Improved oligonucleotides targeting RNA binding protein sites

Abstract

The present invention relates to antisense oligonucleotides complementary to a conserved TDP-43 binding site on a precursor mRNA transcript, which are capable of restoring RNA binding protein function in the processing of a variety of independent mRNAs in TDP-43 depleted cells. The contiguous nucleotide sequence of the antisense oligonucleotide comprises a 2 '-O-methoxyethyl-RNA (2'-MOE) nucleoside and the antisense oligonucleotide is attached to a cholesterol moiety.

Description

[0001] The present invention relates to antisense oligonucleotides that are complementary, such as fully complementary, to RNA binding protein target sites on multiple RNAs, such as TDP-43 binding sites on multiple RNA transcripts, and are capable of restoring RNA binding protein function to multiple RNA transcripts, such as for conditions and medical indications in which RNA binding protein function is depleted. The contiguous nucleotide sequence of the antisense oligonucleotide comprises one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides and the antisense oligonucleotide is attached to at least one cholesterol moiety. Background Art

[0002] TAR DNA-binding protein 43 (TDP-43) is a multifunctional RNA / DNA-binding protein involved in RNA-related metabolism. Dysregulation of TDP-43 deposits as inclusions in the brain and spinal cord of patients with motor neuron diseases: amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD) (Prasad et al., Front. Mol. Neurosci., 2019).

[0003] TDP-43 is mainly located in the nucleus, but also shuttles in the cytoplasm due to some of its functions (Ayala et al., 2008). In diseases, such as ALS and FTLD, an increase in cytoplasmic TDP-43 concentration leads to cytoplasmic inclusion formation (Neumann et al., 2006; Winton et al., 2008a). Cytoplasmic mislocalization may be associated with nuclear depletion, resulting in reduced or lost TDP-43 function. There are TDP-43 mutations that cause abnormal splicing of TDP-43 target RNAs, resulting in extensive splicing aberrations (see, for example, Arnold et al., PNAS 2013 110 E736–745 and Yang et al., PNAS.USA111, E1121–E1129).

[0004] Klim et al. report that loss of STMN2 upon reduced TDP-43 function is due to altered STMN2 splicing and suggest restoration of STMN2 as a therapeutic strategy for ALS.

[0005] TDP-43 depletion manifests itself in a range of diseases, termed TDP-43 pathology, and includes diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis, progressive muscular atrophy, Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine diseases such as spinocerebellar ataxia type 3, myopathies, and chronic traumatic encephalopathy.

[0006] Tollervey et al., Nature Neuroscience 2010, 452-458 reported the characteristics of RNA targets and position-dependent splicing regulation of TDP-43 in healthy brain tissue and brain tissue of FTLD patients. Most TDP-43 binding sites are mapped to introns, long non-coding RNAs (lncRNAs) and intergenic transcripts, which are rich in UG-rich motifs. The conserved RNP fragments in TDP-43 are involved in binding to TAR DNA sequences and RNA sequences with UG repeats (Ayala et al., J.Mol.Biol.2005; 348: 575–588). TDP-43 depletion in cells, such as TDP-43 depletion in TDP pathology, is associated with loss of RNA binding of TDP-43 to TDP-43 RNA targets.

[0007] TDP-43 binding sites in human RNA are available online from the Database of RNA Binding Proteins and Related Motifs - see https: / / attract.cnic.es / results / e9f29380-8921-406e-84a8-27ce9b9398b4# Certain characterized human RNA TDP-43 binding sites disclosed include the following RNA sequences: GUGAAUGA, GUUGUGC, UGUGUGUGUGUG (SEQ ID NO 85), GAAUGG, UGUGUGUG, GAAUGA, UGUGUG, GUUGUUC, and GUUUUGC.

[0008] Melamed et al. reported premature polyadenylation-mediated STMN2 loss as a hallmark of TDP-43 neurodegeneration. WO2019 / 241648 discloses 2'O-methoxyethyl ASOs for increasing STMN2 expression.

[0009] The present inventors have identified antisense oligonucleotides that are complementary, such as fully complementary, to a TDP-43 nucleic acid binding site and are capable of restoring the processing and regulation of deregulated TDP-43 RNA transcript targets in cells exhibiting a loss of TDP-43 function, such as expression and splicing of RNA transcripts, thereby providing a novel method for restoring TDP-43 function in TDP-43-depleted cells (i.e., cells with a loss of TDP-43 function), and a novel therapeutic approach for treating TDP-43 pathologies.

[0010] The inventors have determined that the toxicity of antisense oligonucleotides can be reduced through modification while maintaining or improving potency.

[0011] Purpose of the Invention

[0012] The present invention relates to antisense oligonucleotides complementary to the conserved TDP-43 binding site on pre-mRNA transcripts, which are able to restore RNA binding protein function in the processing of multiple independent mRNAs in TDP-43-depleted cells. The contiguous nucleotide sequence of the antisense oligonucleotide comprises one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides and the antisense oligonucleotide is attached to at least one cholesterol moiety.

[0013] The present invention provides antisense oligonucleotides for restoring RNA binding protein function (such as TDP-43 function or TDP-43-like function) in cells with reduced levels of functional TDP-43.

[0014] The present invention provides oligonucleotides capable of restoring the nuclear function of TDP-43 in RNA processing or expression of one or more TDP-43 target RNAs, thereby at least partially restoring or enhancing the functional phenotype of one or more TDP-43 target RNAs. Such oligonucleotide compounds are referred to herein as RNA binding protein mimetics, such as TDP-43 mimetics.

[0015] The present invention provides antisense oligonucleotides complementary to TDP-43 binding sites, and their use in therapy, such as for treating TDP-43 pathologies.

[0016] The present invention further provides antisense oligonucleotides complementary to TDP-43 binding sites on multiple RNA transcripts (i.e., RNA transcripts transcribed from different genetic loci). The multiple RNA transcripts can, for example, be independently selected from the group consisting of pre-mRNA, mRNA, and lncRNA. Summary of the invention

[0017] The present invention provides an antisense oligonucleotide having a length of 8 to 40 nucleotides, which comprises a continuous nucleotide sequence having a length of at least 8 nucleotides, which is complementary to a sequence selected from the group consisting of: (5'-3') (UG)n, (GU)n, wherein n is 4 to 20, UGUGUGUG, UGUGUGUGU, UGUGUGUGUG (SEQ ID NO 95), UGUGUGUGUGU (SEQ ID NO 84), UGUGUGUGUGUG (SEQ ID NO 85), UGUGUGUGUGUGU (SEQ ID NO 86), GUGUGUGU, GUGUGUGUG, GUGUGUGUGU (SEQ ID NO 87), GUGUGUGUGUG (SEQ ID NO 88), GUGUGUGUGUGU (SEQ ID NO 89), GUGUGUGUGUG (SEQ ID NO 90), GUGUGUGUGUG (SEQ ID NO 91), GUGUGUGUGUG (SEQ ID NO 92), GUGUGUGUGUG (SEQ ID NO 93), GUGUGUGUGUG (SEQ ID NO 94), GUGUGUGUGUG (SEQ ID NO 95), GUGUGUGUGUG 90) and GUGAAUGA, wherein the contiguous nucleotide sequence comprises one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides and wherein the antisense oligonucleotide is attached to at least one cholesterol moiety.

[0018] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32, 33, 34, 35, 36, 37, 38, 39 or 40 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

[0019] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof may comprise at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

[0020] In some embodiments, the contiguous nucleotide sequence or all of the nucleosides in the contiguous sequence may be 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

[0021] In certain embodiments, antisense oligonucleotide can be attached to two or more or three or more cholesterol moieties. In certain embodiments, antisense oligonucleotide can be attached to a cholesterol moiety. In certain embodiments, antisense oligonucleotide can be attached to two cholesterol moieties. In certain embodiments, antisense oligonucleotide can be attached to three cholesterol moieties.

[0022] In some embodiments, one or more cholesterol moieties can be covalently attached to the antisense oligonucleotide.

[0023] In some embodiments, the cholesterol moiety can be selected from the group consisting of: 5'-cholesterol-TEG-CE phosphoramidite, 5'-cholesterol-CE phosphoramidite or cholesteryl-TEG-CE phosphoramidite. In some embodiments, the cholesterol moiety can be a combination selected from the group consisting of: 5'-cholesterol-TEG-CE phosphoramidite, 5'-cholesterol-CE phosphoramidite or cholesteryl-TEG-CE phosphoramidite. In some embodiments, the cholesterol moiety is 5'-cholesterol-TEG-CE phosphoramidite. In some embodiments, all of the cholesterol moieties are 5'-cholesterol-TEG-CE phosphoramidites.

[0024] In embodiments where more than one cholesterol moiety is present, each cholesterol moiety is independently selected such that the cholesterol moieties within an antisense oligonucleotide may or may not be identical.

[0025] In some embodiments, a joint can be located between the antisense oligonucleotide and the cholesterol portion. In some embodiments, a joint can be located between the antisense oligonucleotide and each of the cholesterol portion. In some embodiments, a joint can be located between each of the cholesterol portion.

[0026] In some embodiments, the linker can be a cleavable linker.

[0027] In some embodiments, the linker can be a physiologically labile linker, such as an S1 nuclease sensitive linker.

[0028] In some embodiments, an alkyl group linker is positioned between the antisense oligonucleotide and one or more cholesterol moieties.

[0029] In some embodiments, the physiologically labile linker is a phosphodiester-linked cytidine-adenosine dinucleotide having three consecutive phosphodiester bonds.

[0030] In some embodiments, the C3 alkyl group is a linker between the antisense oligonucleotide and one or more cholesterol moieties. In some embodiments, the C3 alkyl group is between the antisense oligonucleotide and another linker.

[0031] In some embodiments, the C6 alkyl group is a linker between the antisense oligonucleotide and one or more cholesterol moieties. In some embodiments, the C6 alkyl group is between the antisense oligonucleotide and another linker.

[0032] In some embodiments, the C12 alkyl group is a linker between the antisense oligonucleotide and one or more cholesterol moieties. In some embodiments, the C12 alkyl group is between the antisense oligonucleotide and another linker.

[0033] In some embodiments, the TEG group is a linker located between the antisense oligonucleotide and one or more cholesterol moieties. In some embodiments, another TEG group is located between the antisense oligonucleotide and another linker.

[0034] In some embodiments, the HEG group is a linker positioned between the antisense oligonucleotide and one or more cholesterol moieties. In some embodiments, the HEG group is positioned between the antisense oligonucleotide and another linker.

[0035] In some embodiments, the antisense oligonucleotide may contain a phosphorothioate (PS) or phosphodiester (PO) linkage between the cholesterol moiety and the linker.

[0036] In another embodiment, the antisense oligonucleotide may contain a phosphorothioate (PS) or phosphodiester (PO) bond between the linker and the antisense oligonucleotide.

[0037] In another embodiment, the antisense oligonucleotide can contain a phosphorothioate (PS) or phosphodiester (PO) bond between the cholesterol moiety and the linker, and a phosphorothioate (PS) or phosphodiester (PO) bond between the linker and the antisense oligonucleotide. For example, in some embodiments, the antisense oligonucleotide can have the following structure: "cholesterol-PO / PS-linker-PO / PS-oligonucleotide", wherein the PO / PS group is located between the linker and the cholesterol moiety, and another PO / PS group is located between the linker and the antisense oligonucleotide. Here, the phosphorothioate (PS) or phosphodiester (PO) bond can be independently selected so that both are phosphorothioate (PS) bonds, both are phosphodiester (PO) bonds, or one is a phosphorothioate (PS) bond and the other is a phosphodiester (PO) bond.

[0038] In some embodiments, the antisense oligonucleotide may have the structure shown below:

[0039]

[0040] In some embodiments, the antisense oligonucleotide may have the structure shown below:

[0041]

[0042] In some embodiments, the antisense oligonucleotide may have the structure shown below:

[0043]

[0044] In some embodiments, the antisense oligonucleotide may have the structure shown below:

[0045]

[0046] As described in the Background section, functional TDP-43 is primarily a nuclear localized protein that may be present in the cytoplasm. However, accumulation of TDP-43 in the cytoplasm, so-called cytoplasmic inclusions (also called aberrant TDP-43), is associated with non-functional TDP-43, which is associated with loss of nuclear TDP-43 function, for example in the processing of large amounts of pre-mRNA. Therefore, cells expressing TDP-43 in cytoplasmic inclusions are considered to be TDP-43 depleted.

[0047] The antisense oligonucleotide may be an isolated antisense oligonucleotide or a purified oligonucleotide.The antisense oligonucleotide of the present invention is a manufactured (artificial) antisense oligonucleotide.

[0048] The functional phenotype can be, for example, an RNA processing event that is regulated by or dependent on functional TDP-43 (i.e., non-abnormal TDP-43, typically nuclear TDP-43) and / or whose fidelity depends on functional TDP-43. Thus, the enhancement of TDP-43 function using the antisense oligonucleotides of the invention can be assessed by assessing the fidelity of RNA processing events that are regulated by or dependent on functional TDP-43 (as, for example, demonstrated herein, with reference to STMN2, CAMK2B, KALRN, ACTL6B and UNC13A RNA processing).

[0049] Advantageously, the antisense oligonucleotide or its contiguous nucleotide sequence comprises at least 12 or at least 13 contiguous nucleotides which are complementary, such as fully complementary, to the sequence UGUGUGUGUGUG (SEQ ID NO 85) or GUGUGUGUGUGU (SEQ ID NO 89) or UGUGUGUGUGUGU (SEQ ID NO 86) or GUGUGUGUGUGUG (SEQ ID NO 90).

[0050] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises at least 14 contiguous nucleotides that are complementary, such as fully complementary, to the sequence UGUGUGUGUGUGUG (SEQ ID NO 91) or GUGUGUGUGUGUGU (SEQ ID NO 92).

[0051] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises at least 18 contiguous nucleotides that are complementary, such as fully complementary, to the sequence (UG)n or (GU)n (wherein n is an integer from 6 to 20, such as 7 to 9).

[0052] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises at least 18 contiguous nucleotides that are complementary, such as fully complementary, to the sequence UGUGUGUGUGUGUGUGUG (SEQ ID NO 93) or GUGUGUGUGUGUGUGU (SEQ ID NO 94).

[0053] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to the present invention comprises a sequence selected from CACACAC, CACACACA, CACACACAC, ACACACAC or ACACACACA.

[0054] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 1.

[0055] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 2.

[0056] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 3.

[0057] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 4.

[0058] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 5.

[0059] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 6.

[0060] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 7.

[0061] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 8.

[0062] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 9.

[0063] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 10.

[0064] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 11.

[0065] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 12.

[0066] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 13.

[0067] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO 14.

[0068] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 15.

[0069] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 16.

[0070] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 17.

[0071] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 18.

[0072] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 19.

[0073] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 20.

[0074] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 21.

[0075] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 22.

[0076] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 23.

[0077] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 24.

[0078] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 25.

[0079] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 26.

[0080] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 27.

[0081] In some embodiments, the antisense oligonucleotide according to the present invention or its consecutive nucleotide sequence comprises the sequence SEQ ID NO 28.

[0082] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 29.

[0083] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 30.

[0084] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 31.

[0085] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 32.

[0086] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 33.

[0087] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 34.

[0088] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 35.

[0089] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 36.

[0090] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 37.

[0091] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 38.

[0092] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 39.

[0093] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 40.

[0094] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 41.

[0095] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 42.

[0096] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 43.

[0097] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 44.

[0098] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 45.

[0099] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 46.

[0100] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 47.

[0101] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 48.

[0102] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 49.

[0103] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 50.

[0104] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 51.

[0105] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 52.

[0106] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 53.

[0107] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 54.

[0108] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 55.

[0109] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 56.

[0110] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 57.

[0111] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 58.

[0112] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 59.

[0113] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 60.

[0114] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 61.

[0115] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 62.

[0116] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 63.

[0117] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 64.

[0118] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 65.

[0119] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 66.

[0120] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 67.

[0121] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 68.

[0122] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 69.

[0123] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 70.

[0124] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 71.

[0125] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 72.

[0126] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 73.

[0127] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 74.

[0128] In some embodiments, the antisense oligonucleotide according to the present invention or its consecutive nucleotide sequence comprises the sequence SEQ ID NO 75.

[0129] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 76.

[0130] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 77.

[0131] In some embodiments, the antisense oligonucleotide according to the present invention or its consecutive nucleotide sequence comprises the sequence SEQ ID NO 78.

[0132] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 79.

[0133] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 80.

[0134] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 81.

[0135] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 82.

[0136] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence SEQ ID NO 83.

[0137] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to the present invention comprises a sequence or compound as shown in Table 1.

[0138] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to the present invention comprises SEQ ID NOs 118-126.

[0139] In some embodiments, the antisense oligonucleotide according to the present invention or its consecutive nucleotide sequence comprises SEQ ID NO 118.

[0140] In some embodiments, the antisense oligonucleotide according to the present invention or its consecutive nucleotide sequence comprises SEQ ID NO 119.

[0141] In some embodiments, the antisense oligonucleotide according to the present invention or its consecutive nucleotide sequence comprises SEQ ID NO 120.

[0142] In some embodiments, the antisense oligonucleotide according to the present invention or its consecutive nucleotide sequence comprises SEQ ID NO 121.

[0143] In some embodiments, the antisense oligonucleotide according to the present invention or its consecutive nucleotide sequence comprises SEQ ID NO 122.

[0144] In some embodiments, the antisense oligonucleotide according to the present invention or its consecutive nucleotide sequence comprises SEQ ID NO 123.

[0145] In some embodiments, the antisense oligonucleotide according to the present invention or its consecutive nucleotide sequence comprises SEQ ID NO 124.

[0146] In some embodiments, the antisense oligonucleotide according to the present invention or its consecutive nucleotide sequence comprises SEQ ID NO 125.

[0147] In some embodiments, the antisense oligonucleotide according to the present invention or its consecutive nucleotide sequence comprises SEQ ID NO 126.

[0148] In some embodiments, the antisense oligonucleotide according to the present invention or a contiguous nucleotide sequence thereof comprises a sequence (CA)n or (AC)n, wherein n is an integer from 1 to 20, such as from 2 to 20, 3 to 20, 4 to 20, 5 to 20, 6 to 20, 7 to 20, 8 to 20, 9 to 20, 10 to 20, 11 to 20, 12 to 20, 13 to 20, 14 to 20, 15 to 20, 16 to 20, 17 to 20, 18 to 20, 19 to 20, 1 to 15, 1 to 10, 1 to 5, 5 to 15, 5 to 10 or 10 to 15.

[0149] In some embodiments, the antisense oligonucleotide according to the present invention or a contiguous nucleotide sequence thereof comprises the sequence (CA)n or (AC)n, wherein n is an integer such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0150] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to the present invention comprises a sequence selected from the group consisting of: SEQ ID No 1-83 or SEQ ID No 118-126.

[0151] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to the present invention consists of a sequence selected from the group consisting of: SEQ ID No 1-83 or SEQ ID No 118-126.

[0152] The contiguous nucleotide sequence may comprise a fragment of 8 or more contiguous nucleotides of any one of SEQ ID Nos 1-83 or SEQ ID Nos 118-126.

[0153] The contiguous nucleotide sequence may consist of a fragment of 8 or more contiguous nucleotides of any one of SEQ ID Nos 1-83 or SEQ ID Nos 118-126.

[0154] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 8 contiguous nucleotides.

[0155] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 9 contiguous nucleotides.

[0156] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 10 contiguous nucleotides.

[0157] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 11 contiguous nucleotides.

[0158] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 12 contiguous nucleotides.

[0159] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 13 contiguous nucleotides.

[0160] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 14 contiguous nucleotides.

[0161] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 15 contiguous nucleotides.

[0162] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 16 contiguous nucleotides.

[0163] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 17 contiguous nucleotides.

[0164] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 18 contiguous nucleotides.

[0165] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 19 contiguous nucleotides.

[0166] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 20 contiguous nucleotides.

[0167] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 21 contiguous nucleotides.

[0168] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 22 contiguous nucleotides.

[0169] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 23 contiguous nucleotides.

[0170] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 24 contiguous nucleotides.

[0171] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 25 contiguous nucleotides.

[0172] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 26 contiguous nucleotides.

[0173] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 27 contiguous nucleotides.

[0174] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 28 contiguous nucleotides.

[0175] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 29 contiguous nucleotides.

[0176] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 30 contiguous nucleotides.

[0177] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 31 contiguous nucleotides.

[0178] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 32 contiguous nucleotides.

[0179] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 33 contiguous nucleotides.

[0180] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 34 contiguous nucleotides.

[0181] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 35 contiguous nucleotides.

[0182] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 36 contiguous nucleotides.

[0183] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 37 contiguous nucleotides.

[0184] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 38 contiguous nucleotides.

[0185] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 39 contiguous nucleotides.

[0186] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 40 contiguous nucleotides.

[0187] In some embodiments, an antisense oligonucleotide may consist of a contiguous nucleotide sequence.

[0188] In some embodiments, the antisense oligonucleotide may be a contiguous nucleotide sequence.

[0189] In some embodiments, the contiguous nucleotide sequence may be at least 75% complementary to the target sequence.

[0190] In some embodiments, the contiguous nucleotide sequence may be at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to a target sequence.

[0191] In some embodiments, the contiguous nucleotide sequence may contain 1, 2, 3, 4, 5, 6, 7, 8 or more mismatches to the target sequence.

[0192] In some embodiments, antisense oligonucleotides according to the present invention have a Gibbs free energy of the antisense oligonucleotide to a complementary target RNA of less than about -10 ΔG, such as less than about -15 ΔG, such as less than about -17 ΔG.

[0193] Antisense oligonucleotides may be able to restore the functional phenotype of one or more TDP-43 target RNAs in cells that are TDP-43 depleted or express aberrant TDP-43 protein.

[0194] Advantageously, the antisense-oligonucleotides of the invention (which comprise a contiguous nucleotide sequence containing one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides) may further comprise one or more additional or alternative modified nucleosides. In other words, the antisense-oligonucleotides of the invention comprise one or more 2'-MOE nucleosides and may further comprise one or more additional or alternative modified nucleosides.

[0195] Advantageously, the antisense-oligonucleotides of the present invention may comprise LNA nucleosides. LNA nucleotides in a continuous nucleotide sequence are more advantageous. In some embodiments, the antisense-oligonucleotides of the present invention may comprise LNA nucleosides and non-LNA nucleosides, such as DNA nucleosides. In some embodiments, the antisense-oligonucleotides or their continuous nucleotide sequences may comprise LNA nucleosides and DNA nucleosides. In some embodiments, all nucleosides of the antisense-oligonucleotides or their continuous nucleotide sequences are independently selected from LNA and DNA nucleosides. Advantageously, the length of the continuous DNA nucleosides present in the antisense-oligonucleotides or their continuous nucleotide sequences is limited to prevent the recruitment of RNase H that causes degradation of the target RNA. Suitably, the antisense-oligonucleotides or their continuous nucleotide sequences do not contain more than four continuous DNA nucleosides, more advantageously do not contain more than 3 continuous DNA nucleosides.

[0196] When used, advantageously, the antisense oligonucleotides according to the present invention are capable of modulating the splicing of two or more TDP-43 target precursor mRNAs (target RNAs). For example, two or more TDP-43 target RNAs can be independently selected from the group consisting of STMN2 precursor mRNA, CAMK2B precursor mRNA, KALRN precursor mRNA, ACTL6B precursor mRNA and UNC13A precursor mRNA.

[0197] In some embodiments, antisense oligonucleotides according to the present invention are capable of modulating the splicing of one or more TDP-43 target pre-mRNAs (target RNAs).

[0198] In some embodiments, the antisense oligonucleotides according to the present invention are capable of modulating the splicing of two or more TDP-43 target pre-mRNAs (target RNAs).

[0199] In some embodiments, the antisense oligonucleotides according to the present invention are capable of modulating the splicing of three or more TDP-43 target pre-mRNAs (target RNAs).

[0200] In some embodiments, the antisense oligonucleotides according to the present invention are capable of modulating the splicing of four or more TDP-43 target pre-mRNAs (target RNAs).

[0201] In some embodiments, the antisense oligonucleotides according to the invention are capable of modulating the splicing of one, two, three, four, five, six, seven, eight, nine, ten or more TDP-43 target pre-mRNAs (target RNAs).

[0202] In some embodiments, when administered to TDP-43 depleted cells, the antisense oligonucleotides are capable of enhancing the fidelity of pre-mRNA splicing of at least one (such as two or more) pre-mRNA selected from the group consisting of: STMN2 pre-mRNA, CAMK2B pre-mRNA, KALRN pre-mRNA, ACTL6B pre-mRNA, and UNC13A pre-mRNA. In some embodiments, two or more selected pre-mRNAs are selected from the group consisting of: STMN2 and CAMK2B; STMN2 and KALRN; STMN2 and ACTL6B; and STMN2 and UNC13A.

[0203] In some embodiments, when administered to TDP-43 depleted cells, the antisense oligonucleotides are capable of enhancing the fidelity of pre-mRNA splicing of two or more pre-mRNAs selected from the group consisting of: STMN2 pre-mRNA, CAMK2B pre-mRNA, KALRN pre-mRNA, ACTL6B pre-mRNA, and UNC13A pre-mRNA. In some embodiments, the two or more selected pre-mRNAs are selected from the group consisting of: STMN2 and CAMK2B; STMN2 and KALRN; STMN2 and ACTL6B; STMN2 and UNC13A.

[0204] In some embodiments, when administered to TDP-43-depleted cells, the antisense oligonucleotides are capable of enhancing the fidelity of pre-mRNA splicing of three or more pre-mRNAs selected from the group consisting of STMN2 pre-mRNA, CAMK2B pre-mRNA, KALRN pre-mRNA, ACTL6B pre-mRNA, and UNC13A pre-mRNA.

[0205] In some embodiments, the antisense oligonucleotides are capable of enhancing the fidelity of pre-mRNA splicing of STMN2 pre-mRNA, CAMK2B pre-mRNA, KALRN pre-mRNA, ACTL6B pre-mRNA, and UNC13A pre-mRNA when administered to TDP-43-depleted cells.

[0206] In some embodiments, when administered to TDP-43-depleted cells expressing STMN2 pre-mRNA, the antisense oligonucleotide is capable of reducing the proportion of STMN2 mature mRNA comprising a cryptic exon (ce1) between exon 1 and exon 2 compared to wild-type STMN2 mature mRNA having a continuous exon 1 / exon 2 junction.

[0207] In some embodiments, the antisense oligonucleotide is capable of reducing the level of aberrant exon inclusion in CAMK2B mRNA transcripts when administered to TDP-43-depleted cells expressing CAMK2B pre-mRNA.

[0208] In some embodiments, the antisense oligonucleotide is capable of reducing the level of aberrant exon inclusion in the KALRN mRNA transcript when administered to TDP-43-depleted cells expressing KALRN pre-mRNA.

[0209] In some embodiments, the antisense oligonucleotide is capable of reducing the level of aberrant exon inclusion in the ACTL6B mRNA transcript when administered to TDP-43-depleted cells expressing ACTL6B pre-mRNA.

[0210] In some embodiments, the antisense oligonucleotide is capable of reducing the level of aberrant exon inclusion in UNC13A mRNA transcripts when administered to TDP-43-depleted cells expressing UNC13A pre-mRNA.

[0211] In some embodiments, the antisense oligonucleotide is capable of correcting aberrant splicing of two or more of STMN2, CAMK2B, KALRN, ACTL6B, and UNC13A pre-mRNA in TDP-43-depleted cells.

[0212] In some embodiments, the antisense oligonucleotide does not comprise a region of more than 3 or more than 4 consecutive DNA nucleosides.

[0213] In some embodiments, the antisense oligonucleotide is incapable of mediating RNase H cleavage.

[0214] In some embodiments, the antisense oligonucleotide is a morpholino antisense oligonucleotide.

[0215] In some embodiments, an antisense oligonucleotide comprising one or more 2'-MOE nucleosides, or a contiguous nucleotide sequence thereof, may further comprise one or more affinity-enhancing nucleosides, such as 2' sugar-modified nucleosides, which enhance the binding affinity between the antisense oligonucleotide and a complementary RNA molecule, for example and advantageously to provide a lower Gibbs free energy, such as a Gibbs free energy below -10, such as a Gibbs free energy below -15.

[0216] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprising one or more 2'-MOE nucleosides may further comprise one or more modified nucleosides, such as 2' sugar modified nucleosides independently selected from the group consisting of: 2'-O-alkyl-RNA; 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabino nucleic acid (ANA); 2'-fluoro-ANA; locked nucleic acid (LNA) or a combination thereof.

[0217] In some embodiments, the 2' sugar modified nucleoside can be an affinity enhanced 2' sugar modified nucleoside.

[0218] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleosides in the antisense oligonucleotide, or contiguous nucleotide sequence thereof, are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides, which are optionally linked by one or more phosphorothioate internucleoside bonds.

[0219] In some embodiments, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% of the nucleosides in an antisense oligonucleotide or contiguous nucleotide sequence thereof are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides, optionally linked by one or more phosphorothioate internucleoside bonds.

[0220] In some embodiments, all nucleosides in an antisense oligonucleotide or contiguous nucleotide sequence thereof are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides, optionally linked by one or more phosphorothioate internucleoside linkages.

[0221] In some embodiments, an antisense oligonucleotide comprising one or more 2'-MOE nucleosides or a contiguous nucleotide sequence thereof may further comprise a 2'-O-methyl nucleoside.

[0222] In some embodiments, one or more of the further modified nucleosides within the antisense oligonucleotide or contiguous nucleotide sequence thereof is a locked nucleic acid nucleoside (LNA), such as an LNA nucleoside selected from the group consisting of constrained ethyl nucleoside (cEt) or β-D-oxy-LNA.

[0223] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide comprises nucleosides, LNA nucleosides and DNA nucleosides, optionally linked by phosphorothioate internucleoside linkages.

[0224] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence is a mixed polymer or a full polymer.

[0225] In some embodiments, the antisense oligonucleotide or its consecutive nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID No 1-83 or SEQ ID No 118-126 or at least 8 consecutive nucleotides thereof.

[0226] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 9 contiguous nucleotides thereof.

[0227] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 10 contiguous nucleotides thereof.

[0228] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 11 contiguous nucleotides thereof.

[0229] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 12 contiguous nucleotides thereof.

[0230] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 13 contiguous nucleotides thereof.

[0231] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 14 contiguous nucleotides thereof.

[0232] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 15 contiguous nucleotides thereof.

[0233] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 16 contiguous nucleotides thereof.

[0234] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 17 contiguous nucleotides thereof.

[0235] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 18 contiguous nucleotides thereof.

[0236] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 19 contiguous nucleotides thereof.

[0237] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 20 contiguous nucleotides thereof.

[0238] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 21 contiguous nucleotides thereof.

[0239] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 22 contiguous nucleotides thereof.

[0240] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 23 contiguous nucleotides thereof.

[0241] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 24 contiguous nucleotides thereof.

[0242] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 25 contiguous nucleotides thereof.

[0243] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 26 contiguous nucleotides thereof.

[0244] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 27 contiguous nucleotides thereof.

[0245] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 28 contiguous nucleotides thereof.

[0246] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 29 contiguous nucleotides thereof.

[0247] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 30 contiguous nucleotides thereof.

[0248] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 31 contiguous nucleotides thereof.

[0249] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 32 contiguous nucleotides thereof.

[0250] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 33 contiguous nucleotides thereof.

[0251] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 34 contiguous nucleotides thereof.

[0252] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises a nucleobase sequence selected from the group consisting of SEQ ID Nos 1-83 or SEQ ID Nos 118-126 or at least 35 contiguous nucleotides thereof.

[0253] In some embodiments, the cytosine bases present in the antisense oligonucleotide or contiguous nucleotide sequence thereof are independently selected from the group consisting of cytosine and 5-methylcytosine.

[0254] In some embodiments, the cytosine base present in the antisense oligonucleotide or contiguous nucleotide sequence thereof is 5-methylcytosine.

[0255] In some embodiments, the LNA cytosine base present in the antisense oligonucleotide or contiguous nucleotide sequence thereof is LNA 5-methylcytosine.

[0256] In some embodiments, the LNA cytosine base present in the antisense oligonucleotide or contiguous nucleotide sequence thereof is LNA 5-methylcytosine and the DNA cytosine base is cytosine.

[0257] Advantageously, one or more internucleoside linkages between nucleosides on a continuous nucleotide sequence are modified. In certain embodiments, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100% of the internucleoside linkages between nucleosides on a continuous nucleotide sequence are modified.

[0258] In some embodiments, one or more or all modified internucleoside linkages are phosphorothioate linkages. In some embodiments, one or more or all linkages within a contiguous nucleotide sequence are phosphorothioate linkages.

[0259] In some embodiments, all internucleoside linkages present in a contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0260] In some embodiments, all internucleoside linkages present in the antisense oligonucleotide are phosphorothioate internucleoside linkages.

[0261] In some embodiments, the antisense oligonucleotides of the invention attached to at least one cholesterol moiety may further comprise one or more conjugate groups. In other words, the antisense oligonucleotides of the invention are attached to at least one cholesterol moiety and may further comprise one or more additional conjugate groups that are not cholesterol moieties.

[0262] In some embodiments, the antisense oligonucleotides of the invention may be covalently attached to at least one conjugate moiety.

[0263] In some embodiments, the antisense oligonucleotides of the present invention may be in the form of a pharmaceutically acceptable salt. In some embodiments, the salt may be a sodium salt or a potassium salt or an ammonium salt.

[0264] The present invention provides a pharmaceutical composition comprising the antisense oligonucleotide of the present invention and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0265] The present invention provides a pharmaceutical composition comprising the antisense oligonucleotide of the present invention and a pharmaceutically acceptable diluent or solvent and a cation. The cation may be, for example, a sodium cation or a potassium cation. The diluent / solvent may be water.

[0266] The present invention provides a method for enhancing TDP-43 function in a cell expressing abnormal or depleted levels of TDP-43, such as an in vivo or in vitro method, comprising administering an antisense oligonucleotide of the present invention or a composition of the present invention in an effective amount to the cell.

[0267] The present invention provides a method for treating or preventing a TDP-43 pathological condition in a subject, the method comprising administering a therapeutically or prophylactically effective amount of an antisense oligonucleotide of the present invention or a composition of the present invention to a subject suffering from or susceptible to a TDP-43 pathological condition.

[0268] The present invention provides an antisense oligonucleotide of the present invention or a composition of the present invention for use as a medicine.

[0269] The present invention provides an antisense oligonucleotide of the present invention or a composition of the present invention for use in treating TDP-43 pathological conditions.

[0270] The present invention provides the use of the antisense oligonucleotide of the present invention or the composition of the present invention for preparing a medicament for treating or preventing TDP-43 pathological conditions.

[0271] The present invention provides a method according to the present invention, an antisense oligonucleotide for use according to the present invention or a pharmaceutical composition according to the present invention or a use according to the present invention, wherein the TDP-43 pathological condition is a neurological disorder selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis, progressive muscular atrophy, Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine diseases such as spinocerebellar ataxia type 3, myopathy and chronic traumatic encephalopathy.

[0272] In some embodiments, the TDP-43 pathology is a neurological disorder selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD).

[0273] The present invention provides a pharmaceutical composition comprising the antisense oligonucleotide of the present invention and a pharmaceutically acceptable solvent, such as phosphate buffered saline.

[0274] In some embodiments, the antisense oligonucleotides of the invention may be in the form of a solid powder, such as in the form of a lyophilized powder.

[0275] Typically, the antisense oligonucleotides of the invention comprise a contiguous nucleotide sequence of at least 8 or at least 10 nucleotides in length (such as 10-32, 15-32, 20-32, 21-32, 22-32, 23-32, 24-32, 25-32, 26-32, 27-32 or 10-20 nucleotides in length), wherein the contiguous nucleotide sequence is at least 75% complementary to the TDP-43 RNA binding sequence, such as at least 90% complementary or fully complementary. In some embodiments, all nucleosides of the antisense oligonucleotide form a contiguous nucleotide sequence.

[0276] In some embodiments, the antisense oligonucleotides of the invention are capable of modulating the splicing of at least one human pre-mRNA. For example, the splicing of human STMN2, CAMK2B, KALRN, ACTL6B and UNC13A pre-mRNAs depends on TDP-43 binding, as shown in the Examples.

[0277] In another aspect, the invention provides a method for treating or preventing a neurodegenerative disease such as amyotrophic lateral sclerosis (ALS), the method comprising administering to a subject suffering from or susceptible to the disease a therapeutically or prophylactically effective amount of an oligonucleotide of the invention.

[0278] In another aspect, the oligonucleotides or compositions of the invention are used to treat or prevent a neurodegenerative disease, such as a neurodegenerative disorder characterized by TDP-43 pathology or mislocalization of TDP-43 from the nucleus, such as amyotrophic lateral sclerosis (ALS).

[0279] Sequence Listing

[0280] The Sequence Listing filed with this application is hereby incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0281] Figure 1 - Diagram showing the attachment of cholesterol to the 5' of the ASO. DETAILED DESCRIPTION

[0282] RNA-binding protein mimics and TDP-43 mimics

[0283] TDP-43 is a TAR RNA / DNA binding protein that is encoded in humans on human chromosome 1: 11,012,653-11,022,858 forward strand (gene ENSG00000120948, Chr 1: 11,012,344–11,025,739, example of a typical TDP-43 transcript = ENST00000439080.6) and is widely involved in RNA splicing, stability and metabolism. In healthy cells, TDP-43 protein is located in the nucleus, but in several neurodegenerative diseases, dysfunctional TDP-43 aggregates are formed in the cytoplasm (usually associated with hyperphosphorylated and ubiquitinated TDP-43).

[0284] TDP-43 is an example of an RNA binding protein that binds to GU repeats in many independent RNA transcripts. The interaction of RNA binding proteins such as TDP-43 with a large population of RNA transcripts has a profound effect on the biology of RNA transcripts (such as splicing on pre-mRNA, RNA stability, RNA accumulation), thus providing a mechanism to influence the expression of independent RNA populations in cells. This is particularly relevant in the context of TDP-43 depletion, where loss of RNA binding of functional TDP-43 is closely associated with neurodegeneration.

[0285] The present invention provides antisense oligonucleotides that are complementary to GU-rich regions on multiple RNA transcripts, such as conserved TDP-43 binding sites on a population of pre-mRNA transcripts. As shown in the examples, administration of the antisense oligonucleotides of the present invention can restore functional processing of multiple independent RNA transcripts that otherwise are abnormally processed when RNA binding proteins (e.g., TDP-43) are depleted or absent. Therefore, the antisense oligonucleotides of the present invention (also referred to as compounds of the present invention) can be referred to as RNA binding protein mimics or TDP-43 mimics because they restore the function of RNA binding proteins (such as TDP-43) and regulate the RNA biology of multiple RNA transcripts.

[0286] For example, RNA binding protein function (such as TDP-43 function) restored or enhanced by using the compounds of the invention (e.g., in TDP-43 depleted cells) is the expression of pre-mRNA transcripts, processing (e.g., splicing) events, resulting in restoration of functional gene expression that is otherwise dysregulated in cells with reduced levels of functional TDP-43 (referred to herein as TDP-43 depleted cells). This may result in enhanced gene expression or enhanced quality of gene expression.

[0287] Advantageously, the compounds of the present invention are able to mimic functional TDP-43 and restore the nuclear function of TDP-43 in the expression of one or more TDP-43 target RNAs, thereby restoring the functional phenotype of one or more TDP-43 target RNAs.

[0288] It is understood that other RNA binding proteins can bind to the TDP-43 binding site, and thus TDP-43 mimetics referred to herein are oligonucleotides that are complementary to the TDP-43 binding site of one or more RNA targets, such as multiple nucleic acid targets (i.e., RNA targets described from different gene loci), and are capable of restoring normal (wild-type) expression.

[0289] As reported in Arnold et al., PNAS 2013, some TDP-43 pathologies are associated with certain TDP-43 mutations, and these may not necessarily be associated with TDP-43 cytoplasmic depletion. In the context of the present invention, the normal function of TDP-43 may be genetically disrupted, so this is also considered a potential source of depleted or normal TDP-43, a phenotype that may be addressed using the TDP-43 mimetics of the present invention.

[0290] TDP-43 RNA Target Examples

[0291] Depletion of TDP-43 in neuronal cells leads to profound changes in RNA processing of a large number of RNA transcripts in the cell.

[0292] These examples show five of these TDP-43 target RNAs: STMN2, KALRN, ACTL6B, UNC13A, and CAMK2B, but the present invention is not limited thereto.

[0293] Arnold et al., PNAS 2013 110 E736–745 Identify TDP-43-bound RNAs with widespread pre-mRNA splicing aberrations in TDP-43-depleted cells (TDP-43 ASO-depleted mice) and illustrate the identification of indicative TDP-43-regulated splicing events using microarray analysis. Arnold et al. identified RNAs whose splicing is regulated by TDP-43, including Eif4h, Taf1b, Kcnip2, (TDP-43 mutation dependent), Sort1, Kcnd3, Ahi1, Atxn2, Ctnnd (dose dependent).

[0294] STMN2 (Klim et al., Nat Neurosci. 2019 Feb;22(2):167-179) - TDP-43 depletion in neuronal cells (e.g., in ALS) leads to mis-splicing of STMN2 transcripts. STMN2 encodes a microtubule regulator whose expression is decreased after TDP-43 knockdown and TDP-43 mislocalization, as well as in patient-specific motor neurons and autopsy patient spinal cords.

[0295] Post-translational stabilization of STMN2 rescues defects in neurite outgrowth and axon regeneration induced by TDP-43 depletion. TDP-43 depletion leads to the incorporation of a cryptic intron between exon 1 and exon 2 of STMN2. WO2019 / 241648 discloses a fully MOE-modified phosphorothioate ASO for inhibiting the mis-splicing of STMN2.

[0296] The above-described transcripts and associated TDP-43 depletion splicing events can be used to assay for restoration of TDP-43 function using the compounds of the invention.

[0297] TDP-43 Pathology

[0298] TDP-43 pathology is a disease associated with decreased or abnormal TDP-43 expression, which is often associated with an increase in cytoplasmic TDP-43, particularly hyperphosphorylated and ubiquitinated TDP-43.

[0299] TDP-43 depletion is manifested in a range of diseases, referred to as TDP-43 pathology, and includes, for example, diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis, progressive muscular atrophy, Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine diseases such as spinocerebellar ataxia type 3, myopathies, and chronic traumatic encephalopathy.

[0300] TDP-43 depleted cells

[0301] TDP-43 depleted cells refer to cells with reduced functional levels of TDP-43. It will be understood that in TDP-43 pathology, aberrant TDP-43 expression results in accumulation of dysfunctional cytoplasmic TDP-43, as well as reduced levels of functional nuclear TDP-43 - since such cells depleted of TDP-43 may be characterized by reduced levels of TDP-43 function, they may be associated with elevated levels of dysfunctional TDP-43. For in vitro assessment, TDP-43 depletion may be engineered, for example, by genetic engineering methods (e.g., CRISPR / CAS9), or, as shown in the Examples, by using antisense oligonucleotide inhibitors of TDP-43 (illustrated by spacer oligonucleotides targeting human TDP-43 transcripts).

[0302] In some embodiments, the cells in which TDP-43 is depleted are neuronal cells.

[0303] Sequence complementary to the TDP-43 binding site

[0304] TDP-43 binding sites are characterized, for example, by a poly-GU motif (see RNA Binding Database https: / / attract.cnic.es / results / e9f29380-8921-406e-84a8-27ce9b9398b4# ), and interventions suitable for antisense oligonucleotides may contain a (GU)n or (UG)n motif, wherein n is at least 3 or preferably at least 4. In some embodiments, n is 4, 5, 6, 7, 8, 9 or 10.

[0305] In some embodiments, the TDP-43 binding site may comprise a sequence selected from the group consisting of (UG)n, (GU)n, wherein n is 4 to 20, UGUGUGUG, UGUGUGUGU, UGUGUGUGUG (SEQ ID NO 95), UGUGUGUGUGU (SEQ ID NO 84), UGUGUGUGUGUG (SEQ ID NO 85), UGUGUGUGUGUGU (SEQ ID NO 86), GUGUGUGU, GUGUGUGUG, GUGUGUGUGU (SEQ ID NO 87), GUGUGUGUGUG (SEQ ID NO 88), GUGUGUGUGUGU (SEQ ID NO 89), GUGUGUGUGUGUG (SEQ ID NO 90), and GUGAAUGA.

[0306] In some embodiments, the TDP-43 binding site may comprise a sequence selected from the group consisting of GUGAAUGA, GUUGUGC, UGUGUGUGUGUG (SEQ ID NO 85), GAAUGG, UGUGUGUG, GAAUGA, UGUGUG, GUUGUUC, and GUUUUGC. In some embodiments, the TDP-43 binding site may comprise the sequence UGUGUGUGUGUGUG (SEQ ID NO 91).

[0307] In some embodiments, the antisense oligonucleotides of the present invention may comprise a sequence that is complementary (such as fully complementary) to one or more sequences selected from the group consisting of: (UG)n, (GU)n, wherein n is 4 to 20, UGUGUGUG, UGUGUGUGU, UGUGUGUGUG (SEQ ID NO 95), UGUGUGUGUGU (SEQ ID NO 84), UGUGUGUGUGUG (SEQ ID NO 85), UGUGUGUGUGUGU (SEQ ID NO 86), GUGUGUGU, GUGUGUGUG, GUGUGUGUGU (SEQ ID NO 87), GUGUGUGUGUG (SEQ ID NO 88), GUGUGUGUGUGU (SEQ ID NO 89), GUGUGUGUGUGUG (SEQ ID NO 90), and GUGAAUGA.

[0308] The antisense oligonucleotides of the invention may comprise a sequence that is complementary (such as fully complementary) to a TDP-43 binding site sequence, such as one or more sequences selected from the group consisting of: (GU)n, (UG)n, GUGAAUGA, GUUGUGC, GAAUGG, UGUGUGUG, GAAUGA, UGUGUG, UGUGUGUGUGUG (SEQ ID NO 85), GUUGUUC and GUUUUGC.

[0309] Oligonucleotides

[0310] As used herein, the term "oligonucleotide" is defined as a molecule comprising two or more covalently linked nucleosides as is generally understood by those skilled in the art. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are typically prepared in a laboratory by first being synthesized by solid phase chemistry and then purified and separated. When referring to the sequence of an oligonucleotide, reference is made to the sequence or order of the covalently linked nucleotides or nucleosides or their modifications. The antisense oligonucleotides of the present invention are artificial, and are chemically synthesized, and are typically purified or separated.

[0311] The antisense-oligonucleotides of the invention comprising a contiguous nucleotide sequence comprising one or more 2'-MOE nucleosides may further comprise one or more further or additional modified nucleosides, such as 2' sugar modified nucleosides. The antisense-oligonucleotides of the invention may comprise one or more modified internucleoside linkages, such as one or more phosphorothioate internucleoside linkages.

[0312] Antisense Oligonucleotides

[0313] As used herein, the term "antisense oligonucleotide" is defined as an oligonucleotide that can regulate the expression of a target gene by hybridizing with a target nucleic acid, particularly hybridizing with a continuous sequence on the target nucleic acid. Antisense oligonucleotides are not double-stranded in fact, and are therefore not siRNA or shRNA. The antisense oligonucleotides of the present invention can be single-stranded. It should be understood that the single-stranded oligonucleotides of the present invention can form a hairpin or intermolecular duplex structure (a duplex between two molecules of the same oligonucleotide), as long as the degree of self-complementarity within or therebetween is less than about 50% of the total length across the oligonucleotide.

[0314] In some embodiments, the single-stranded antisense oligonucleotides of the invention may be free of RNA nucleosides.

[0315] Advantageously, the antisense oligonucleotides of the invention comprising a contiguous nucleotide sequence comprising one or more 2'-MOE nucleosides may further comprise one or more further or additional modified nucleosides or nucleotides, such as 2' sugar modified nucleosides. In addition, in some antisense oligonucleotides of the invention, it may be advantageous that the unmodified nucleosides are DNA nucleosides.

[0316] Continuous nucleotide sequence

[0317] The term "continuous nucleotide sequence" refers to an oligonucleotide region that is complementary to a target nucleic acid. The term is used interchangeably herein with the term "continuous core base sequence" and the term "oligonucleotide motif sequence". In certain embodiments, all nucleosides of antisense oligonucleotides constitute a continuous nucleotide sequence. A continuous nucleotide sequence is a sequence of nucleotides in an oligonucleotide of the present invention that is complementary to a target nucleic acid or a target sequence, and in some cases is completely complementary.

[0318] In certain embodiments, antisense oligonucleotide comprises continuous nucleotide sequence, and can optionally comprise other one or more nucleotides, for example can be used for functional group (for example, conjugate group) is connected to the nucleotide joint region of continuous nucleotide sequence.Nucleotide joint region can be complementary or non-complementary with target nucleic acid.It should be understood that the continuous nucleotide sequence of this oligonucleotide can not be longer than oligonucleotide itself, and this oligonucleotide can not be shorter than continuous nucleotide sequence.

[0319] Nucleotides and nucleosides

[0320] Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and for purposes of the present invention, include both naturally occurring and non-naturally occurring nucleotides and nucleosides. In nature, nucleotides, such as DNA and RNA nucleotides, contain a ribose sugar moiety, a core base moiety, and one or more phosphate groups (which are not present in nucleosides). Nucleosides and nucleotides may also be referred to interchangeably as "units" or "monomers."

[0321] Modified Nucleosides

[0322] As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside modified by introducing one or more modifications of a sugar moiety or (core) base moiety compared to an equivalent DNA or RNA nucleoside. Advantageously, the antisense oligonucleotide of the present invention comprising a continuous nucleotide sequence containing one or more 2'-MOE nucleosides may further comprise one or more further or additional modified nucleosides, which comprise a modified sugar moiety. The term modified nucleoside may also be used interchangeably with the term "nucleoside analogs" or modified "units" or modified "monomers" herein. Nucleosides with unmodified DNA or RNA sugar moieties are referred to herein as DNA or RNA nucleosides. If Watson Crick (Watson Crick) base pairing is allowed in the base region of a DNA or RNA nucleoside, it is still generally referred to as DNA or RNA. Exemplary modified nucleosides that can be used in the compounds of the present invention include LNA, 2'-O-MOE and morpholino nucleoside analogs.

[0323] Modified internucleoside linkages

[0324] As commonly understood by those skilled in the art, the term "modified internucleoside linkage" is defined as a linkage that covalently couples two nucleosides together, except for a phosphodiester (PO) linkage. The antisense oligonucleotides of the present invention may therefore comprise one or more modified internucleoside linkages, such as one or more phosphorothioate internucleoside linkages.

[0325] In some embodiments, at least 50% of the internucleoside bonds in the antisense oligonucleotide or its continuous nucleotide sequence are phosphorothioates, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80% or such as at least 90% or more of the internucleoside bonds in the antisense oligonucleotide or its continuous nucleotide sequence are phosphorothioates. In some embodiments, all internucleoside bonds in the antisense oligonucleotide or its continuous nucleotide sequence are phosphorothioates.

[0326] Advantageously, all internucleoside bonds of the contiguous nucleotide sequence of the antisense-oligonucleotide are phosphorothioate, or all internucleoside bonds of the antisense-oligonucleotide are phosphorothioate bonds.

[0327] Nucleobase

[0328] The term nucleobase includes purines (e.g., adenine and guanine) and pyrimidines (e.g., uracil, thymine, and cytosine) present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term nucleobase also encompasses modified nucleobases that are different from naturally occurring nucleobases but functional during nucleic acid hybridization. In this context, "nucleobase" refers to naturally occurring nucleobases such as adenine, guanine, cytosine, thymine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012), Accounts of Chemical Research, Vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Supplement 37 1.4.1.

[0329] In some embodiments, the nucleobase moiety is modified by changing a purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, 2'-thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine, 5'-nitroindole.

[0330] The nucleobase moiety may be represented by a letter code for each corresponding nucleobase, such as A, T, G, C or U, wherein each letter may optionally include a functionally equivalent modified nucleobase. For example, in an exemplary antisense oligonucleotide, the nucleobase moiety is selected from A, T, G, C and 5-methylcytosine. Optionally, a 5-methylcytosine LNA nucleoside may be used in the LNA spacer.

[0331] Modified oligonucleotides

[0332] The term modified oligonucleotide describes a kind of antisense oligonucleotide, and it comprises one or more sugar-modified nucleosides and / or modified internucleoside bonds.Term " chimeric oligonucleotide " is the term used in the literature to describe the oligonucleotide comprising sugar-modified nucleosides and DNA nucleosides.In certain embodiments, it may be advantageous that antisense oligonucleotide of the present invention is a chimeric oligonucleotide.

[0333] Complementarity

[0334] The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). It should be understood that oligonucleotides may contain nucleosides with modified nucleobases, for example, 5-methylcytosine is often used instead of cytosine, and therefore, the term complementarity encompasses Watson-Crick base pairing between unmodified nucleobases and modified nucleobases (see, for example, Hirao et al. (2012) Accounts of Chemical Research, Vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Supplement 37 1.4.1).

[0335] As used herein, the term "complementarity percentage" refers to the ratio (expressed as a percentage) of nucleotides complementary to a reference sequence (such as a target sequence or sequence motif) of a continuous nucleotide sequence in a nucleic acid molecule (such as an oligonucleotide), which spans a continuous nucleotide sequence. Therefore, by counting the number of aligned nucleobases complementary (forming Watson Crick base pairs) between the two sequences (when the oligonucleotide sequences of 5'-3' and 3'-5' of the target sequence are aligned), dividing it by the total number of nucleotides in the oligonucleotide, and then multiplying it by 100, the percentage of complementarity is calculated. In such comparisons, nucleobases / nucleotides that are not aligned (forming base pairs) are called mismatches. Insertions and deletions are not allowed in the calculation of the % complementarity of continuous nucleotide sequences. It should be understood that when determining complementarity, as long as the functional ability of the nucleobases forming Watson Crick base pairing is retained, the chemical modification of the nucleobase is not considered (for example, when calculating the percentage of complementarity, 5'-methylcytosine is considered to be the same as cytosine).

[0336] In the present invention, the level of complementarity between the contiguous nucleotide sequence of the antisense oligonucleotide and the TDP-43 binding site or target sequence may be at least about 75%.

[0337] In the present invention, the level of complementarity between the contiguous nucleotide sequence of the antisense oligonucleotide and the target TDP-43 binding site or target sequence may be at least about 80%.

[0338] In the present invention, the level of complementarity between the contiguous nucleotide sequence of the antisense oligonucleotide and the TDP-43 binding site or target sequence may be at least about 85%.

[0339] In the present invention, the level of complementarity between the contiguous nucleotide sequence of the antisense oligonucleotide and the TDP-43 binding site or target sequence may be at least about 90%.

[0340] In the present invention, the level of complementarity between the contiguous nucleotide sequence of the antisense oligonucleotide and the TDP-43 binding site or target sequence may be at least about 95%.

[0341] In some embodiments, the contiguous nucleotide sequence may be fully complementary to the TDP-43 binding site or target sequence. The term "fully complementary" refers to 100% complementarity.

[0342] The compounds of the present invention are complementary to the TDP-43 binding site in the TDP-43 target RNA.

[0343] Perfect complementarity may not be required, and in some embodiments, the antisense oligonucleotide may contain one, two, three, four, five, six, seven, eight or more mismatches to the TDP-43 RNA binding site of the TDP-43 target RNA to which it effectively binds. In this regard, antisense oligonucleotides can be designed that are fully complementary to multiple but not identical TDP-43 binding sites in different TDP-43 target RNAs. In some embodiments, universal bases (such as inosine) can be used for complementary positions in antisense oligonucleotides, where these positions do not have complete identity with TDP-43 binding site sequences in multiple TDP-43 RNA targets.

[0344] In some embodiments, the contiguous nucleotide sequence may include one or more mismatches to the TDP-43 binding site or target sequence.

[0345] In some embodiments, the contiguous nucleotide sequence may include two or more mismatches to the TDP-43 binding site or target sequence.

[0346] In some embodiments, the contiguous nucleotide sequence may include three or more mismatches to the TDP-43 binding site or target sequence.

[0347] In some embodiments, the contiguous nucleotide sequence may include four or more mismatches to the TDP-43 binding site or target sequence.

[0348] In some embodiments, the contiguous nucleotide sequence may include five or more mismatches to the TDP-43 binding site or target sequence.

[0349] In some embodiments, the contiguous nucleotide sequence may include six or more mismatches to the TDP-43 binding site or target sequence.

[0350] In some embodiments, the contiguous nucleotide sequence may include seven or more mismatches to the TDP-43 binding site or target sequence.

[0351] In some embodiments, the contiguous nucleotide sequence may include eight or more mismatches to the TDP-43 binding site or target sequence.

[0352] In some embodiments, for oligonucleotides of 10 to 32 nucleotides in length, antisense oligonucleotides of the invention containing one or more, such as two or more, three or more, four or more, five or more, six or more, seven or more, or eight or more mismatches can hybridize to a target nucleic acid with an estimated ΔG° value of less than -10 kcal.

[0353] In some embodiments, for oligonucleotides of 10 to 32 nucleotides in length, antisense oligonucleotides of the invention containing one or more, such as two or more, three or more, four or more, five or more, six or more, seven or more, or eight or more mismatches can hybridize to a target nucleic acid with an estimated ΔG° value of less than -12 kcal, -15 kcal, -17 kcal, -20 kcal, -30 kcal, -40 kcal, -50 kcal, or -60 kcal.

[0354] The calculation of ΔG value is discussed below.

[0355] Identity

[0356] As used herein, the term "identity" refers to the ratio of nucleotides (expressed as a percentage) of a continuous nucleotide sequence in a nucleic acid molecule (such as an oligonucleotide) that is identical to a reference sequence (such as a sequence motif), and the nucleic acid molecule spans a continuous nucleotide sequence. Therefore, by counting the number of aligned nuclear bases that are identical (matched) in two sequences (in the continuous nucleotide sequence of the compound of the present invention and in the reference sequence), the number is divided by the total number of nucleotides of the oligonucleotide and multiplied by 100 to calculate the identity percentage. Therefore, the percentage of identity = (matching number x 100) / length of the alignment region (such as a continuous nucleotide sequence). Insertions and deletions are not allowed in the calculation of the percentage of identity of a continuous nucleotide sequence. It should be understood that when determining the identity, as long as the functional ability of the nuclear base forming Watson Crick base pairing is retained, the chemical modification of the nuclear base is not considered (for example, when calculating the identity percentage, 5-methylcytosine is considered to be the same as cytosine).

[0357] Hybridization

[0358] As used herein, the term "hybridizing" (hybridizes) should be understood as the formation of hydrogen bonds between base pairs on opposite strands of two nucleic acid chains (e.g., an oligonucleotide and a target nucleic acid), thereby forming a duplex. The binding affinity between the two nucleic acid chains is the strength of the hybridization. It is usually measured in terms of the melting temperature (T m), the melting temperature is defined as the temperature at which half of the oligonucleotides and the target nucleic acid form a duplex. Under physiological conditions, T m It is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515–537). The standard state Gibbs free energy ΔG° more accurately represents the binding affinity and is given by ΔG° = -RTln(K d ) and the dissociation constant (K d ), where R is the gas constant and T is the absolute temperature. Therefore, the very low ΔG° of the reaction between the oligonucleotide and the target nucleic acid reflects the strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with the reaction with a water concentration of 1M, a pH of 7, and a temperature of 37°C. The hybridization of the oligonucleotide with the target nucleic acid is a spontaneous reaction, and the ΔG° of a spontaneous reaction is less than zero. ΔG° can be measured experimentally, for example, by using an isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36–38 and Holdgate et al., 2005, Drug Discov Today. The technician will know that commercial equipment can be used for ΔG° measurement. ΔG ° can also be estimated numerically using the nearest neighbor model described in SantaLucia, 1998, Proc Natl Acad Sci USA.95:1460–1465, appropriately using the derived thermodynamic parameters described in Sugimoto et al., 1995, Biochemistry 34:11211–11216 and McTigue et al., 2004, Biochemistry 43:5388–5405. In some embodiments, for oligonucleotides of 10 to 30 nucleotides in length, the antisense oligonucleotides of the present invention hybridize with target nucleic acids with an estimated ΔG ° value of less than -10 kcal. In some embodiments, the degree or intensity of hybridization is measured by the standard state Gibbs free energy ΔG °. For oligonucleotides of 8 to 30 nucleotides in length, antisense oligonucleotides can hybridize with target nucleic acids with an estimated ΔG ° value of less than -10 kcal, such as less than -15 kcal, such as less than -20 kcal, and such as less than -25 kcal. In some embodiments, the oligonucleotide hybridizes to the target nucleic acid with an estimated AG° of -10 kcal to -60 kcal, such as -12 kcal to -40 kcal, such as -15 kcal to -30 kcal, or -16 kcal to -27 kcal, such as -18 kcal to -25 kcal.

[0359] Exemplary TDP-43 RNA targets

[0360] In some embodiments, the TDP-43 target RNA is a mammalian protein called stathmin 2 or SCG10, SCGN10, such as human STMN2 disclosed as gene: ENSG00000104435 (ensemble.org), encoded on human chromosome 8: 79,610,814-79,666,175 forward strand (GRCh38: CM000670.2).

[0361] In some embodiments, the TDP-43 target RNA is CAMK2B.

[0362] In some embodiments, the TDP-43 target RNA is KALRN.

[0363] In some embodiments, the TDP-43 target RNA is UNC13A.

[0364] In some embodiments, the TDP-43 target RNA is ACTL6B.

[0365] Target cells

[0366] As used herein, the term "target cell" refers to a cell expressing a targeted TDP-43 RNA target, the expression of which will be corrected by administering a compound of the invention. Suitably, the target cell is further depleted of TDP-43. For experimental use, TDP-43 depletion can be engineered into the cell, for example, by genetic engineering (e.g., CRISPR / CAS9) or by using an ASO inhibitor of TDP-43.

[0367] In some embodiments, the target cell can be in vivo or in vitro. In some embodiments, the target cell is a mammalian cell, such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell, such as a monkey cell or a human cell.

[0368] In some embodiments, the target cell is a mammalian neuron cell.

[0369] For in vitro evaluation, the target cell can be a glutamatergic neuron (also referred to herein as a glutamatergic neuron cell), such as a human glutamatergic neuron, such as a human glutamatergic neuron depleted of TDP-43. Human glutamatergic neurons can be obtained from Cellular Dynamics (iCell GlutaNeurons). For in vitro evaluation, target cells, such as glutamatergic neurons, are in vitro. TDP-43 depletion of target cells (e.g., for in vitro evaluation) can be achieved, for example, using antisense oligonucleotides or siRNA reagents, or can be engineered into cells, for example, by CRISPR / Cas9 editing or shRNA vector expression. As further described in the examples, target cells (e.g., for in vitro use) can be neurons derived from human pluripotent stem cells, such as these can be obtained as iCell GlutaNeurons kits, 01279 item number R1034 (Fujifilm Cellular Dynamics).

[0370] Splicing regulation

[0371] Splicing regulation can be used to correct cryptic splicing, modulate alternative splicing, restore open reading frames, and induce protein knockdown.

[0372] Splicing regulation can be determined by RNA sequencing (RNAseq), which allows for quantitative assessment of different splicing products of pre-mRNA, or by digital droplet PCR using a PCR assay designed for one or another splicing form. In some embodiments of the present invention, antisense oligonucleotides regulate the splicing of STMN2 pre-mRNA, for example, they reduce the level of mature STMN2 mRNA, which contains (e.g., in target cells or TDP-43-depleted cells) an RNA sequence located between exon 1 and exon 2 (as shown in the examples). In some embodiments of the present invention, antisense oligonucleotides regulate the splicing of STMN2 pre-mRNA, for example, they increase the level of mature correctly spliced ​​STMN2 mRNA, which does not contain (e.g., in target cells) an RNA sequence located between exon 1 and exon 2, referred to as WT STMN2 transcript.

[0373] High affinity modified nucleosides

[0374] A high affinity modified nucleoside is a modified nucleoside that, when incorporated into an antisense oligonucleotide, can enhance the affinity of the antisense oligonucleotide for its complementary target, for example, by increasing the melting temperature (T m). The high affinity modified nucleosides of the present invention preferably increase the melting temperature of each modified nucleoside by between +0.5°C and +12°C, more preferably between +1.5°C and +10°C and most preferably between +3°C and +8°C. Many high affinity modified nucleosides are known in the art and include, for example, many 2' substituted nucleosides and locked nucleic acids (LNA) (see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3 (2), 293-213).

[0375] Sugar modification

[0376] An antisense oligonucleotide of the invention comprising a contiguous nucleotide sequence comprising one or more 2'-MOE nucleosides may further comprise one or more nucleosides having a modified sugar moiety (ie, modification of the sugar moiety) when compared to the ribose sugar moiety found in DNA and RNA.

[0377] A number of modified nucleosides having a ribose moiety have been produced, primarily for the purpose of improving certain properties of the oligonucleotide, such as affinity and / or nuclease resistance.

[0378] Such modifications include those in which the ribose ring structure is modified, such as by being substituted with a hexose ring (HNA), or a bicyclic (LNA) having a diradical bridge between the C2 and C4 carbon atoms on the ribose ring, or an unconnected ribose ring (e.g., UNA) lacking a key between the C2 and C3 carbon atoms. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011 / 017521) or tricyclic nucleic acids (WO2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety is substituted with a non-sugar moiety, such as with respect to peptide nucleic acids (PNA) or morpholino nucleic acids.

[0379] Sugar modifications also include modifications by changing the substituents on the ribose ring to groups other than hydrogen or the 2'-OH group naturally present in DNA and RNA nucleosides. For example, substituents can be introduced at the 2', 3', 4' or 5' positions.

[0380] 2' sugar modified nucleosides

[0381] A 2' sugar modified nucleoside is a nucleoside that has a substituent other than H or -OH at the 2' position (2' substituted nucleosides) or contains a 2' linked diradical capable of forming a bridge between the 2' carbon and the second carbon atom in the ribose ring, such as an LNA (2'-4' diradical bridged) nucleoside.

[0382] In fact, people have spent a lot of effort to develop 2' sugar-substituted nucleosides, and found that many 2' substituted nucleosides have beneficial properties after being incorporated into oligonucleotides. For example, 2' modified sugars can provide enhanced binding affinity and / or increased nuclease resistance to oligonucleotides. Examples of 2' substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. For further examples, see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3 (2), 293-213 and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are schematic diagrams of some 2' substituted modified nucleosides.

[0383]

[0384] With respect to the present invention, 2' substituted sugar modified nucleosides do not include 2' bridged nucleosides like LNA.

[0385] Locked Nucleoside Nucleosides (LNA Nucleosides)

[0386] "LNA nucleosides" are 2'-modified nucleosides that contain a double radical (also called a "2'-4' bridge") connecting the C2' and C4' ribose sugar rings of the nucleoside, which restricts or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). When LNAs are incorporated into oligonucleotides for complementary RNA or DNA molecules, locking the conformation of the ribose is associated with improved hybridization affinity (duplex stabilization). This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary duplex.

[0387] Non-limiting exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al. J. Org. Chem. 2010, Vol. 75(5) pp.1569-81, and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.

[0388] Without further limitation, exemplary LNA nucleosides are disclosed in Scheme 1.

[0389] Scenario 1:

[0390]

[0391] Specific LNA nucleosides are β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA, such as (S)-6'-methyl-β-D-oxy-LNA (ScET) and ENA.

[0392] A particularly advantageous LNA is β-D-oxy-LNA.

[0393] Morpholino oligonucleotides

[0394] In some embodiments, the antisense oligonucleotides of the invention comprise or consist of morpholino nucleosides (i.e., are morpholino oligomers and as phosphodiamidate morpholino oligomers (PMOs)). Splicing-modulating morpholino oligonucleotides have been approved for clinical use - see, for example, eteplirsen, a 30nt morpholino oligonucleotide targeting a frameshift mutation in DMD, for the treatment of Duchenne muscular dystrophy. Morpholino oligonucleotides have a nucleobase attached to a six-membered morpholine ring instead of a ribose, such as a methylene morpholine ring connected by a phosphodiamidate group, for example, as illustrated by the following 4 consecutive morpholino nucleotides:

[0395]

[0396] In some embodiments, a morpholino oligonucleotide of the invention can be, for example, 20-40 morpholino nucleotides in length, such as 25-35 morpholino nucleotides in length.

[0397] RNase H activity and recruitment

[0398] The RNase H activity of an antisense oligonucleotide refers to the ability to recruit RNase H when the antisense oligonucleotide is in a duplex with a complementary RNA molecule. WO01 / 23613 provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H. If an oligonucleotide has an initial rate when providing a complementary target nucleic acid sequence that is measured using the method provided in Examples 91 to 95 of WO01 / 23613 (incorporated herein by reference) (in pmol / l / min) of an oligonucleotide having the same base sequence as the modified oligonucleotide being tested but only comprising DNA monomers having phosphorothioate bonds between all monomers in the oligonucleotide, it is generally considered to be able to recruit RNase H. For use in determining RHase H activity, recombinant RNase H1 from Lubio Science GmbH, Lucerne, Switzerland is available.

[0399] It is known that DNA oligonucleotides can effectively recruit RNase H, as do gapmer oligonucleotides, which contain a region of DNA nucleosides (usually at least 5 or 6 consecutive DNA nucleosides) flanked by 5' and 3' regions containing 2' sugar-modified nucleosides (usually high affinity 2' sugar-modified nucleosides, such as 2-O-MOE and / or LNA). For effective regulation of splicing, degradation of pre-mRNA is undesirable, and therefore preferably, RNase H degradation of the target is avoided. Therefore, the antisense oligonucleotides of the present invention are preferably not gapmer oligonucleotides. RNase H recruitment can be avoided by limiting the number of consecutive DNA nucleotides in the antisense oligonucleotide; therefore, for effective splicing regulation, mixed polymer and full polymer designs can be used accordingly.

[0400] Polymers and polymers

[0401] For splicing regulation, it is usually advantageous to use antisense oligonucleotides that do not raise RNase H. Since RNase H activity requires a continuous sequence of DNA nucleotides, the RNase H activity of antisense oligonucleotides can be achieved by designing antisense oligonucleotides that do not include more than 3 or more than 4 continuous DNA nucleosides. This can be achieved by using antisense oligonucleotides or their continuous nucleoside regions (which include sugar-modified nucleosides, such as 2' sugar-modified nucleosides) and short DNA nucleoside regions (such as 1, 2 or 3 DNA nucleosides) with a mixed polymer design. Mixed polymers are illustrated in this article by "every two" design (wherein nucleosides alternate between 1 LNA and 1 DNA nucleosides, such as LDLDLDLDLDLDLDLL, with 5' end and 3' end LNA nucleosides) and "every three" design (such as LDDLDDLDDLDDLDDL, where every three nucleosides are LNA nucleosides).

[0402] A full polymer is an antisense oligonucleotide or a contiguous nucleotide sequence thereof that does not contain DNA or RNA nucleosides, and may, for example, contain only 2'-O-MOE nucleosides, such as full MOE phosphorothioate, for example MMMMMMMMMMMMMMMMMMMM, where M = 2'-O-MOE, which is reported as an effective splicing regulator for therapeutic use. Alternatively, a mixed polymer may contain a mixture of modified nucleosides, such as MLMLMLMLMLMLMLMLMLML, where L = LNA and M = non-LNA modified nucleosides, such as 2'-O-MOE nucleosides.

[0403] Advantageously, the internucleoside nucleoside in the mixed polymers and the whole polymers or the majority of the nucleoside linkages in the mixed polymers may be phosphorothioate. The mixed polymers and the whole polymers may contain other internucleoside linkages, such as phosphodiester or phosphorothioate (as examples).

[0404] Region D' or D" in the oligonucleotide

[0405] The contiguous nucleobase sequence of the oligonucleotides of the invention is generally complementary to multiple TDP-43 binding sites present in different TDP-43 RNA targets. The region of the antisense oligonucleotide that is complementary (such as fully complementary) to the TDP-43 binding site is referred to as a contiguous nucleotide sequence. In some embodiments, all nucleosides of the antisense oligonucleotide are within the contiguous nucleotide sequence (i.e., the antisense oligonucleotide and the contiguous nucleotide sequence have nucleotides of the same length). In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence and an optional nucleotide-based linker region that can connect the oligonucleotide to an optional functional group, such as a conjugate or other non-complementary terminal nucleotides (e.g., region D' or D").

[0406] In some embodiments, the oligonucleotides of the invention may comprise or consist of a continuous nucleotide sequence of an oligonucleotide that is complementary to a target nucleic acid (such as a mixed or full polymer region) and other 5' and / or 3' nucleosides. The other 5' and / or 3' nucleosides may or may not be fully complementary to the target nucleic acid. Such additional 5' and / or 3' nucleosides may be referred to herein as regions D' and D".

[0407] For the purpose of joining a contiguous nucleotide sequence (such as a mixed polymer or a full polymer) to a conjugate moiety or another functional group, an added region D' or D" may be used. When used to join the contiguous nucleotide sequence to a conjugate moiety, it may act as a biocleavable linker. Alternatively, it may be used to provide exonuclease protection or for synthesis or manufacturing.

[0408] Region D' or D" may independently contain or have 1, 2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. The nucleotides adjacent to the F or F' region are not sugar-modified nucleotides, such as DNA or RNA or base-modified versions thereof. The D' or D" region may act as a bio-cleavable linker that is sensitive to nucleases (see definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are linked to a phosphodiester bond and are DNA or RNA. Nucleotide-based bio-cleavable linkers suitable for use as region D' or D" are disclosed in WO2014 / 076195, for example, may be phosphodiester-linked DNA dinucleotides. The use of bio-cleavable linkers in poly-oligonucleotide construction is disclosed in WO2015 / 113922, in which they are used to connect multiple antisense structures in a single oligonucleotide.

[0409] In one embodiment, the antisense oligonucleotide of the present invention comprises a region D' and / or D" in addition to the continuous nucleotide sequence constituting the mixed polymer or the full polymer.

[0410] In some embodiments, the internucleoside linkage between region D' or D" and the mixed or full polymer region is a phosphodiester linkage.

[0411] Connectors

[0412] A bond or linker is a connection between two atoms that connects one target chemical group or segment to another target chemical group or segment via one or more covalent bonds. The conjugate moiety can be connected to the oligonucleotide directly or through a linking moiety (e.g., a linker or tether). The linker can covalently link a third region, such as a conjugate moiety (region C), to a first region, such as an oligonucleotide or a continuous nucleotide sequence complementary to the target nucleic acid (region A).

[0413] In some embodiments of the present invention, the antisense oligonucleotide of the present invention may optionally include a linker region (second region or region B and / or region Y) located between the antisense oligonucleotide or continuous nucleotide sequence (region A or first region) complementary to the target nucleic acid and the conjugate portion (region C or third region).

[0414] Region B refers to a biodegradable joint comprising or consisting of a physiologically unstable bond, which is cleavable under conditions commonly encountered in mammals or under conditions similar thereto. The conditions under which the physiologically unstable joint undergoes chemical transformation (e.g., cutting) include chemical conditions, such as pH, temperature, oxidation or reduction conditions or agents, and salt concentrations found in mammalian cells or similar to those encountered in mammalian cells. Conditions within mammalian cells also include the presence of enzymatic activity (such as from proteolytic enzymes or hydrolytic enzymes or nucleases) that is commonly present in mammalian cells. In one embodiment, the biodegradable joint is susceptible to S1 nuclease cutting. In certain embodiments, the nuclease-sensitive joint comprises 1 to 5 nucleosides, such as one or more DNA nucleosides comprising at least two continuous phosphodiester bonds. More details of the phosphodiester comprising a biodegradable joint are described in WO 2014 / 076195.

[0415] Region Y refers to a linker that is not necessarily biocleavable but is primarily used to covalently link the conjugate moiety (region C or the third region) to the oligonucleotide (region A or the first region). The region Y linker may comprise an oligomer of a chain structure or repeating units such as ethylene glycol, an amino acid unit, or an aminoalkyl group. The antisense oligonucleotide conjugates of the present invention may be constructed from the following region elements: AC, ABC, ABYC, AYBC, or AYC. In some embodiments, the linker (region Y) is an aminoalkyl group, such as a C2–C36 aminoalkyl group, including, for example, a C6 to C12 aminoalkyl group. In some embodiments, the linker (region Y) is a C6 aminoalkyl group.

[0416] treat

[0417] As used herein, the term "treatment" refers to the treatment of an existing disease (e.g., a disease or disorder referred to herein) or the prevention of a disease, i.e., prevention. It will therefore be appreciated that in some embodiments, the treatment referred to herein may be preventive. In some embodiments, the treatment is not preventive, e.g., the treatment is the treatment of an existing disease condition that has been diagnosed in a patient.

[0418] Antisense oligonucleotides of the present invention

[0419] The antisense oligonucleotides of the present invention are complementary to the RNA binding sites (such as the TDP-43 RNA binding sites on multiple pre-mRNA transcripts) on multiple independent pre-mRNA transcripts. The antisense oligonucleotides of the present invention can or regulate the expression of multiple pre-mRNA transcripts, for example, via (independently) regulating pre-mRNA splicing, enhancing RNA stability, enhancing the expression of encoded proteins, reducing the expression of truncated proteins encoded by one or more pre-mRNAs. As shown in the examples, the antisense oligonucleotides of the present invention can be used to enhance the fidelity of the pre-mRNA processed into the mature mRNA encoding the correct expression and functional protein. Therefore, the antisense oligonucleotides of the present invention can be suitable for use in treating diseases associated with pre-mRNA maturation disorders.

[0420] In some embodiments, the antisense oligonucleotides of the invention may contain one, two, three, four, five, six, seven, eight or more mismatches between the antisense oligonucleotide and the target nucleic acid TDP-43 binding region. Despite the mismatches, hybridization with the target nucleic acid may still be sufficient to show the desired modulation of the TDP-43 RNA target RNA. The reduced binding affinity caused by the mismatches may be advantageously compensated by an increase in the number of nucleotides in the antisense oligonucleotide and / or an increase in the number of modified nucleosides that can increase the binding affinity to the target, such as 2' sugar-modified nucleosides present in the oligonucleotide sequence, including LNA.

[0421] In some embodiments, one, two, three, four, five, six, seven, eight or more universal nucleosides, such as inosine, may be used at the mismatch positions.

[0422] Inosine is a nucleoside with the following structure:

[0423]

[0424] Universal nucleosides are particularly useful when antisense oligonucleotides are targeted to different TDP-43 target RNAs with different TDP-43 binding regions.

[0425] In some embodiments, the contiguous nucleotide sequence may include one or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0426] In some embodiments, the contiguous nucleotide sequence may include two or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0427] In some embodiments, the contiguous nucleotide sequence may include three or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0428] In some embodiments, the contiguous nucleotide sequence may include four or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0429] In some embodiments, the contiguous nucleotide sequence may include five or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0430] In some embodiments, the contiguous nucleotide sequence may include six or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0431] In some embodiments, the contiguous nucleotide sequence may include seven or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0432] In some embodiments, the contiguous nucleotide sequence may include eight or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0433] In some embodiments, for oligonucleotides of 10 to 32 nucleotides in length, antisense oligonucleotides of the invention containing one or more, such as two or more, three or more, four or more, five or more, six or more, seven or more, or eight or more universal nucleotides at positions representing mismatches can hybridize to a target nucleic acid with an estimated ΔG value of less than -10 kcal.

[0434] In some embodiments, for oligonucleotides of 10 to 32 nucleotides in length, antisense oligonucleotides of the invention containing one or more, such as two or more, three or more, four or more, five or more, six or more, seven or more, or eight or more mismatches can hybridize to a target nucleic acid with an estimated ΔG° value of less than -12 kcal, -15 kcal, -17 kcal, -20 kcal, -30 kcal, -40 kcal, -50 kcal, or -60 kcal.

[0435] The calculation of ΔG values ​​was discussed above.

[0436] In some embodiments, the antisense oligonucleotide of the invention or a contiguous nucleotide sequence thereof comprises or consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 contiguous nucleotides in length.

[0437] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of sequences SEQ ID NO 1-83 or SEQ ID NO 118-126. It should be understood that the sequences set forth in SEQ ID NO 1-83 or SEQ ID NO 118-126 may include modified nucleobases that act as the nucleobases shown in base pairing, for example, 5-methylcytosine may be used instead of methylcytosine. Inosine may be used as a universal base.

[0438] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 8 to 30 or 8 to 40 nucleotides in length, and has at least 75%, such as at least 80%, at least 85%, at least 90% identity, at least 95% identity, or more than 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118-126. In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 8 to 30 or 8 to 40 nucleotides in length, and has at least 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118-126.

[0439] It will be appreciated that the contiguous nucleobase sequence (motif sequence) may be modified, for example, to increase nuclease resistance and / or binding affinity to a target nucleic acid.

[0440] The pattern of incorporating modified nucleosides (eg, high affinity modified nucleosides) into an oligonucleotide sequence is often referred to as oligonucleotide design.

[0441] The antisense oligonucleotides of the present invention are designed with modified nucleosides and DNA nucleosides. Advantageously, high affinity modified nucleosides are used.

[0442] In one embodiment, the antisense oligonucleotide comprising a contiguous nucleotide sequence comprising one or more 2'-MOE nucleosides may further comprise at least 1 further or additional modified nucleosides, such as at least 2 modified nucleosides, at least 3 modified nucleosides, at least 4 modified nucleosides, at least 5 modified nucleosides, at least 6 modified nucleosides, at least 7 modified nucleosides, at least 8 modified nucleosides, at least 9 modified nucleosides, at least 10 modified nucleosides, at least 11 modified nucleosides, at least 12 modified nucleosides, at least 13 modified nucleosides, at least 14 modified nucleosides, at least 15 modified nucleosides, at least 16 modified nucleosides, at least 17 modified nucleosides, at least 18 modified nucleosides, at least 19 modified nucleosides, at least 20 modified nucleosides, at least 21 modified nucleosides, at least 22 modified nucleosides, at least 23 modified nucleosides, at least 24 modified nucleosides, at least 25 modified nucleosides, at least 26 modified nucleosides, at least 27 modified nucleosides, at least 28 modified nucleosides, at least 29 modified nucleosides, at least 30 modified nucleosides, at least 31 modified nucleosides, at least 32 modified nucleosides, at least 33 modified nucleosides, at least 34 modified nucleosides, at least 35 At least 19 modified nucleosides, at least 20 modified nucleosides, at least 21 modified nucleosides, at least 22 modified nucleosides, at least 23 modified nucleosides, at least 24 modified nucleosides, at least 25 modified nucleosides, at least 26 modified nucleosides, at least 27 modified nucleosides, at least 28 modified nucleosides, at least 29 modified nucleosides, at least 30 modified nucleosides, at least 31 modified nucleosides, at least 32 modified nucleosides, at least 33 modified nucleosides, at least 34 modified nucleosides, at least 35 modified nucleosides, at least 36 modified nucleosides, at least 37 modified nucleosides, at least 38 modified nucleosides, at least 39 modified nucleosides or more. In one embodiment, the antisense oligonucleotide comprising a continuous nucleotide sequence containing one or more 2'-MOE nucleosides may further comprise 1 to 10 modified nucleosides, such as 2 to 9 modified nucleosides, such as 3 to 8 modified nucleosides, such as 4 to 7 modified nucleosides, such as 6 or 7 modified nucleosides. Suitable modifications are described under "modified nucleosides", "high affinity modified nucleosides", "sugar modifications", "2' sugar modifications" and "locked nucleic acids (LNA)".

[0443] In one embodiment, the antisense oligonucleotide comprising a continuous nucleotide sequence containing one or more 2'-MOE nucleosides may further include one or more sugar-modified nucleosides, such as 2' sugar-modified nucleosides. Preferably, the oligonucleotide of the present invention may further include one or more 2' sugar-modified nucleosides, which are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleotide (ANA), 2'-fluoro-ANA and LNA nucleosides. If one or more modified nucleosides are locked nucleic acids (LNA), it is preferred.

[0444] In further embodiments, the antisense oligonucleotide comprises at least one modified internucleoside linkage. Suitable internucleoside modifications are described under "modified internucleoside linkages". It is advantageous if at least 75%, such as all, of the internucleoside linkages within a continuous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages. In certain embodiments, all internucleotide linkages in the continuous sequence of the antisense oligonucleotide are phosphorothioate linkages.

[0445] Medicinal salt

[0446] The term "salt" as used herein conforms to its commonly known meaning, ie, an ionic assembly of an anion and a cation.

[0447] The present invention contemplates pharmaceutically acceptable salts of the antisense oligonucleotides of the present invention. In other words, the present invention provides pharmaceutically acceptable salts of the antisense oligonucleotides of the present invention.

[0448] In some embodiments, the pharmaceutically acceptable salt is a sodium salt, a potassium salt, or an ammonium salt.

[0449] The present invention provides a pharmaceutically acceptable sodium salt of the antisense oligonucleotide of the present invention.

[0450] The present invention provides a pharmaceutically acceptable potassium salt of the antisense oligonucleotide of the present invention.

[0451] The present invention provides a pharmaceutically acceptable ammonium salt of the antisense oligonucleotide of the present invention.

[0452] Delivery of antisense oligonucleotide splicing modulators

[0453] The present invention provides an antisense oligonucleotide of the present invention, wherein the antisense oligonucleotide is encapsulated in a lipid-based delivery vehicle, covalently linked to or encapsulated in a dendrimer, or conjugated to an aptamer.

[0454] This may be to deliver the antisense oligonucleotides of the invention to target cells and / or to improve the pharmacokinetics of the antisense oligonucleotides.

[0455] Examples of lipid-based delivery vehicles include oil-in-water emulsions, micelles, liposomes, and lipid nanoparticles.

[0456] Manufacturing method

[0457] On the other hand, the present invention provides a method for manufacturing the antisense oligonucleotide of the present invention, the method comprising reacting nucleotide units and forming covalently linked continuous nucleotide units contained in the oligonucleotide. Preferably, the method uses phosphoramidite chemistry (see, e.g., Caruthers et al., 1987, Methods in Enzymology, Vol. 154, pp. 287-313). In another embodiment, the method further comprises reacting continuous nucleotide sequences with conjugate moieties (ligands) to covalently attach the conjugate moieties to the antisense oligonucleotide. On the other hand, a method for manufacturing the composition of the present invention is provided, the method comprising mixing the antisense oligonucleotide of the present invention with a medicinal diluent, solvent, carrier, salt and / or adjuvant.

[0458] Pharmaceutical composition

[0459] In a further aspect, the invention provides a pharmaceutical composition comprising any one of the aforementioned antisense oligonucleotides and a pharmaceutical diluent, carrier, salt and / or adjuvant. Pharmaceutical diluents include phosphate buffered saline (PBS), and pharmaceutical salts include but are not limited to sodium and potassium salts. In some embodiments, the pharmaceutical diluent is sterile phosphate buffered saline. In some embodiments, the antisense oligonucleotide is used in a pharmaceutical diluent at a concentration of 50 μM to 300 μM solution.

[0460] application

[0461] The antisense oligonucleotides of the present invention can be used as research reagents, for example, for diagnosis, treatment and prevention.

[0462] In research, such antisense oligonucleotides can be used to mimic the activity of TDP-43 in cells (e.g., in vitro cell cultures, such as neuronal cells) and experimental animals, thereby facilitating functional analysis of the target or evaluating its usability as a target for therapeutic intervention.

[0463] The present invention provides a method for enhancing TDP-43 function in a cell expressing abnormal or depleted levels of TDP-43, such as an in vivo or in vitro method, the method comprising administering an antisense oligonucleotide or a pharmaceutical composition according to the present invention to the cell in an effective amount. In some embodiments, the target cell is a mammalian cell, particularly a human cell. The target cell may be an in vitro cell culture or an in vivo cell that forms part of a mammalian tissue. In a preferred embodiment, the target cell is a neuronal cell, such as a neuronal cell in which normal TDP-43 activity is depleted. In some embodiments, the target cell may express a disease-associated variant of TDP-43, and / or express dysfunctional TDP-43.

[0464] For therapy, antisense oligonucleotides can be administered to an animal or human suspected of having a disease or condition that can be treated by mimicking TDP-43.

[0465] The present invention provides a method for treating or preventing a disease, which comprises administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide or pharmaceutical composition of the present invention to a subject suffering from or susceptible to the disease.

[0466] The invention also relates to an antisense oligonucleotide or a pharmaceutical composition as defined herein for use as a medicament.

[0467] The antisense oligonucleotide or pharmaceutical composition according to the present invention is usually administered in an effective amount.

[0468] The invention also provides the use of an antisense oligonucleotide of the invention as described for the manufacture of a medicament for treating a disorder according to the invention, or for use in a method of treating a disorder mentioned herein.

[0469] The invention further relates to the use of an antisense oligonucleotide or a pharmaceutical composition as defined herein for the manufacture of a medicament for the treatment of a neurological disorder, such as a neurodegenerative disorder (such as ALS), characterized by TDP-43 pathology or mislocalization of TDP-43 from the nucleus.

[0470] The present invention also provides an antisense oligonucleotide of the present invention for use in a method of treating a disease or disorder mentioned herein.

[0471] In one embodiment, the invention relates to antisense oligonucleotides or pharmaceutical compositions for use in treating a neurological disorder characterized by TDP-43 pathology or mislocalization of TDP-43 from the nucleus, such as a neurodegenerative disorder (such as ALS).

[0472] The disease or condition may be selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis, progressive muscular atrophy, Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine diseases such as spinocerebellar ataxia type 3, myopathy and chronic traumatic encephalopathy.

[0473] Application

[0474] For example, the antisense oligonucleotides or pharmaceutical compositions of the invention can be administered, for example, via intracerebral, intracerebroventricular, or intrathecal administration.

[0475] In a preferred embodiment, the antisense oligonucleotide or pharmaceutical composition of the present invention is administered by a parenteral route, including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, such as intracerebral or intraventricular, intravitreal administration. In one embodiment, the active antisense oligonucleotide or pharmaceutical composition is administered intravenously. In another embodiment, the active antisense oligonucleotide or pharmaceutical composition is administered subcutaneously.

[0476] Combination therapy

[0477] In some embodiments, the antisense oligonucleotides of the invention or the pharmaceutical compositions of the invention are for use in combination therapy with one or more other therapeutic agents.

[0478] Examples

[0479] Example 1: Identification of mRNAs that are mis-spliced ​​in the absence of TDP43 protein

[0480] A hallmark feature of ALS disease is the presence of cytoplasmic aggregates of TDP43 protein in a small fraction of the patient's neuronal cells. As a consequence of cytoplasmic aggregates of TDP43, it is depleted in the cell nucleus and thus cannot perform its normal functions in the nucleus.

[0481] TDP43 has been shown to affect mRNA splicing. To identify new genes whose mRNA is regulated by the presence of TDP43, we knocked down TDP43 in a neuronal cell model. The cells were RNA sequenced and de novo transcript analysis was performed to identify affected genes with new splicing patterns.

[0482] Human glutamatergic neurons (Fujifilms) were plated at 60,000 live cells together with 10,000 live astrocytes (Fujifilms) in 96-well plates coated with laminin and poly(ethyleneimine) solution (Sigma Aldrich) in 200 μl of culture medium (day -1).

[0483] To knock down TDP-43, 5 μM of compound A (ID NO: 1, SEQ ID 13) was added to the culture medium on day 0, and PBS was added to other wells as a control. Half of the cell culture medium was changed 3 times a week during the entire experimental period (days 2, 5, 7, 10, 12, 14, and 17). Cells were harvested on day 20 using Magnapure lysis buffer (Roche) and RNA was isolated on the MagNA pure 96 system (Roche) according to the manufacturer's instructions (including the DNase treatment step). The KAPAmRNA HyperPrep Kit was used. The platform (Roche) prepares NGS libraries from 100ng total RNA. The library is subjected to paired end sequencing with a 150-bp read length on a NovaSeq6000 sequencer (Illumina). Data analysis was performed using CLCGenomics Workbench 21. The data was first analyzed by running a large gap mapping analysis using the hg38 genome assembly, and then transcript discovery was performed. The predicted new splicing events were checked by manual visual inspection to identify the true splicing events. The following are some identified mis-splicing events due to TDP43 depletion, which we later restored again using ASO (Example 2).

[0484] STMN2: contains a novel exon 2, which contains a polyA signal site, causing transcript truncation, thereby producing a truncated STMN2 protein. The first base of the novel exon 2 is located at Chr 8pos 79,616,822 (hg38).

[0485] CAMK2B: novel usage of a splice donor site causes exon elongation, resulting in nonsense-mediated transcript attenuation. The last base of the extended exon is at position Chr 7pos44,222,117 (hg38), which is spliced ​​together with the next canonical splice acceptor site at Chr 7pos44,220,901 (hg38).

[0486] KALRN: contains a novel exon that causes a premature stop codon and nonsense-mediated transcript attenuation. The novel exon has two possible splice acceptor sites and the same splice donor site, resulting in exons with the first and last bases being chr 3 (hg38): (124,700,977; 124,701,255) or (124,701,093-124,701,255).

[0487] UNC13A: contains a new exon that causes a premature stop codon and nonsense-mediated transcript decay. The new exon has two possible splice acceptor sites and the same splice donor site, resulting in an exon with the first and last bases being chr 19 (hg38): (17,642,591; 17,642,414) or (17,642,541-17,642,414). UNC13A is located on the minus strand.

[0488] ACTL6B: After the discovery of TDP43 loss, ACTL6B contains a new 69-base pair of exons. The first and last bases in the new exon are 100,650,643 and 100,650,575

[0489] According to the hg38 human gene annotation, ACTL6B was placed in the negative direction.

[0490] Example 2: Improved splicing recovery using cholesterol-conjugated CA repeat MOE ASO in TDP43-depleted glutamatergic neurons

[0491] Here, we show the ability of CA repeat ASOs to induce correct splicing at the TDP43 targets STMN2, KALRN, CAMK2B, ACTL6B, and UNC13A. We show that MOE CA repeat ASOs conjugated with cholesterol at the 5' end are particularly potent in their ability to restore splicing of affected target genes.

[0492] Human glutamatergic neurons (Fujifilms) were plated with 60,000 live cells and 10,000 live astrocytes (Fujifilms) in 96-well plates in 200 μl culture medium coated with laminin and poly (ethyleneimine) solution (Sigma Aldrich) (day -1). In order to knock down TDP-43, compound A (ID NO: 1, SEQ ID 13) was added to the culture medium at 5 μM on day 0 (except for four control wells per plate). Half of the cell culture medium was replaced 3 times a week during the entire experimental period (days 2, 5, 7, 9, 12, 14, 16, and 19). On day 5, CA repeat ASO was added to the cell culture medium at variable doses. (25uM, 7.91uM, 2.5uM, 0.791uM, 0.25uM, 0.0791uM, 0.025uM, 0.00791uM).

[0493] In total, cells were treated with 7 different ASOs containing CA repeats and one negative control ASO (Table 1). 12 wells in the plate received Compound A (SEQ ID 13) alone to serve as a baseline reference.

[0494] Cells were harvested on day 21 using Magnapure lysis buffer (Roche) and RNA was isolated on a MagNA pure 96 system (Roche) according to the manufacturer's instructions (including a DNase treatment step). Purified RNA was denatured at 90°C for 30 seconds prior to cDNA synthesis. cDNA was created using the iScript Advanced cDNA Synthesis Kit for RT-qPCR (Biorad) according to the manufacturer's instructions.

[0495] The expression level of the target gene was measured by droplet digital PCR using the QX1 system (Bio-Rad) with QX1 software standard version. The PCR probe assay used to measure the expression of the normally spliced ​​target mRNA was designed to span two exons, between which a new "mutant" exon would appear.

[0496] Expression values ​​from the experiments are shown in Table 1. RNA was examined in quadruple ddPCR reactions run to measure four genes. Mix 1 (TARDBP, STMN2, KALRN, HPRT1), Mix 2 (

[0497] Assays were performed using custom designed PCR probes synthesized at Integrated DNA technologies (IDT) or pre-designed ddPCR assays from Biorad:

[0498] Probe mix1

[0499] TARDBP:

[0500] Primer 1: CAGCTCATCCTCAGTCATGTC, Primer 2: GATGGTGTGACTGCAAACTTC, Probe:

[0501] / 5Cy5 / CAGCGCCCCAAAACACTTTTCT / 3IAbRQSp / )

[0502] STMN2:

[0503] Primer 1: CTGCTCAGCGTCTGC, Primer 2: GTTGCGAGGTTCCGG, Probe:

[0504] / 5HEX / CTAAAACAG / ZEN / CAATGGCCTACAAGGAAAAAATGAAG / 3IABkFQ /

[0505] KALRN:

[0506] Primer 1: CGAGCCCTCGGAGTTTG, Primer 2: TCCTTCCAAGAAATGGTGGC, Probe: / 56-FAM / CGACTTCCA / ZEN / GAATATGATGCTGCTGCTGATG / 3IABkFQ /

[0507] The following CY5.5-labeled HPRT1 probe was purchased from BioRad: dHsaCPE13136107.

[0508] Probe Mix 2:

[0509] ACTL6B:

[0510] Primer 1: TCTGAGCCAAACCTGCAC, Primer 2: ATCAGCTCTGTCAGCTTCTCC,

[0511] Probe: / 5HEX / CGAGGCTCC / ZEN / GTGGAACACACG / 3IABkFQ / )

[0512] UNC13A:

[0513] Primer 1: GATCAAAGGCGAGGAGAAGG, Primer 2: TGGCATCTGGGATCTTCAC, Probe: / 56-FAM / ACCTGTCTG / ZEN / CATGAGAACCTGTTCCACTTC / 3IABkFQ /

[0514] CAMK2B:

[0515] Primer 1: CTGACAGTGCCAATACCACC, Primer 2: GCTGCTCCGTGGTCTTAAT, Probe:

[0516] / 5Cy5 / ATGAAGACGCTAAAGCCCGGAAGCAG / 3IAbRQSp /

[0517] The following CY5.5-labeled GAPDH probe was purchased from BioRad: dHsaCPE70459273.

[0518]

[0519]

[0520]

[0521]

[0522]

[0523]

[0524]

[0525] Table 2: Rescue of TDP43 target mRNA splicing after exposure to oligonucleotides

[0526] The data shown in Table 2 were normalized to the expression of the housekeeping gene (HPRT1 or GAPDH) present in a given PCR setup and finally to the average expression value of control wells (PBS) that did not receive any TDP43 knockdown or CA repeat ASO. The last column shows the average expression for all given conditions. KD (“knockdown”, describing wells that received only treatment with a spacer ASO that degrades TDP43 mRNA)

[0527]

[0528]

[0529]

[0530] Some references

[0531] Salter CG, Beijer D, Hardy H, et al. Truncating SLC5A7 mutations underlie aspectrum of dominant hereditary motor neuropathies. Neurol Genet. 2018;4(2):e222.

[0532] Yukiko Nasu-Nishimura 1, Tomoatsu Hayashi, Tomohiro Ohishi, ToshioOkabe, Susumu Ohwada, Yoshimi Hasegawa, Takao Senda, Chikashi Toyoshima, TsutomuNakamura, Tetsu Akiyama.Role of the Rho GTPase-activating Protein RICS inNeurite Outgrowth.Genes Cells. 2006 Jun;11(6):607-14.

[0533] Arundhati Jana, Edward L. Hogan, and Kalipada Pahan. Ceramide and neurodegeneration: Susceptibility of neurons and oligodendrocytes to celldamage and death. J Neurol Sci. 2009 Mar 15;278(1-2):5–15.

[0534] Conti et al., TDP-43 affects splicing profiles and isoform production of genes involved in the apoptotic and mitotic cellular pathways. Nucleic Acids Res. October 15, 2015; 43(18):8990–9005.

[0535] Humphrey et al., Quantitative analysis of cryptic splicing associated with TDP-43 depletion. BMC Medical Genomics 2017; Vol. 10, Article number: 38 (2017).

[0536] Melamed et al., Premature polyadenylation-mediated loss of stathmin-2 is a hallmark of TDP-43-dependent neurodegeneration. Nat Neurosci. February 2019; 22(2):180–190.

[0537] Klim et al., ALS-implicated protein TDP-43 sustains levels of STMN2, a mediator of motor neuron growth and repair. Nature Neuroscience 22, pp. 167–179 (2019)

[0538] Sequence

[0539]

[0540]

[0541]

[0542]

Claims

1. An antisense oligonucleotide of 8 to 40 nucleotides in length, comprising a contiguous nucleotide sequence of at least 8 nucleotides in length, which is complementary to a sequence selected from the group consisting of: (5'-3') (UG)n, (GU)n, wherein n is 4 to 20, UGUGUGUG, UGUGUGUGU, UGUGUGUGUG (SEQ ID NO 95), UGUGUGUGUGU (SEQ ID NO 84), UGUGUGUGUGUG (SEQ ID NO 85), UGUGUGUGUGUGU (SEQ ID NO 86), GUGUGUGU, GUGUGUGUG, GUGUGUGUGU (SEQ ID NO 87), GUGUGUGUGUG (SEQ ID NO 88), GUGUGUGUGUGU (SEQ ID NO 89), GUGUGUGUGUG (SEQ ID NO 90), GUGUGUGUGUG (SEQ ID NO 91), GUGUGUGUGUG (SEQ ID NO 92), GUGUGUGUGUG (SEQ ID NO 93), GUGUGUGUGUG (SEQ ID NO 94), GUGUGUGUGUG (SEQ ID NO 95), GUGUGUGUGUG 90) and GUGAAUGA, wherein the contiguous nucleotide sequence comprises one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides and wherein the antisense oligonucleotide is attached to at least one cholesterol moiety.

2. The antisense oligonucleotide of claim 1, wherein the contiguous nucleotide sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32, 33, 34, 35, 36, 37, 38, 39 or 40 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

3. The antisense oligonucleotide of claim 1, wherein the contiguous nucleotide sequence comprises at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides. 4 . The antisense oligonucleotide according to claim 1 , wherein all of the nucleosides of the contiguous nucleotide sequence are 2′-O-methoxyethyl-RNA (2′-MOE) nucleosides.

5. The antisense oligonucleotide according to any one of claims 1 to 4, wherein the antisense oligonucleotide is attached to two or more or three or more cholesterol moieties.

6. The antisense-oligonucleotide according to any one of claims 1 to 5, wherein the cholesterol moiety is covalently attached to the antisense-oligonucleotide.

7. The antisense oligonucleotide according to any one of claims 1 to 6, wherein the cholesterol moiety is selected from the group comprising: 5'-cholesterol-TEG-CE phosphoramidite, 5'-cholesterol-CE phosphoramidite or cholesteryl-TEG-CE phosphoramidite.

8. The antisense-oligonucleotide according to any one of claims 1 to 7, wherein a linker is located between the antisense-oligonucleotide and the cholesterol moiety.

9. The antisense oligonucleotide according to any one of claims 1 to 8, wherein the linker is a C3 alkyl group, a C6 alkyl group, a C12 alkyl group, a TEG group or a HEG group.

10. The antisense oligonucleotide according to claim 8 or 9, wherein the linker is a physiologically unstable linker. The antisense oligonucleotide according to claim 10 , wherein the physiologically labile linker is an S1 nuclease-sensitive linker.

12. The antisense oligonucleotide according to any one of claims 1 to 11, wherein the antisense oligonucleotide has the structure shown below: (i) or (ii) or (iii) or (iv) 13. The antisense oligonucleotide according to any one of claims 1 to 12, wherein the contiguous nucleotide sequence comprises: a sequence selected from CACACAC, CACACACA, CACACACAC, ACACACAC or ACACACACA; or a sequence selected from the group consisting of: SEQ ID No 1-83, or a fragment of 8 or more contiguous nucleotides thereof.

14. The antisense oligonucleotide according to any one of claims 1 to 13, wherein the contiguous nucleotide sequence is at least 8 nucleotides in length.

15. The antisense-oligonucleotide of any one of claims 1 to 14, wherein the contiguous nucleotide sequence is at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.

16. The antisense-oligonucleotide according to any one of claims 1 to 15, wherein the antisense-oligonucleotide consists of the contiguous nucleotide sequence.

17. The antisense oligonucleotide according to claims 1 to 16, wherein the contiguous nucleotide sequence is at least 75% complementary to the target sequence.

18. The antisense oligonucleotide of any one of claims 1 to 17, wherein the contiguous nucleotide sequence is at least 80%, at least 85%, at least 90% or at least 95% complementary to a target sequence.

19. The antisense oligonucleotide of any one of claims 1 to 18, wherein the contiguous nucleotide sequence comprises 1, 2, 3, 4, 5, 6, 7, 8 or more mismatches to a target sequence.

20. The antisense oligonucleotide according to any one of claims 1 to 19, wherein the Gibbs free energy of the antisense oligonucleotide for the complementary target RNA is less than about -10ΔG, such as less than about -15ΔG, such as less than about -17ΔG.

21. The antisense oligonucleotide according to any one of claims 1 to 20, wherein the antisense oligonucleotide is capable of restoring the functional phenotype of one or more TDP-43 target RNAs in cells that are TDP-43 depleted or express aberrant TDP-43 protein.

22. The antisense oligonucleotide according to any one of claims 1 to 21, wherein the antisense oligonucleotide is capable of modulating the splicing of two or more TDP-43 target pre-mRNAs.

23. The antisense oligonucleotide of claim 22, wherein the two or more TDP-43 target pre-mRNAs are independently selected from the group consisting of STMN2 pre-mRNA, CAMK2B pre-mRNA, KALRN pre-mRNA, ACTL6B pre-mRNA and UNC13A pre-mRNA.

24. The antisense oligonucleotide according to any one of claims 1 to 23, wherein when administered to TDP-43 depleted cells, the antisense oligonucleotide is capable of enhancing the fidelity of pre-mRNA splicing of two or more mRNAs selected from the group consisting of: STMN2 mRNA, CAMK2B mRNA, KALRN mRNA, ACTL6B mRNA and UNC13A mRNA.

25. The antisense oligonucleotide according to any one of claims 1 to 24, wherein when administered to TDP-43-depleted cells expressing STMN2 pre-mRNA, the antisense oligonucleotide is capable of reducing the proportion of STMN2 mature mRNA comprising a cryptic exon (ce1) between exon 1 and exon 2 compared to wild-type STMN2 mature mRNA having a continuous exon 1 / exon 2 junction.

26. The antisense oligonucleotide according to any one of claims 1 to 25, wherein the antisense oligonucleotide is capable of reducing the level of aberrant exon inclusions in CAMK2B mRNA transcripts when administered to TDP-43-depleted cells expressing CAMK2B pre-mRNA.

27. The antisense oligonucleotide according to any one of claims 1 to 26, wherein the antisense oligonucleotide is capable of reducing the level of aberrant exon inclusion in KALRN mRNA transcripts when administered to TDP-43-depleted cells expressing KALRN pre-mRNA.

28. The antisense oligonucleotide of any one of claims 1 to 27, wherein the antisense oligonucleotide is capable of reducing the level of aberrant exon inclusions in UNC13A mRNA transcripts when administered to TDP-43-depleted cells expressing UNC13A pre-mRNA.

29. The antisense oligonucleotide according to any one of claims 1 to 28, wherein the antisense oligonucleotide is capable of reducing the level of aberrant exon inclusions in ACTL6B mRNA transcripts when administered to TDP-43-depleted cells expressing ACTL6B pre-mRNA.

30. The antisense oligonucleotide according to any one of claims 1 to 23, wherein the antisense oligonucleotide is capable of correcting the aberrant splicing of two or more of STMN2, CAMK2B, KALRN, ACTL6B and UNC13A pre-mRNA in TDP-43-depleted cells.

31. The antisense-oligonucleotide according to any one of claims 1 to 30, wherein the antisense-oligonucleotide does not comprise a region of more than 3 or more than 4 consecutive DNA nucleosides.

32. The antisense oligonucleotide according to any one of claims 1 to 31, wherein the antisense oligonucleotide is not capable of mediating RNase H cleavage.

33. The antisense oligonucleotide according to any one of claims 1 to 32, wherein the antisense oligonucleotide is a morpholino antisense oligonucleotide.

34. according to the antisense-oligonucleotide described in any one in claim 1 to 33, wherein said antisense-oligonucleotide further comprises one or more modified nucleosides, such as 2' sugar-modified nucleosides independently selected from the group consisting of the following items: 2'-O-alkyl-RNA; 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabinonucleotide (ANA); 2'-fluoro-ANA; locked nucleic acid (LNA); and any combination thereof.

35. The antisense oligonucleotide of claim 34, wherein the 2' sugar modified nucleoside is an affinity enhanced 2' sugar modified nucleoside.

36. The antisense oligonucleotide according to claim 34 or 35, wherein one or more of the modified nucleosides is a locked nucleic acid nucleoside (LNA), such as an LNA nucleoside selected from the group consisting of constrained ethyl nucleoside (cEt) and β-D-oxy-LNA.

37. The antisense oligonucleotide of claim 36, wherein the contiguous nucleotide sequence of the antisense oligonucleotide comprises LNA nucleosides and DNA nucleosides.

38. The antisense oligonucleotide according to any one of claims 32 to 37, wherein the antisense oligonucleotide or a contiguous nucleotide sequence thereof is a mixed polymer or a full polymer.

39. The antisense-oligonucleotide of any one of claims 1 to 38, wherein one or more of the internucleoside linkages between the nucleosides on the contiguous nucleotide sequence is modified.

40. The antisense-oligonucleotide of any one of claims 1 to 39, wherein at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the internucleoside linkages between the nucleosides on the contiguous nucleotide sequence are modified.

41. The antisense oligonucleotide of any one of claims 39 or 40, wherein one or more or all of the modified internucleoside linkages comprise phosphorothioate linkages.

42. The antisense-oligonucleotide according to any one of claims 1 to 41, wherein all internucleoside linkages present in the antisense-oligonucleotide are phosphorothioate internucleoside linkages.

43. The antisense oligonucleotide of any one of claims 1 to 42, wherein the antisense oligonucleotide is covalently attached to at least one conjugate moiety.

44. The antisense oligonucleotide according to any one of claims 1 to 43, wherein the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.

45. The antisense oligonucleotide of claim 44, wherein the salt is a sodium salt or a potassium salt.

46. ​​A pharmaceutical composition comprising the antisense oligonucleotide according to any one of claims 1 to 45 and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

47. A method for enhancing TDP-43 function in a cell expressing abnormal or depleted levels of TDP-43, the method comprising administering to the cell an antisense oligonucleotide according to any one of claims 1 to 45 or a pharmaceutical composition according to claim 46 in an effective amount.

48. A method for treating or preventing a TDP-43 pathological condition in a subject, the method comprising administering to a subject suffering from or susceptible to the TDP-43 pathological condition a therapeutically or prophylactically effective amount of an antisense oligonucleotide according to any one of claims 1 to 45 or a pharmaceutical composition according to claim 46.

49. The antisense oligonucleotide according to any one of claims 1 to 45 or the pharmaceutical composition according to claim 46 for use as a medicament.

50. The antisense oligonucleotide according to any one of claims 1 to 45 or the pharmaceutical composition according to claim 46 for use in treating a TDP-43 pathological condition.

51. Use of an antisense oligonucleotide according to claims 1 to 45 or a pharmaceutical composition according to claim 46 for the preparation of a medicament for the treatment or prevention of TDP-43 pathological conditions.

52. The method of claim 48, the antisense oligonucleotide for use according to claim 50 or the pharmaceutical composition for use according to claim 51, wherein the TDP-43 pathological condition is a neurological disorder selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis, progressive muscular atrophy, Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine diseases such as spinocerebellar ataxia type 3, myopathy and chronic traumatic encephalopathy.

53. The method, the antisense oligonucleotide for use, or the pharmaceutical composition or the use according to claim 52, wherein the TDP-43 pathological condition is a neurological disorder selected from the group consisting of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD).

Images