Molecular Marker Linked to Wheat Stripe Rust Resistance Gene YrZ41-2AL and Its Application

Abstract

The present invention provides a molecular marker linked to the wheat stripe rust resistance gene YrZ41-2AL and its application, belonging to the technical field of molecular markers. The nucleotide sequence of the molecular marker KASP-2AL-2 provided by the present invention is as shown in SEQ ID NO.1, and the polymorphism of the 19th base of the nucleotide sequence is T or C. The molecular marker KASP-2AL-2 of the present invention is closely linked to the stripe rust resistance gene YrZ41-2AL on wheat chromosome 2A, can quickly and accurately detect the stripe rust resistance gene, and has high application value in aspects such as screening or identifying wheat stripe rust resistance, breeding wheat with stripe rust resistance traits, and improving wheat germplasm resources.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and particularly to molecular markers linked to the wheat stripe rust resistance gene YrZ41-2AL and their applications. Background Art

[0002] Wheat (Triticum aestivum L.) is an important food crop, and its yield directly affects China's food security. With the continuous growth of the world's population, in order to meet the food needs of the rapidly growing population, it is estimated that food production needs to increase by 70% by 2050. Therefore, ensuring high and stable wheat yields and continuously increasing wheat production is not only an effective means to guarantee China's food security but also an important challenge faced by breeders.

[0003] The growth process of wheat is often threatened by various diseases, affecting yield improvement. Stripe rust caused by Puccinia striiformis f. sp. tritici (abbreviated as Pst) is a major biological disaster threatening the safe production of wheat. Stripe rust is one of the most widespread and harmful wheat diseases in China. In general years, it can cause a 10-30% yield loss, and in epidemic years, it can lead to more serious yield losses or even crop failures. Breeding and promoting disease-resistant varieties to reduce wheat yield losses caused by diseases is an effective means to guarantee China's food security.

[0004] Common wheat is an allohexaploid and has lost a large number of excellent genes of its ancestral species during evolution and domestication. Cultivated emmer wheat (T. turgidum ssp. dicoccum) is an original hulled tetraploid wheat domesticated from wild emmer wheat, carrying abundant powdery mildew resistance, stem rust resistance, leaf rust resistance, and stripe rust resistance loci, and is an important resource material for the genetic improvement of common wheat. At present, there is little research on the stripe rust resistance genes of cultivated emmer wheat.

[0005] Cultivated emmer wheat Z41 is a resource material collected and preserved by the Wheat Research Institute of Sichuan Agricultural University, showing a high level of resistance to stripe rust in the field. Mining the stripe rust resistance genes of Z41 can provide new resistance sources for wheat disease-resistant variety breeding, and developing molecular markers closely linked to the Z41 disease-resistant genes can accelerate the utilization of these disease-resistant genes in disease-resistant breeding. Summary of the Invention

[0006] In view of this, the object of the present invention is to provide molecular markers linked to the wheat stripe rust resistance gene YrZ41-2AL and their applications. The molecular marker KASP-2AL-2 provided by the present invention is a tightly linked marker, with accurate and efficient detection, convenient and stable amplification.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] Molecular marker linked to wheat stripe rust resistance gene YrZ41-2AL and its application. The molecular marker is KASP-2AL-2, and its nucleotide sequence is shown in SEQ ID NO.1. The 19th base polymorphism of the nucleotide sequence is T or C.

[0009] In certain embodiments, the KASP-2AL-2 is tightly linked to the wheat stripe rust resistance gene YrZ41-2AL and co-localizes at the end of the long arm of wheat chromosome 2A.

[0010] In certain embodiments, the wheat stripe rust resistance gene YrZ41-2AL corresponds to the physical interval of 783-788 Mb of the wild emmer wheat reference genome 2.0.

[0011] In certain embodiments, the genetic distance between KASP-2AL-2 and YrZ41-2AL is 0.9 cM.

[0012] In certain embodiments, the mapping method of the YrZ41-2AL is as follows: Using the highly susceptible stripe rust tetraploid durum wheat 'Langdon' as the female parent and the stripe rust resistant tetraploid cultivated emmer wheat 'Z41' as the male parent to hybridize to obtain the hybrid F1, and self-cross to obtain F2; Using the single-seed descent method, continuously self-cross the F2 single plants to obtain the F5 population; Among them, the highly resistant stripe rust F5 line HR74 is self-crossed to obtain a population of 111 single plants. Field stripe rust resistance identification shows that 77 plants are resistant and 34 plants are susceptible (chi-square value = 1.024, p = 0.312), which conforms to the dominant single-gene segregation ratio. The disease resistance gene is temporarily named YrZ41-2AL; Extract RNA from the leaves of 18 extremely resistant and 18 extremely susceptible single plants respectively from the segregating population, and construct a resistant RNA pool and a susceptible RNA pool respectively for transcriptome sequencing; Screen the polymorphic SNP markers between the parents and the resistant and susceptible pools in the BSR-Seq data, and convert them into KASP markers; Conduct stripe rust phenotype identification on the genetic segregating population, and extract the DNA of the parents 'Langdon', 'Z41' and the plants in the resistant and susceptible segregating population; According to the developed KASP markers, use JoinMap 4.0 to construct a genetic map, and combine the population single-plant resistance phenotype data to map the disease resistance gene YrZ41-2AL.

[0013] In certain embodiments, the YrZ41-2AL is derived from the male parent tetraploid cultivated emmer wheat 'Z41'.

[0014] The present invention also provides a primer set for amplifying the molecular markers described in the above technical solution. The primer set includes: primer KASP-2AL-2F1 with a nucleotide sequence as shown in SEQ ID NO.2, primer KASP-2AL-2F2 with a nucleotide sequence as shown in SEQ ID NO.3, and primer KASP-2AL-2C with a nucleotide sequence as shown in SEQ ID NO.4.

[0015] In certain embodiments, different fluorescent modification groups are respectively linked to the primers shown in SEQ ID NO.2-3.

[0016] The present invention also provides a method for identifying wheat stripe rust resistance. The method uses the genomic DNA of the wheat to be tested as a template, performs fluorescence quantitative PCR amplification using the primer set described in the above technical solution, genotypes the wheat to be tested according to the amplification results, and determines whether it has stripe rust resistance.

[0017] In certain embodiments, the determination criteria of the method are as follows: if the base T corresponding to KASP-2AL-2F1 is detected, the wheat to be tested does not contain the YrZ41-2AL locus; if the base C corresponding to KASP-2AL-2F2 is detected, the wheat to be tested contains the homozygous YrZ41-2AL locus; if both the base T corresponding to KASP-2AL-2F1 and the base C corresponding to KASP-2AL-2F2 are detected, it is determined that the wheat to be tested contains the heterozygous YrZ41-2AL locus; wherein, the wheat to be tested containing the YrZ41-2AL locus has stripe rust resistance.

[0018] The present invention also provides an application of the molecular marker described in the above technical solution or the primer set described in the above technical solution. The application is any one of the following applications:

[0019] (1) Screening or identifying wheat stripe rust resistance;

[0020] (2) Improvement of wheat germplasm resources;

[0021] (3) Creation of wheat materials resistant to stripe rust;

[0022] (4) Wheat molecular marker-assisted breeding.

[0023] Beneficial technical effects:

[0024] (1) The molecular marker linked to the wheat stripe rust resistance gene YrZ41-2AL provided by the present invention can be used to detect the stripe rust resistance gene YrZ41-2AL, rapidly screen plants with this locus, and thus promote the molecular assisted breeding of disease-resistant wheat. KASP-2AL-2 is tightly linked to the stripe rust resistance gene YrZ41-2AL on wheat chromosome 2A, and can be used to locate the trait of wheat stripe rust resistance, so as to eliminate susceptible plants during the breeding process, improve the breeding efficiency, and provide a basis for the research of wheat stripe rust resistance genes.

[0025] (2) The present invention discloses for the first time a stripe rust resistance gene from tetraploid cultivated emmer wheat Z41, which is located on the long arm of wheat chromosome 2A, can significantly increase wheat stripe rust resistance, and has potential utilization value in wheat stripe rust resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is the genetic linkage map of the wheat stripe rust resistance gene YrZ41-2AL in Example 1;

[0027] Figure 2 It is the genotyping result of the molecular marker KASP-2AL-2 for individual plants in the YrZ41-2AL segregation population in Example 1; among them, the HEX (blue, 'Z41') fluorescence genotyping is for stripe rust-resistant plants homozygous for the YrZ41-2AL gene, the FAM (orange, 'Langdon') fluorescence genotyping is for susceptible plants without the YrZ41-2AL gene; the green fluorescence is for heterozygous disease-resistant plants of the YrZ41-2AL gene; the black fluorescence is for the blank control NTC. DETAILED DESCRIPTION OF THE INVENTION

[0028] In order to better understand the present invention, the content of the present invention will be further clarified below in conjunction with the examples, but the content of the present invention is not limited to the following examples. The materials, reagents, etc. used in the examples and test examples of the present invention can be obtained from commercial channels without special instructions; the methods used in the examples and test examples of the present invention are all conventional methods without special instructions.

[0029] The wheat 'Langdon' and 'Z41' used in the following examples are both preserved in the Wheat Research Institute of Sichuan Agricultural University and have been publicly disclosed in the following literature before the application date: "Frequent occurrence of unreduced gametes in Triticum turgidum-Aegilops tauschii hybrids, Zhang et al. 2010, Euphytica, 172: 285-294", and the applicant undertakes to open it to the public within 20 years from the application date.

[0030] Example 1: Obtaining of Wheat Stripe Rust Resistance Gene YrZ41-2AL and Its Molecular Marker KASP-2AL-2

[0031] (1) Test materials: Using the stripe rust-susceptible tetraploid durum wheat 'Langdon' as the female parent and the stripe rust-resistant tetraploid cultivated emmer wheat 'Z41' as the male parent, cross to obtain F1, and F1 self-cross to obtain the F2 population. Using the single-seed descent method, continuously self-cross the F2 single plants to obtain the F5 population. The F5 disease-resistant line HR74 is self-crossed to obtain 111 single plants and a population showing segregation of resistance and susceptibility. This segregating population is used as the resistance segregating population of YrZ41-2AL.

[0032] (2) Conduct field adult-plant stage phenotypic identification of stripe rust for the parents 'Langdon', 'Z41' and single plants of the resistance segregating population. Inoculate the mixed races of stripe rust (CYR32, CYR33, CYR34, Zhong4, and HY46, all provided by the Plant Protection Institute of Gansu Academy of Agricultural Sciences) in the field; the materials used for stripe rust resistance identification are planted with 15 seeds per row according to a row length of 1.5 m, plant spacing of 0.1 m, row spacing of 0.3 m, and the inducing material Avocet S is planted in alternate rows. At the three-leaf and one-heart stage, artificial inoculation is carried out by the smearing method. In March-April of the following year, after Avocet S is fully diseased, refer to the 0-9 grade classification standard (Line and Qayoum, 1992, Virulence, aggressiveness, evolution, and distribution of races of Puccinia striiformis (the cause of stripe rust of wheat) in North America, 1968-87. Technical Bulletin-USDA) to conduct stripe rust resistance phenotypic identification. The resistance phenotypic investigation is carried out four times, once every seven days, and the most severe investigation result is used as the final phenotype.

[0033] (3) The results of field stripe rust resistance identification show that the segregating population composed of 111 single plants shows segregation of resistance and susceptibility, 77 plants are resistant to stripe rust: 34 plants are susceptible to stripe rust (chi-square value = 1.024, p = 0.312), which conforms to the dominant single-gene segregation ratio, indicating that the stripe rust resistance of the population is controlled by a dominant single gene, tentatively named YrZ41-2AL.

[0034] (4) BSR-Seq data analysis

[0035] ① Genomic DNA extraction: The CTAB (Cetyltrimethylammonium Bromide) method was used to extract wheat plant DNA (Rogers and Bendich 1985, Plant Mol. Biol., 1985, 5:69 - 76).

[0036] ② Screening of polymorphic markers between parents and bulks: Transcriptome sequencing combined with bulked segregant analysis was used. From the resistant - susceptible segregating population consisting of 111 individual plants, 18 extremely resistant and 18 susceptible plants were selected respectively to construct a resistant RNA pool and a susceptible RNA pool. These were sent to Novogene (https: / / www.novogene.com / ) for transcriptome sequencing, and BSR - Seq analysis was performed to obtain SNP data. After removing SNPs that were heterozygous in the parents and SNPs with a quality below 10% in the parents and resistant - susceptible pools, a total of 61,000 high - quality SNPs were obtained. By calculating the allelic differential variant frequency (ΔSNP - index) in the resistant and susceptible pools, a total of 793 differential SNPs with ΔSNP - index ≥ 0.6 were obtained. Chromosome number distribution and sliding window mapping were performed on the 793 obtained SNPs, and it was found that 170 of them were located on chromosome 2A, and 133 of them were enriched at the end of chromosome 2AL.

[0037] ③ KASP marker development: Based on the BSR - Seq sequencing data, differential SNPs between parents and bulks were selected and converted into KASP markers. According to the position information of the SNPs on the wild emmer wheat reference genome version 2.0, 100 - base sequences before and after the SNP were extracted. The bases around 18bp - 22bp before the SNP site were designed as FAM and HEX forward primers (the difference lies in the last base of the primer), and a reverse primer was designed from the other end of the SNP site. The primer specificity was detected using the wheat tribe multi - omics data website (http: / / 202.194.139.32 / ). After primer design, FAM 5’ - GAAGGTGACCAAGTTCATGCT - 3’ and HEX 5’ - GAAGGTCGGAGTCAACGGATT - 3’ fluorescent tags were added to the 5’ end of the forward primer sequences respectively, and the universal primer was not modified.

[0038] (5) Genotyping analysis: According to the designed KASP primers, the polymorphism of the markers was verified using ‘Langdon’, ‘Z41’ and the resistant - susceptible pools. Markers with polymorphism between the parents and the resistant - susceptible pools were used for genotyping.

[0039] The nucleotide sequence of KASP-2AL-2 (SEQ ID NO.1) is as follows: 5'-GCAATTACAAGTGCCATCCGCTTAATAATACTAGCAGATTTCTTGTTT CCTACCTACTACTGAACAATGTGG-3';

[0040] The KASP molecular marker amplification primer set for KASP-2AL-2 includes 3 primers, namely: KASP-2AL-2F1 (SEQID NO.2), KASP-2AL-2F2 (SEQ ID NO.3) and KASP-2AL-2C (SEQ ID NO.4). As follows:

[0041] KASP-2AL-2F1 primer: (The underlined part is the FAM tag sequence)

[0042] 5’- GAAGGTGACCAAGTTCATGCT GCAATTACAAGTGCCATCT-3’

[0043] (SEQ ID NO.2)

[0044] KASP-2AL-2F2 primer: (The underlined part is the HEX tag sequence)

[0045] 5’- GAAGGTCGGAGTCAACGGATT GCAATTACAAGTGCCATCC-3’

[0046] (SEQ ID NO.3)

[0047] KASP-2AL-2C primer:

[0048] 5’-CCACATTGTTCAGTAGTAGG-3’(SEQ ID NO.4)

[0049] Using this KASP marker for fluorescence quantitative PCR genotyping of the genomic DNA of the disease-resistant parent 'Z41', disease-resistant pool and disease-susceptible parent 'Langdon', disease-susceptible pool and the offspring population, the genotyping of resistant and susceptible materials was successful (such as Figure 2 ). The genotyping results of the parent Z41 and the disease-resistant pool were HEX (blue) fluorescence values, and the genotyping results of the parent LDN and the disease-susceptible pool were FAM (orange) fluorescence values. Among them, the plant genotypes with blue fluorescence consistent with the parent Z41 were recorded as "C", which were stripe rust-resistant lines; the plant genotypes with orange fluorescence consistent with the parent LDN were recorded as "T", which were stripe rust-susceptible lines; the green fluorescence was for heterozygous lines, with the genotype recorded as "C / T", which were stripe rust-resistant lines; the missing ones were recorded as "-".

[0050] (6) Construction of linkage map: According to the developed markers, use JoinMap 4.0 to construct a genetic map.

[0051] (7) As Figure 1 : Among the 4 pairs of designed linkage markers, the molecular marker KASP-2AL-2 is tightly linked to the stripe rust resistance gene YrZ41-2AL. This molecular marker and wheat stripe rust resistance YrZ41-2AL are co-localized at the end of the long arm of wheat chromosome 2A. Genetic linkage analysis shows that KASP-2AL-2 is tightly linked to the stripe rust resistance gene YrZ41-2AL, and the genetic distance between them and YrZ41-2AL is 0.9 cM.

[0052] Example 2 Application of molecular marker KASP-2AL-2 in selecting and controlling stripe rust resistance gene YrZ41-2AL

[0053] (1) Use the stripe rust-susceptible tetraploid durum wheat 'Langdon' as the female parent and the stripe rust-resistant cultivated emmer wheat 'Z41' as the male parent to construct a resistance segregation population, and randomly select 60 lines from the offspring lines.

[0054] (2) Detect the KASP-2AL-2 marker for the 60 obtained lines. The specific method is as follows: Extract the DNA of the 60 lines; use it as a template, and use the specific primer pair of the molecular marker KASP-2AL-2 as primers for PCR amplification and fluorescence reading. The primers for the marker KASP-2AL-2 are: KASP-2AL-2F1: (The underlined part is the FAM tag sequence)

[0055] 5'- GAAGGTGACCAAGTTCATGCT GCAATTACAAGTGCCATCT-3'

[0056] (SEQ ID NO.2)

[0057] KASP-2AL-2F2: (The underlined part is the HEX tag sequence)

[0058] 5'- GAAGGTCGGAGTCAACGGATT GCAATTACAAGTGCCATCC-3'

[0059] (SEQ ID NO.3)

[0060] KASP-2AL-2C:

[0061] 5'-CCACATTGTTCAGTAGTAGG-3' (SEQ ID NO.4)

[0062] The amplification reaction system for the above-mentioned fluorescence quantitative PCR: 5 μL of Master Mix, 1.4 μL of mixed primers (0.168 μL of the upstream primer shown in SEQ ID NO.3, 0.168 μL of the upstream primer shown in SEQ ID NO.4, 0.42 μL of the downstream primer shown in SEQ ID NO.5, and 0.644 μL of ddH2O), 0.8 μL of template DNA, 3.8 μL of ddH2O. At the same time, at least 3 independent blanks with ddH2O replacing the DNA template need to be added.

[0063] The above-mentioned fluorescence quantitative PCR procedure is shown in Table 1:

[0064] Table 1 Fluorescence quantitative PCR procedure

[0065]

[0066]

[0067] Fluorescence reading results (such as Figure 2 ), plants with HEX (blue) fluorescence detected to be consistent with the parental Z41 genotype are recorded as "C", which are homozygous lines carrying the YrZ41-2AL locus. Plants with FAM (orange) fluorescence detected to be consistent with the parental LDN genotype are recorded as "T", which are stripe rust-susceptible lines without YrZ41-2AL. Green fluorescence indicates lines carrying the heterozygous YrZ41-2AL locus, and the genotype is recorded as "C / T". The genotype of each line and the field phenotypic value (resistant R, susceptible S) are shown in Table 2. According to the genotyping results of the marker KASP-2AL-2, lines containing the homozygous or heterozygous stripe rust resistance gene YrZ41-2AL show a stripe rust-resistant phenotype (R), while lines of the 'Langdon' type are all susceptible (S). The actual results are consistent with the expected results, indicating that the stripe rust resistance gene YrZ41-2AL of the present invention indeed has a significant effect on increasing stripe rust resistance; at the same time, the molecular marker KASP-2AL-2 of the present invention can be used to track and identify the stripe rust resistance gene YrZ41-2AL.

[0068] Table 2 Corresponding results of KASP-2AL-2 genotypes and phenotypes of 'Langdon'×'Z41' residual heterozygous lines

[0069]

[0070]

[0071] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A molecular marker linked to the wheat stripe rust resistance gene YrZ41-2AL, characterized in that, The molecular marker is KASP-2AL-2, and its nucleotide sequence is shown in SEQ ID NO.

1. The 19th base polymorphism of the nucleotide sequence is T or C.

2. The molecular marker according to claim 1, wherein The KASP-2AL-2 is closely linked to the wheat stripe rust resistance gene YrZ41-2AL and is co-localized at the end of the long arm of wheat chromosome 2A.

3. A primer set for amplifying the molecular marker according to claim 1 or 2, characterized in that, The primer set includes: primer KASP-2AL-2F1 with a nucleotide sequence shown in SEQ ID NO.2, primer KASP-2AL-2F2 with a nucleotide sequence shown in SEQ ID NO.3, and primer KASP-2AL-2C with a nucleotide sequence shown in SEQ ID NO.

4.

4. The primer set according to claim 3, wherein The primers shown in SEQ ID NO.2-3 are respectively linked with different fluorescent modification groups.

5. A method for identifying wheat resistant to stripe rust, characterized in that, The method uses the genomic DNA of the wheat to be tested as a template, performs fluorescence quantitative PCR amplification using the primer set described in claim 3 or 4, and genotypes the wheat to be tested according to the amplification results to determine whether it has stripe rust resistance.

6. The method according to claim 5, wherein The determination criterion of the method is as follows: if the base T corresponding to KASP-2AL-2F1 is detected, the wheat to be tested does not contain the YrZ41-2AL locus; if the base C corresponding to KASP-2AL-2F2 is detected, the wheat to be tested contains the homozygous YrZ41-2AL locus; if both the base T corresponding to KASP-2AL-2F1 and the base C corresponding to KASP-2AL-2F2 are detected, it is determined that the wheat to be tested contains the heterozygous YrZ41-2AL locus; among them, the wheat to be tested containing the YrZ41-2AL locus has stripe rust resistance.

7. Use of the molecular marker according to any one of claims 1 to 2 or the primer set according to any one of claims 3 to 4, characterized in that The application is any one of the following applications: (1) Screening or identifying wheat stripe rust resistance; (2) Improvement of wheat germplasm resources; (3) Creation of wheat materials resistant to stripe rust; (4) Wheat molecular marker-assisted breeding.

Images