an SNP site, and its base is T or C.

[0008] The nucleotide sequence of the second molecular marker is shown in SEQ ID No. 2. The 25th base from the 5' end of the sequence shown in SEQ ID No. 2 is an SNP site, and its base is C or T.

[0009] The nucleotide sequence of the first molecular marker is as follows:

[0010] CAGTAGACACATCGGCTCTGAAGACTGGCATGCACACATGCACATCTGGAAACGACAATGAGGGYACAGAGTCTGTGTGGGATAGGTATGAAAATAACCTGCAAGTGTTCGCTGA

[0011] Note: The nucleotides in bold shaded areas in the sequence are SNP sites, and the nucleotide polymorphism is T / C, which is represented by "Y" in the sequence listing.

[0012] The nucleotide sequence of the second molecular marker is as follows:

[0013] CTGCTGGTGCATCCATAGAAATCTYTGGTTCAAGCAGCTTAATAAGTGATCAA GTGGGAG

[0014] Note: The nucleotides in bold shaded areas in the sequence are SNP sites, and the nucleotide polymorphism is C / T, which is represented by "Y" in the sequence listing.

[0015] This invention screened two SNP sites related to maize kernel traits in the coding region of the maize Zm00001d014723 gene. These two SNP sites are located at nucleotides 936 and 1112 of the coding region of the Zm00001d014723 gene, as shown in SEQ ID No. 3. Based on these two SNP sites, this invention further developed and designed a first molecular marker and a second molecular marker. When the base of the first molecular marker at the SNP site is T, and the base of the second molecular marker at the SNP site is C, it corresponds to the high kernel weight trait. The two markers are used in combination for the detection of maize kernel traits and the breeding of high-yielding maize varieties.

[0016] A second aspect of the present invention provides the application of the above-described SNP molecular marker combination in (1) or (2) as follows:

[0017] (1) Screening or identifying the grain traits of maize germplasm resources;

[0018] (2) Marker-assisted breeding of maize.

[0019] In the above applications, the grain characteristics include: 100-grain weight, grain length, and grain width.

[0020] In the above applications, the specific application of marker-assisted breeding of maize is the selection and breeding of high-yield maize inbred lines.

[0021] A third aspect of the present invention provides primer pairs for amplifying the above-mentioned SNP molecular marker combinations, comprising: primer pair A for detecting a first molecular marker and primer pair B for detecting a second molecular marker;

[0022] The nucleotide sequences of primer pair A are shown in SEQ ID No. 4 and SEQ ID No. 5. Specifically:

[0023] P-936-F1: 5'-CAGTAGACACATCGGCTCTG-3'; (SEQ ID No. 4)

[0024] P-936-R1: 5'-TCAGCGAACACTTGCAGGTTA-3'. (SEQ ID No.5)

[0025] The nucleotide sequences of primer pair B are shown in SEQ ID No. 6-SEQ ID No. 8. Specifically:

[0026] P-1112-F2-1: 5'-GAAGGTGACCAAGTTCATGCTCTGCTGGTGCATCCATAGAAATCTT-3'; (SEQID No. 6)

[0027] P-1112-F2-2: 5'-GAAGGTCGGAGTCAACGGATTGCTGGTGCATCCATAGAAATCTC-3'; (SEQ ID No. 7)

[0028] P-1112-R2: 5'-CTCCCACTTGATCACTTATTAAGCTGC-3'. (SEQ ID No. 8).

[0029] In P-1112-F2-1, the shaded area represents the FAM blue fluorescence sequence; in P-1112-F2-2, the shaded area represents the HEX red fluorescence sequence.

[0030] In a fourth aspect, a kit containing the primer pairs described above is provided.

[0031] The above primer pairs or kits can be used to amplify or detect the above SNP molecular marker combinations. Specifically, the first molecular marker is identified by enzyme digestion after amplification using primer pair A; the second molecular marker is identified by fluorescence signal color after amplification using primer pair B.

[0032] A fifth aspect of the present invention provides the use of the above primer pairs or kits in the following (1) or (2):

[0033] (1) Screening or identifying the grain traits of maize germplasm resources;

[0034] (2) Marker-assisted breeding of maize.

[0035] In the above applications, the grain characteristics include: 100-grain weight, grain length, and grain width.

[0036] In the above applications, the specific application of marker-assisted breeding of maize is the selection and breeding of high-yield maize inbred lines.

[0037] A sixth aspect of the present invention provides a method for detecting the characteristics of corn kernels, comprising the following steps:

[0038] Using the genomic DNA of the maize sample as a template, PCR amplification was performed on pair A using primers shown in SEQ ID No. 4 and SEQ ID No. 5. The genotype at the SNP site of the first molecular marker was identified based on the amplification results. PCR amplification was performed on pair B using primers shown in SEQ ID No. 6-SEQ ID No. 8. The genotype at the SNP site of the second molecular marker was identified based on the amplification results.

[0039] Maize inbred lines with the TT genotype as the first molecular marker and the CC genotype as the second molecular marker have higher 100-kernel weight, kernel length, and kernel width than maize inbred lines with the CC genotype as the first molecular marker and the TT genotype as the second molecular marker.

[0040] Preferably, the PCR product amplified by primer pair A is digested with restriction endonuclease BseSI, and the genotype at the SNP site of the first molecular marker is identified based on the number of bands in the digestion product; if there is only one 115bp band, it is the TT genotype, and if there are two bands, 50bp and 65bp, it is the CC genotype.

[0041] Preferably, the genotype at the SNP site of the second molecular marker is identified based on the fluorescence signal color after primer pair B amplification; if the fluorescence signal is red, it is the CC genotype, and if the fluorescence signal is blue, it is the TT genotype.

[0042] The beneficial effects of this invention are:

[0043] This invention studies the relationship between the Zm00001d014723 gene and maize kernel weight, develops SNP molecular markers related to productive traits such as 100-kernel weight, kernel length, and kernel width, and further uses PCR amplification and agarose gel electrophoresis to directly and rapidly identify seedlings, enabling early prediction of inbred line yield and providing new ideas for molecular breeding. Attached Figure Description

[0044] Figure 1 Figure 1 shows the kernel characteristics of wild-type and Zm00001d014723 gene mutants in the context of the maize RP125 inbred line. Figure A shows the phenotypes of kernel length and width in wild-type and mutant kernels. Figure B shows the statistical analysis of kernel length, width, and 100-kernel weight in wild-type and mutant kernels. WT represents the RP125 inbred line, and MT represents the Zm00001d014723 gene mutant.

[0045] Figure 2 Figure 1 shows kernel images of wild-type and Zm00001d014723 gene mutants in the context of the B104 maize inbred line. Figure A shows the phenotypes of kernel length and width in wild-type and mutant kernels. Figure B shows the statistical analysis of kernel length, width, and 100-kernel weight in wild-type and mutant kernels. WT represents the B104 inbred line, and MT represents the Zm00001d014723 gene mutant.

[0046] Figure 3 This section presents SNP information for the Zm00001d014723 gene. Figure A shows the haplotypes of the Zm00001d014723 gene and their corresponding SNPs. Gray left arrows indicate the gene on the antisense strand, large gray boxes represent exons, small gray boxes represent UTR regions, and gray lines represent intron regions. Black numbers indicate SNP positions, and red numbers indicate emphasis. LD indicates the association between SNPs; red dots in the figure indicate a strong association between the SNPs at Chr5:60592800 (first molecular marker) and Chr5:60592624 (second molecular marker). Figure B compares the 100-kernel weight of different haplotype maize inbred lines (P = 0.0006). Figure C compares the kernel length of different haplotype maize inbred lines (P = 0.0002). Figure D compares the kernel width of different haplotype maize inbred lines (P = 0.0188).

[0047] Figure 4 The images show the BseSI digestion results (agarose gel electrophoresis) of different genotypes at the first molecular marker (SNP) site in some maize inbred lines. Inbred lines with a C nucleotide at the first molecular marker SNP site were split into 50 bp and 65 bp segments; this genotype is the low-grain-weight genotype, Hap1. Inbred lines with a T nucleotide at the first molecular marker SNP site could not be digested, retaining 115 bp; this genotype is the high-grain-weight genotype, Hap2.

[0048] Figure 5 This is a genotyping diagram of the KASP gene at Chr5:60592624 for some maize inbred lines. Detailed Implementation

[0049] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0050] As mentioned earlier, maize is one of the most widely distributed and highest-yielding food crops in the world, and it is also an important feed, industrial raw material, and energy crop. Stabilizing and increasing maize yield plays a vital role in ensuring my country's food and energy security. Therefore, finding a new molecular marker to significantly increase maize kernel weight in order to improve yield is of great importance.

[0051] During their research, the inventors used the chemical mutagen ethyl methane sulfonate (EMS) to mutagenesis the pollen of the backbone inbred line RP125, obtaining a mutant with significantly smaller seeds that was stably inherited. Figure 1 The gene controlling the grain mutant phenotype was located as Zm00001d014723 using map-based cloning technology. Then, using maize B104 inbred line recipient material, a knockout mutant of the Zm00001d014723 gene was obtained using CRISPR / Cas9 technology. The results showed that the grain length, grain width, and 100-grain weight of the mutant were significantly reduced compared to the wild type. Figure 2 This demonstrates that the Zm00001d014723 gene is a key gene regulating maize kernel size. The coding region sequence of the Zm00001d014723 gene is shown in SEQ ID No. 3, as follows:

[0052]

[0053] To facilitate breeding practices, this invention uses the Zm00001d014723 gene as the research object and develops SNP molecular markers related to maize kernel traits. These markers originate from the coding region of the Zm00001d014723 gene. The characteristic feature of this coding region is that the low kernel weight C / C, T / T at Chr5:60592800 and Chr5:60592624 positions changes to a high kernel weight T / T, C / C.

[0054] When the bases at Chr5:60592800 and Chr5:60592624 are detected to be homozygous C / C and T / T respectively, the inbred line is predicted to be a low-grain-weight inbred line, which is the main genotype of most inbred lines; when the bases at Chr5:60592800 and Chr5:60592624 are detected to be homozygous T / T and C / C respectively, the inbred line is predicted to be a high-grain-weight inbred line, which exists only in a few inbred lines.

[0055] This invention also provides a method for predicting grain weight of maize inbred lines using the above-mentioned SNP molecular markers. PCR amplification and enzyme digestion are used to determine whether the bases at Chr5:60592800 and Chr5:60592624 in the coding region of the Zm00001d014723 gene are C / C and T / T or T / T and C / C, respectively. C / C and T / T types indicate low-grain-weight inbred lines, while T / T and C / C indicate high-grain-weight inbred lines.

[0056] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0057] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions.

[0058] Example 1: Screening and association analysis of SNP loci associated with maize kernel traits

[0059] Seed phenotypic information of 500 maize inbred lines and the coding region information of the Zm00001d014723 gene were obtained from the ZEAMAP website (http: / / www.zeamap.com / ). A total of 11 SNP loci were found, forming 8 haplotypes, as detailed below. Figure 3 As shown in Figure A.

[0060] By analyzing different haplotypes and grain weight information (including weight per 100 grains, grain length, and grain width), only the grain weight of the inbred lines of haplotype 1 (Hap1) and haplotype 2 (Hap2) showed a significant difference (P = 0.0006).

[0061] Two SNP sites significantly associated with grain weight were identified, with physical locations of Chr5: 60592800 and Chr5: 60592624. Chr5: 60592800 corresponds to nucleotide 936 of the coding region of the Zm00001d014723 gene shown in SEQ ID No. 3; Chr5: 60592624 corresponds to nucleotide 1112 of the coding region of the Zm00001d014723 gene shown in SEQ ID No. 3. The maize reference genome for these physical locations is B73RefGen_v4.

[0062] The two SNP sites mentioned above are strongly correlated. To facilitate their use in actual production, two molecular markers were developed based on these two SNP sites. The nucleotide sequence of the first molecular marker is shown in SEQ ID No. 1. The 65th base from the 5' end of the sequence shown in SEQ ID No. 1 is the SNP site, and its base is either T or C. The nucleotide sequence of the second molecular marker is shown in SEQ ID No. 2. The 25th base from the 5' end of the sequence shown in SEQ ID No. 2 is the SNP site, and its base is either C or T.

[0063] Example 2: Detection of genotypes at SNP loci associated with maize kernel traits

[0064] 1. Genotyping at SNP sites identified by the first molecular marker:

[0065] For the first molecular marker developed in Example 1, the following primer pair A was designed:

[0066] P-936-F1: 5'-CAGTAGACACATCGGCTCTG-3'; (SEQ ID No. 4)

[0067] P-936-R1: 5'-TCAGCGAACACTTGCAGGTTA-3'. (SEQ ID No.5)

[0068] Using genomic DNA from maize as a template, PCR amplification was performed on primer pair A as shown in SEQ ID No. 4 and SEQ ID No. 5. The PCR kit was 2×Taq Plus Master Mix II (Dye Plus), and the reaction system is shown in Table 1. The amplification program is shown in Table 2.

[0069] Table 1: PCR reaction system

[0070] Components Volume (μL) <![CDATA[ddH2O]]> To 20μL 2×Taq Plus Master Mix II(Dye Plus) 10μL Upstream primer (10 μM) 1μL Downstream primer (10 μM) 1μL DNA sample (concentration approximately 200 ng / μL) 1μL

[0071] Table 2: PCR reaction procedure

[0072]

[0073] The obtained PCR products were digested with the restriction endonuclease BseSI (New England Biolabs). The BseSI restriction site is 5'-G(G / T)GC(A / C)C-3'. The PCR product digestion system is shown in Table 3.

[0074] Table 3: Enzyme digestion system

[0075] Components Volume (μL) Restriction endonucleases 0.2μL 10X NEBuffer 0.7μL PCR products 5μL <![CDATA[ddH2O]]> To 7μL

[0076] The enzyme digestion results were distinguished by 4% agarose gel electrophoresis. If the nucleotide at the SNP site of the first molecular marker is T, it cannot be digested and there is only one 115bp band. This genotype (TT) is a high-grain-weight genotype. If the nucleotide at the SNP site of the first molecular marker is C, the enzyme digestion product is divided into two bands of 50bp and 65bp. This genotype (CC) is a low-grain-weight genotype.

[0077] 2. Detection of genotypes at SNP sites of the second molecular marker:

[0078] For the second molecular marker developed in Example 1, the following primer pair B was designed using KASP typing technology:

[0079] P-1112-F2-1: 5'-GAAGGTGACCAAGTTCATGCTCTGCTGGTGCATCCATAGAAATCTT-3'; (SEQID No. 6)

[0080] P-1112-F2-2: 5'-GAAGGTCGGAGTCAACGGATTGCTGGTGCATCCATAGAAATCTC-3'; (SEQ ID No. 7)

[0081] P-1112-R2: 5'-CTCCCACTTGATCACTTATTAAGCTGC-3'. (SEQ ID No.8)

[0082] It includes two upstream typing primers, P-1112-F2-1 (3' end is T) and P-1112-F2-2 (3' end is C) and a universal downstream primer, P-1112-R2; among them, P-1112-F2-1 has FAM blue fluorescence and P-1112-F2-2 has HEX red fluorescence.

[0083] Using maize inbred line genomes as templates, PCR amplification was performed using the 2×Master Mix for ASPCRV1 PCR kit (Chengdu Hanchen Guangyi Biotechnology Co., Ltd.). The reaction system is shown in Table 4, and the amplification program is shown in Table 5.

[0084] Table 4: PCR reaction system

[0085] Components Volume (μL) <![CDATA[ddH2O]]> To 10μL 2×Master Mix (HCSCI) 5μL Upstream primer (10 μM) 0.25μL Downstream primer (10 μM) 0.25μL DNA sample (concentration approximately 35 ng / μL) 1μL

[0086] Table 5: PCR reaction procedure

[0087]

[0088] The genotype of each cross is determined by the color of the fluorescence signal. If the fluorescence signal is blue, the genotype at the SNP site of the second molecular marker (Chr5: 60592624) is TT; if the fluorescence signal is red, the genotype at the SNP site of the second molecular marker (Chr5: 60592624) is CC.

[0089] Example 3: Application of SNP molecular marker combinations related to maize kernel traits in the identification of 100-kernel weight, kernel length, and kernel width in maize

[0090] Five seeds from each of 24 maize inbred lines were taken and planted in an artificial climate chamber (16 hours of light, 8 hours of darkness, 28°C, and 50% relative humidity). On the tenth day of germination, seeds approximately 2 cm long were selected from the middle of the second leaf. 2 Leaves of varying sizes were collected. Five replicates of each inbred line were placed in the same centrifuge tube. The genomes of 24 inbred lines were extracted using the CTAB method. The centrifuge tubes containing leaves and steel balls were flash-frozen in liquid nitrogen for five minutes, then homogenized using a high-throughput tissue homogenizer at 55 Hz for 45 seconds. 500 μL of preheated CTAB at 65 °C was added, mixed, and incubated at 65 °C for 30 minutes. After cooling to room temperature, 200 μL of chloroform was added, mixed again, and centrifuged at 12,000 rpm for 10 minutes. 400 μL of the supernatant was added to 400 μL of anhydrous ethanol, mixed by inversion, and centrifuged at 10,000 rpm for 5 minutes. The mixture was washed twice with 75% ethanol, dried, reconstituted with 100 μL of ddH₂O, and stored at 4 °C.

[0091] Using the extracted genome of maize inbred lines as a template, the genotypes at SNP sites related to maize kernel traits in the above-mentioned maize inbred line materials were detected according to the method in Example 2. The detection results of genotypes at SNP sites with first molecular markers in some maize inbred lines are shown below. Figure 4 As shown; the genotype detection results at the SNP loci of the second molecular marker in some maize inbred lines are as follows. Figure 5 As shown in the figure. The results showed that among the 24 maize inbred lines tested, 13 were haplotype 1 (Hap1), which were identified as low-grain-weight inbred lines; and 11 were haplotype 2 (Hap2), which were identified as high-grain-weight inbred lines.

[0092] After the maize matured, the 100-kernel weight, kernel width, and kernel length traits were examined. The results showed that the 100-kernel weight, kernel width, and kernel length of the inbred line of haplotype 2 were higher than those of the inbred line of haplotype 1, which was consistent with the identification results of SNP molecular marker combinations.

[0093] The above results demonstrate that the SNP molecular marker combination of the present invention can be used to detect the traits of maize kernels, and the results are accurate and reliable.

[0094] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A combination of SNP molecular markers related to maize kernel traits, characterized in that, Including first molecular markers and second molecular markers; The nucleotide sequence of the first molecular marker is shown in SEQ ID No.

1. The 65th base from the 5' end of the sequence shown in SEQ ID No. 1 is an SNP site, and its base is T or C. The nucleotide sequence of the second molecular marker is shown in SEQ ID No.

2. The 25th base from the 5' end of the sequence shown in SEQ ID No. 2 is an SNP site, and its base is C or T.

2. A primer pair for amplifying the SNP molecular marker combination of claim 1, characterized in that, include: Primer pair A for detecting the first molecular marker and primer pair B for detecting the second molecular marker; The nucleotide sequences of primer pair A are shown in SEQ ID No. 4 and SEQ ID No. 5; the nucleotide sequences of primer pair B are shown in SEQ ID No. 6-SEQ ID No.

8.

3. A kit containing the primer pair as described in claim 2.

4. The use of the primer pair of claim 2 or the kit of claim 3 in the following (1) or (2): (1) Screening or identifying grain traits of maize germplasm resources; (2) Marker-assisted breeding of maize; The grain characteristics are: 100-grain weight, grain length, and grain width; The specific purpose of the marker-assisted breeding of maize is the selection and breeding of high-yield maize inbred lines.

5. A method for detecting the characteristics of corn kernels, characterized in that, Includes the following steps: Using the genomic DNA of the maize sample as a template, PCR amplification was performed on pair A using primers shown in SEQ ID No. 4 and SEQ ID No.

5. The genotype at the SNP site of the first molecular marker was identified based on the amplification results. PCR amplification was performed on pair B using primers shown in SEQ ID No. 6-SEQ ID No.

8. The genotype at the SNP site of the second molecular marker was identified based on the amplification results. Maize inbred lines with the TT genotype as the first molecular marker and the CC genotype as the second molecular marker have higher 100-kernel weight, kernel length, and kernel width than maize inbred lines with the CC genotype as the first molecular marker and the TT genotype as the second molecular marker. The PCR products amplified from primer A were digested with the restriction endonuclease BseSI. The genotype at the SNP site of the first molecular marker was identified based on the number of bands in the digestion products. If there was only one 115bp band, it was the TT genotype. If there were two bands, 50bp and 65bp, it was the CC genotype. The genotype at the SNP site of the second molecular marker is identified based on the fluorescence signal color after primer pair B amplification; if the fluorescence signal is red, it is the CC genotype, and if the fluorescence signal is blue, it is the TT genotype.

Images