Keto-alcoholic acid reductase mutant, genetically engineered bacteria producing high levels of D-pantothenic acid

By constructing a substrate-specific ketool acid reductase mutant and using CRISPR-Cas9 gene editing technology, the substrate binding ability of the ketool acid reductase was modified, solving the problem of low yield in the chemical enzymatic production of D-pantothenic acid and realizing efficient and environmentally friendly D-pantothenic acid production.

CN119220512BActive Publication Date: 2025-11-14ZHEJIANG UNIV OF TECH
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411766945.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-04
Publication Date
2025-11-14
Estimated Expiration
2044-12-04

AI Technical Summary

Technical Problem

Existing chemical enzymatic methods for producing D-pantothenic acid suffer from problems such as low yield, high cost, difficulty in industrialization, and the generation of toxic and harmful substances during the production process, as well as instability in the microbial fermentation process.

Method used

By semi-rational design of enzymes, a substrate-specific ketolate reductase mutant was obtained, and a genetically engineered bacterium producing high levels of D-pantothenic acid was constructed using CRISPR-Cas9 gene editing technology to modify the substrate binding ability of the ketolate reductase and enhance its catalytic efficiency.

Benefits of technology

It increased the yield of D-pantothenic acid, reduced production costs, reduced environmental pollution, and achieved a more environmentally friendly production method. In shake-flask fermentation, the yield of D-pantothenic acid increased by 12.04%, while the accumulation of branched-chain amino acids was less.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119220512B_ABST
    Figure CN119220512B_ABST
Patent Text Reader

Abstract

This invention provides a ketolic acid reductase mutant and its application in constructing genetically engineered bacteria that produce high levels of D-pantothenic acid. To address the technical problem of low D-pantothenic acid yield in existing microbial fermentation, this invention utilizes semi-rational enzyme design to obtain a substrate-specific ketolic acid reductase mutant, which is then applied to construct genetically engineered bacteria that produce high levels of D-pantothenic acid. Furthermore, this invention employs CRISPR-Cas9 gene editing technology to construct genetically engineered bacteria that produce high levels of D-pantothenic acid using the aforementioned ketolic acid reductase mutant, increasing D-pantothenic acid production by approximately 12.04%. Compared to the starting strain, the accumulation of valine in the fermentation broth remained almost unchanged compared to the control, but the accumulation of the branched-chain amino acid isoleucine was lower, achieving substrate-specific modification of the ketolic acid reductase.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering, specifically relating to substrate-specific ketol acid reductase mutants and their application in constructing genetically engineered bacteria that produce high levels of D-pantothenic acid, and a genetically engineered bacterium that produces high levels of D-pantothenic acid and its construction method. Background Technology

[0002] Pantothenic acid (PA) is an important member of the vitamin B family, also known as vitamin B5 or pantothenic acid, and is an essential vitamin for maintaining normal energy metabolism. First isolated from yeast in 1933, pantothenic acid is widely found in various foods in nature, especially animal liver, vegetables, and whole grains. As a component of coenzyme A (CoA) and acyl carrier protein (ACP), D-pantothenic acid participates in biochemical reactions such as fatty acid synthesis, protein metabolism, and energy metabolism, possessing a variety of biological functions. It is crucial for maintaining normal physiological functions and is widely used in the pharmaceutical, food, feed processing, and cosmetic industries.

[0003] Currently, the chemical enzymatic method is the mainstream production method for D-pantothenic acid, offering advantages such as substrate specificity and mild reaction conditions. However, it suffers from low productivity, high cost, difficulty in industrialization, and the generation of toxic and harmful substances during the production process. Compared to traditional chemical production methods, products produced by microbial cell factories are more environmentally friendly, reducing pollution and meeting the urgent needs of modern society for green production. Furthermore, this production method achieves zero or negative carbon emissions during the process, thereby reducing the negative impact on atmospheric carbon dioxide levels and contributing to addressing climate change challenges. It provides a more environmentally friendly and economically efficient method for producing D-pantothenic acid.

[0004] However, the current method of producing D-pantothenic acid using chemical enzymatic methods still has drawbacks, such as unstable fermentation processes and low yields. Therefore, constructing a higher-yielding D-pantothenic acid strain remains a major challenge. Summary of the Invention

[0005] To address the technical problem of low D-pantothenic acid yield in existing microbial fermentation synthesis technologies, this invention utilizes semi-rational enzyme design to obtain a substrate-specific ketolic acid reductase mutant, which is then applied to construct genetically engineered bacteria that produce high levels of D-pantothenic acid. Furthermore, this invention employs CRISPR-Cas9 gene editing technology to construct genetically engineered bacteria that produce high levels of D-pantothenic acid using the aforementioned ketolic acid reductase mutant.

[0006] The technical solution adopted in this invention is: a ketool acid reductase mutant, obtained by single mutation at positions 47, 69, 75, 115 and 414 of the amino acid sequence shown in SEQ ID NO.1.

[0007] Ketolactate reductase (EC 1.1.1.86, AHAIR), also known as acetolactate reductase, participates in the biosynthesis of branched-chain amino acids. It is a bifunctional enzyme that catalyzes two distinct reactions at a common active site; it acts as both an isomerase and a reductase. In isomerase reactions, 2-acetolactate passes through Mg... 2+ It is an intermediate in the rearrangement-dependent methyl migration pathway to pantothenic acid, namely 2,3-dihydroxyisovalerate, and is therefore one of the key enzymes in the D-pantothenic acid biosynthesis pathway. In *E. coli*, it is produced by... ilvC Gene encoding.

[0008] To construct a superior D-pantothenic acid-producing strain, this invention modifies the interaction sites between the substrate acetolactate molecule and the ketoolactate reductase isomerase, altering its substrate heterogeneity. Since the enzyme molecule has a shallow active pocket, the substrate binds more easily to the enzyme, thus enabling the ketoolactate reductase to catalyze reactions involving various 2-keto acids. This invention selects six amino acid sites (68, 75, 110, 132, 155, and 414) near the substrate-enzyme binding site as targets for site-directed mutagenesis. Since alanine, due to its simple structure, does not significantly alter the protein's spatial conformation, all seven sites are mutated to alanine. Furthermore, this invention also selects four amino acid sites (47, 69, 43, and 115) that enhance the affinity of acetolactate as a substrate for the ketoolactate reductase isomerase for site-directed mutagenesis. Subsequently, the mutants are transmitted via plasmid pACYC. ilvC Overexpression was performed in gene-knockout sclerotia, and a superior keto-olate reductase mutant was obtained through screening. ilvC A47S , ilvC K69L , ilvC K75A , ilvC V115I , ilvC S414A And genetically engineered bacteria that produce high levels of D-pantothenic acid containing the coding genes of the aforementioned superior mutants.

[0009] Preferably, the ketool acid reductase mutant is obtained by mutating the amino acid sequence shown in SEQ ID NO.1 through one of the following mutations:

[0010] (1) Alanine at position 47 is mutated to serine;

[0011] (2) The lysine at position 69 is mutated to leucine;

[0012] (3) The lysine at position 75 is mutated to alanine;

[0013] (4) Valine at position 115 is mutated to isoleucine;

[0014] (5) The serine at position 414 is mutated to alanine.

[0015] The present invention also provides a gene encoding the ketohydric acid reductase mutant described above.

[0016] The present invention also provides a recombinant vector containing the gene encoding the ketohydric acid reductase mutant.

[0017] The present invention also provides a genetically engineered bacterium containing the gene encoding the ketohydric acid reductase mutant mutant.

[0018] The present invention also provides the application of the ketool acid reductase mutant in the construction of genetically engineered bacteria that produce high levels of D-pantothenic acid.

[0019] This invention also provides a method for constructing a genetically engineered bacterium that produces high levels of D-pantothenic acid, comprising: knocking out the D-pantothenic acid-producing bacteria from the genome of the *D. spp.* ilvC The gene encoding the ketolic acid reductase mutant was introduced into the substrate bacteria and overexpressed to construct a genetically engineered bacterium that produces high levels of D-pantothenic acid.

[0020] Preferably, the gene encoding the ketoalkanoate reductase mutant is introduced into the sclerotium bacteria using the low-copy plasmid pACYC and overexpressed.

[0021] Preferably, the chassis bacteria are Escherichia coli W3110 , Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / Δ ilvA / Trc-lpd / Δglk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T (Referred to as DPAL6), has been disclosed in CN113637618A.

[0022] Preferably, the method for constructing the genetically engineered bacterium that produces high levels of D-pantothenic acid includes:

[0023] (1) Using CRISPR-Cas9 gene editing technology, the DPAL6 genome of the fungus was knocked out. ilvC Genes were used to obtain strain DPAL6 / Δ ilvC ;

[0024] (2) The coding gene of the ketool acid reductase mutant was induced in strain DPAL6 / Δ by using the low-copy plasmid pACYC. ilvC By overexpressing D-pantothenic acid, a genetically engineered bacterium producing high levels of D-pantothenic acid was obtained.

[0025] The present invention also provides a genetically engineered bacterium that produces high levels of D-pantothenic acid, constructed using the method described above.

[0026] Preferably, the genetically engineered bacterium producing high levels of D-pantothenic acid is one of the following:

[0027] (1) Escherichia coli W3110 , Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T / Δ ilvC / pACYC- ilvC A47S ;

[0028] (2) Escherichia coli W3110 , Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T / Δ ilvC / pACYC- ilvC K69L ;

[0029] (3) Escherichia coli W3110 , Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T / Δ ilvC / pACYC- ilvC K75A ;

[0030] (4) Escherichia coli W3110 , Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T / Δ ilvC / pACYC- ilvC S414A ;

[0031] (5) Escherichia coli W3110 , Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T / Δ ilvC / pACYC- ilvC V115I .

[0032] The present invention also provides the application of the genetically engineered bacteria that produce high levels of D-pantothenic acid in the preparation of D-pantothenic acid through microbial fermentation.

[0033] Preferably, the application includes: inoculating the genetically engineered bacteria that produce high levels of D-pantothenic acid into a chloramphenicol-resistant fermentation medium, and fermenting it at 37°C and 100-200 rpm until the OD reaches 100%. 600 When the concentration is 0.8~1.0, the temperature is then increased to 30℃ and fermented at 180 rpm for 48 h. After fermentation, the supernatant of the fermentation broth is taken for separation and purification to obtain the D-pantothenic acid.

[0034] The fermentation medium is preferably composed of the following: glucose 10-30 g / L, ammonium sulfate 10-25 g / L, anhydrous betaine 1-5 g / L, yeast powder 1-5 g / L, potassium dihydrogen phosphate 1-5 g / L, anhydrous magnesium sulfate 0.5-2 g / L, β-alanine 1-5 g / L, and a 1-5 ml / L trace element solution in deionized water with a natural pH. The trace element solution is composed of: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, and 0.02 g / L NiCl2·7H2O in deionized water.

[0035] Specifically, the fermentation culture method includes: taking out the genetically engineered bacterial strain that produces high levels of D-pantothenic acid for fermentation, streaking it onto an LB agar plate, and incubating it overnight at 37°C for 12-16 h. A single colony is then picked and inoculated into an LB test tube, and cultured at 37°C and 180 rpm for 12 h to obtain a seed culture. 1.5 mL of the seed culture is inoculated into a 250 mL shake flask containing 50 mL of culture medium and cultured at 30°C and 180 rpm for 48 h.

[0036] The beneficial effects of this invention: This invention utilizes molecular docking to perform site-directed mutagenesis on ketolactone reductase, thereby enhancing the binding affinity of acetolactate to the substrate and ultimately obtaining a superior ketolactone reductase mutant. Among them, the ketolactone reductase mutant ilvC V115I While enhancing the D-pantothenic acid pathway, the synthesis of L-valine was not affected. Finally, through shake-flask fermentation, the yield of D-pantothenic acid increased by about 12.04%, and the accumulation of valine in the fermentation broth was almost unchanged compared with the control, but the accumulation of the branched amino acid isoleucine was less, thus achieving the substrate specificity modification of ketol acid reductase. Attached Figure Description

[0037] Figure 1 DPAL7 (DPAL6 / Δ) in Comparative Example 1 of this invention ilvC Changes in OD600 and D-pantothenic acid potency.

[0038] Figure 2 For Comparative Example 2 of this invention, DPAL8 (DPAL7 / pACYC- ilvC Changes in OD600 and D-pantothenic acid potency.

[0039] Figure 3 In Embodiment 1 of the present invention, DPAL15(DPAL7 / pACYC- ilvC A47S Changes in OD600 and D-pantothenic acid potency.

[0040] Figure 4 In Embodiment 2 of the present invention, DPAL16(DPAL7 / pACYC- ilvC K69L Changes in OD600 and D-pantothenic acid potency.

[0041] Figure 5 In Embodiment 3 of the present invention, DPAL10(DPAL7 / pACYC- ilvC K75A Changes in OD600 and D-pantothenic acid potency.

[0042] Figure 6 In Embodiment 4 of the present invention, DPAL18(DPAL7 / pACYC- ilvC V115I Changes in the amino acid and D-pantothenic acid titers.

[0043] Figure 7 In Embodiment 5 of the present invention, DPAL14(DPAL7 / pACYC- ilvC S414A Changes in OD600 and D-pantothenic acid potency.

[0044] Figure 8 For Comparative Example 3 of this invention, DPAL9 (DPAL7 / pACYC- ilvC R68A Changes in OD600 and D-pantothenic acid potency.

[0045] Figure 9 For Comparative Example 4 of this invention, DPAL11(DPAL7 / pACYC- ilvC Q110A Changes in OD600 and D-pantothenic acid potency.

[0046] Figure 10 For Comparative Example 5 of this invention, DPAL12 (DPAL7 / pACYC- ilvC H132A Changes in OD600 and D-pantothenic acid potency.

[0047] Figure 11 For Comparative Example 6 of this invention, DPAL13 (DPAL7 / pACYC- ilvC K155A Changes in OD600 and D-pantothenic acid potency.

[0048] Figure 12 For Comparative Example 7 of this invention, DPAL17 (DPAL7 / pACYC- ilvC V43I Changes in OD600 and D-pantothenic acid potency. Detailed Implementation

[0049] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, unless otherwise specified, the following embodiments and features can be combined with each other. Unless otherwise specified, the methods used in the embodiments of the present invention are conventional methods, and the reagents used are commercially available.

[0050] In the following examples, the final concentration of spectinomycin and kanamycin in the culture medium was 0.05 mg / L.

[0051] LB medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, solvent: deionized water, pH: natural.

[0052] MS medium: glucose 20 g / L, (NH4)2SO4 16 g / L, KH2PO4 2 g / L, MgSO4 0.5 g / L, yeast extract 2 g / L, CaCO3 10 g / L, 1 ml / L trace element solution in deionized water, pH natural; 10 g / L calcium carbonate (sterilized separately); the trace element solution composition is: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 1 g / L ZnSO4·7H2O, 0.20 g / L CuSO4, 0.02 g / L NiCl2·7H2O in deionized water.

[0053] The parent strain described in this invention E. coli W3110 is from the Yale University Coli Genetic Stock Center (CGSC), deposited on August 5, 1975, with accession number CGSC#4474, and has been published in patents US 2009 / 0298135A1 and US2010 / 0248311 A1.

[0054] HPLC determination of D-pantothenic acid content: Chromatographic conditions: C18 column (250 × 4.6 mm, particle size 5 μm, Agilent Technologies Co., Santa Clara, CA, USA), detection wavelength: 200 nm, column temperature: 30℃; Sample preparation: The sample was diluted with ultrapure water to maintain the D-pantothenic acid content between 0.05 g / L and 0.40 g / L; Mobile phase: acetonitrile / water / phosphoric acid: (50 / 949 / 1); Data acquisition time: 25 min.

[0055] Determination of amino acid content: Analytical conditions: Hitachi custom ion exchange resin (4.6mm ID×60mm*), wavelength: 570nm, 440nm, separation column temperature: 57℃; reaction column temperature: 135℃; Sample preparation: Dilute the sample with ultrapure water to maintain the L-Valine content between 0.05g / L and 0.4g / L; Mobile phase: B1 (700 mL water / 6.19 g sodium citrate / 1 M NaOH / 5.66 g sodium chloride / 19.8 g citric acid / 135 mL ethanol); R3 (50 mL ethanol / 950 mL water); Data acquisition time: 30 min.

[0056] The primer sequence information used in the examples is shown in Table 1.

[0057] Table 1: Primer sequences

[0058] Primer Name Sequence (5’-3’) pACYC-F GAAGCTTAGATCTATTACCCTG pACYC-R GGTCTGTTTCCTGTGTGAAA ilvCEc-F TTTCACACAGGAAACAGACCATGGCTAACTACTTCAATACAC ilvCEc-R ATCCGCCAAAACAGCCAAGCTTTTAACCCGCAACAGCAATAC pT-ΔilvC-F TAATACTAGTCAGGTAGGTAAGAAACTGCGGTTTTAGAGCTAGAAATAGC pT-ΔilvC-R GCTCTAAAACCGCAGTTTCTTACCTACCTGACTAGTATTATACCTAGGAC ΔilvC-up-F ATTCTCTAGAGTCGACCTGCGTGTTCCGCGCGGAAGCGAT ΔilvC-up-R GTGAGGGCATCAGCGCGCACGGTGATTCCTCGTGATGTTG ΔilvC-down-F GTGCGCGCTGATGCCCTCAC ΔilvC-down-R GGGTAATAGATCTAAGCTTCGGGACCTGCGAAGCCCGGAT ΔilvC-VF GCGCCAGCAGCTGGCACAGC ΔilvC-VR GCAGACATACAGAGGGCGGT R68A-F TACGCTCTGGCGAAAGAAGCGATTGCCGAGAAG R68A-R CGCTTCTTTCGCCAGAGCGTAGGAGATATCGA K75A-F GATTGCCGAGGCGCGCGCGTCCTGGCGTAAAG K75A-R GACGCGCGCGCCTCGGCAATCGCTTCTTTAC Q110A--F CCGGACAAGGCGCACTCTGATGTAGTGCGCAC Q110A-R TCAGAGTGCGCCTTGTCCGGCGTCAGGTTAA H132A-F GGCTACTCGGCGGGTTTCAACATCGTCGAAGT H132A-R GTTGAAACCCGCCGAGTAGCCCAGCGCCGCGC K155A-F GTTGCGCCGGCGTGCCCAGGCACCGAAGTGCG K155A-R GCCTGGGCACGCCGGCGCAACCATCACTACGG S414A-F CGTGGTTATCGCGGATACCGCTGAGTACGGTAAC S414A-R CAGCGGTATCCGCGATAACCACGTTCATTTCGTA A47S-F GGCTGTGGCAGCCAGGGTCTGAACCAGGGCCTG A47S-R CAGACCCTGGCTGCCACAGCCGACGATGACTAC K69L-F ATCGCTTCCAAGCGCAGAGCGTAGGAGATATCGAGACCAG K69L-R GCTCTGCGCTTGGAAGCGATTGCCGAGAAGCGCGCGTCCT V43I-F GTAGTCATCCTGGGCTGTGGCGCACAGGGTCT V43I-R GCCACAGCCCAGGATGACTACTTTTTTACCCTG V115I-F CTGATGTAATTCGCACCGTACAGCCACTGATG V115I-R TACGGTGCGAATTACATCAGAGTGCTGCTTGTC

[0059] Comparative Example 1: DPAL7(DPAL6 / Δ ilvC Construction and shake-flask fermentation

[0060] Using DPAL6 as the starting strain, CRISPR-Cas9-mediated gene editing technology was employed to insert gene editing molecules into the genome. ilvC Gene knockout was performed to determine the impact of the keto-alcohol reductase mutant on the pantothenic acid pathway.

[0061] (1) Construct pTarget-Δ ilvC Plasmid: Using pTarget F plasmid (Addgene Plasmid #62226) as a template, pT-Δ ilvC -F / pT-Δ ilvC -R represents primers for PCR amplification. The PCR product was digested with Dpn I at 37°C for 3 hours; pTarget-Δ ilvCThe PCR product was amplified using linearized primers pTarget-XF and pTarget-XR, and pTarget-Δ was purified by gel extraction. ilvC Linearized vectors are used for subsequent ligation of Donor DNA.

[0062] (2) Constructing pTD-Δ ilvC plasmids: E. coli Using the W3110 genome as a template, Δ ilvC -up-F、Δ ilvC -up-R is the primer used to amplify the upstream portion (F1) of the donor DNA, Δ ilvC -down-F and Δ ilvC -down-R is used as the primer to amplify the downstream portion (F2) of the donor DNA. The PCR fragments are then purified using gel extraction to obtain F1 and F2. Following the ClonExpress® (Onestep clone kit, Vazyme Biotech, Nanjing, China) instructions, pTarget-Δ ilvC The linearized vector, fragments F1 and F2 were ligated together, and pTD-Δ was obtained through sequencing verification. ilvC Plasmid.

[0063] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into DPAL6, and a single colony was transferred into an LB tube containing 0.05 mg / L kanamycin and cultured overnight at 30 °C. Then, 1% (v / v) of the inoculum was inoculated into a 250 mL shake flask containing 50 mL of LB medium, and 500 μl of 1 mol / L L-arabinose was added. The culture was carried out at 150 rpm and 30 °C until OD. 600 Cells were collected by centrifugation at 0.4~0.6 rpm and 4℃ for 10 min to prepare electrocompetent cells. For detailed procedures, please refer to the description in (Molecular Cloning: A Laboratory Manual, 3rd Edition, 99-102).

[0064] (4) Use a pipette to draw an appropriate amount of pTD-Δ ilvC Approximately 200 ng of plasmid was mixed with 100 μl of pre-prepared electrocompetent cells and transferred together into a pre-cooled 2 mm electroporation cuvette. After incubating on ice for 1–2 min, the mixture was then subjected to electroporation using a MicroPluser. TMElectroporation was performed using BIO-RAD (bio-based transducers). Immediately after electroporation, 800 μl of LB medium was added and gently aspirated, then transferred to 2 mL Eppendorf tubes. After recovery at 30°C for 3-4 h, the mixture was plated onto LB agar plates containing 0.05 mg / L kanamycin and 0.05 mg / L spectinomycin. The plates were incubated upside down at 30°C for 12-16 h, with the Δ... ilvC Using -VF / R primers for colony PCR verification, if a fragment of approximately 1500 bp can be successfully cloned, it proves to be DPAL7 (DPAL6 derivative, Δ). ilvC Positive colonies.

[0065] (5) Plasmid elimination: Use an inoculation loop to pick a positive single colony and inoculate it into an LB liquid tube containing 1 mM IPTG and 0.05 mg / L kanamycin. Incubate overnight at 30 °C. The next day, streak the bacterial culture onto an LB agar plate containing 0.05 mg / L kanamycin and incubate at 30 °C for 24 h. When the bacteria reach a certain size, pick a portion of single colonies and streak them onto an LB agar plate containing 0.05 mg / L spectinomycin. Single colonies that cannot be streaked onto an LB agar plate containing 0.05 mg / L spectinomycin will show their pTarget-Δ. ilvC The plasmid was successfully eliminated, and then pTarget-Δ was picked. ilvC Single colonies with successfully eliminated pCas plasmids were cultured overnight at 37 °C in LB tubes to eliminate the pCas plasmid. The next day, the bacterial culture was streaked onto LB agar plates and incubated at 37 °C for 12 h. A portion of single colonies were then streaked onto LB agar plates containing 0.05 mg / L kanamycin. Single colonies that could not be streaked onto LB agar plates containing 0.05 mg / L kanamycin were considered to have successfully eliminated the pCas plasmid, ultimately yielding the plasmid-free strain DPAL7 (DPAL6 derivative, Δ). ilvC ).

[0066] (6) Shake flask fermentation: DPAL7 (DPAL6 derivative, Δ ilvC Using the starting strain DPAL6 as a control group, 10 mL of each strain was inoculated into LB medium and cultured at 37°C and 200 rpm as a pre-culture. After 8-12 h, 1 mL of the pre-culture was inoculated at a 2% inoculum into a 500 mL shake flask containing 50 mL of MS medium, and then cultured in a constant temperature shaker at 30°C and 180 rpm for 48 h for fermentation. After fermentation, 1 mL of the fermentation broth was used to determine the OD. 600 Simultaneously, 1 mL of fermentation broth was pipetted and centrifuged at 12000 rpm for 3 min at room temperature. The fermentation supernatant was diluted 5-fold, and the diluted sample was filtered through an aqueous filter membrane to remove impurities before HPLC analysis. OD 600and the D-pantothenic acid content in the fermentation broth supernatant, such as Figure 1 As shown.

[0067] As can be seen from the figure, in the genome ilvC Gene knockout, compared to DPAL6 knockout ilvC The DPA production of the strain decreased by about 80%, indicating that ketool acid reductase plays a key role in the DPA production pathway.

[0068] Comparative Example 2: DPAL8(DPAL7 / pACYC- ilvC Construction and shake-flask fermentation

[0069] Starting with DPAL7 as the strain, the recombinant plasmid pACYC- was constructed. ilvC The bacteria were introduced into the chassis bacteria DPAL7 for verification. ilvC Effect on D-pantothenic acid potency

[0070] (1) Construction of pACYC plasmid linearization vector: Using the original pACYC plasmid as a template, the pACYC plasmid was linearized and circularized using primers pACYC-F and pACYC-R. After verification by nucleic acid gel electrophoresis, the residual template was digested with DPNⅠ at 37℃ for 1 h. After digestion, the product was cleaned up and purified, and the nucleic acid concentration was measured to finally obtain the pACYC linearized vector fragment.

[0071] (2) Original ilvC Fragment amplification: with wild type E. coli Using the W3110 genome as a template, PCR amplification was performed using primers ilvCEc-F and ilvCEc-R. After verification by nucleic acid gel electrophoresis, the products were purified and nucleic acid concentrations were measured to obtain the final amplified product. ilvC Fragment (nucleotide sequence as shown in SEQ ID NO.2).

[0072] (3) plasmid pACYC- ilvC Construction: Linearization of the vector with pACYC and amplification ilvC Using the fragment as a template, add the reaction mixture according to the instructions of the ClonExpress Ultra One Step Cloning Kit. Incubate at 50°C for 15 minutes, then immediately place on ice to cool. ilvC The gene fragment was integrated into the multiple cloning site of the pACYC plasmid, and the ligation product was then transformed into DH5α competent cells. After successful colony PCR verification, the recombinant plasmid pACYC- was obtained by picking bacteria and inoculating test tubes. ilvC .

[0073] (4) Plasmid pACYC- ilvC Transformation into the chassis strain DPAL7 yields DPAL8. For specific steps, refer to step (6) of Comparative Example 1. The OD600 and D-pantothenic acid content in the fermentation broth supernatant of strain DPAL8 after fermentation are as follows: Figure 2 As shown.

[0074] As shown in the figure, by constructing the recombinant plasmid pACYC- ilvC overexpression ilvC Compared with DPAL6, it restored its isomerase activity, making the D-pantothenic acid production almost the same as the control.

[0075] Example 1: DPAL15(DPAL7 / pACYC-ilvC) A47S Construction and shake-flask fermentation

[0076] Using DPAL7 as the starting strain, site-directed mutagenesis was employed to transform the original Escherichia coli. ilvC The 47th codon, gca, is mutated to agc, changing the amino acid it encodes from alanine to serine, thereby altering the substrate preference of the ketool acid reductase.

[0077] (1) Plasmid pACYC-ilvC A47S Construction: Using plasmid pACYC-ilvC as a template, site-directed mutagenesis was performed using primers A47S-F and A47S-R. The mutated PCR product was verified by nucleic acid gel electrophoresis. The remaining template was then digested with DPNⅠ at 37℃ for 1 h. After digestion, the product was cleaned up, purified, and nucleic acid concentration was measured, finally yielding the product containing... ilvC Mutant pACYC- ilvC A47S Linearization of the vector fragment by plasmid.

[0078] (2) Plasmid pACYC- ilvC A47S Transformed into the chassis strain DPAL7 to obtain DPAL15. Refer to step (6) of Comparative Example 1 for specific steps. The OD600 and D-pantothenic acid content in the fermentation broth supernatant of strain DPAL15 after fermentation are as follows: Figure 3 As shown.

[0079] As shown in the figure, compared with strain DPAL6, strain DPAL15 showed a significant increase in OD and pantothenic acid production, indicating that it is more effective against DPAL6. ilvC A mutation in codon 47 may increase its isomerase activity, thereby leading to an increase in D-pantothenic acid production.

[0080] Example 2: DPAL16(DPAL7 / pACYC-ilvC) K69L Construction and shake-flask fermentation

[0081] Using DPAL7 as the starting strain, site-directed mutagenesis was employed to transform the original Escherichia coli. ilvC The 69th codon, aaa, is mutated to ctg, changing the amino acid it encodes from lysine to leucine, thereby altering the substrate preference of the ketool acid reductase.

[0082] With plasmid pACYC- ilvC Using the template, site-directed mutagenesis was performed using primers K69L-F and K69L-R to construct the plasmid pACYC- ilvC K69L The plasmid pACYC- ilvC K69L The bacteria were transformed into the chassis strain DPAL7 to obtain DPAL16. Specific steps are described in Example 1. The OD600 and D-pantothenic acid content in the fermentation broth supernatant of strain DPAL16 after fermentation are as follows: Figure 4 As shown.

[0083] As shown in the figure, compared with strain DPAL6, strain DPAL16 showed a significant increase in OD and pantothenic acid production, indicating that it is more effective in treating DPAL6. ilvC A mutation in codon 69 may increase its isomerase activity, thereby leading to an increase in D-pantothenic acid production.

[0084] Example 3: DPAL10 (DPAL7 / pACYC- ilvC K75A Construction and shake-flask fermentation

[0085] Using DPAL7 as the starting strain, site-directed mutagenesis was employed to transform the original Escherichia coli. ilvC The 75th codon, aag, is mutated to gcg, changing the amino acid it encodes from lysine to alanine, thereby altering the substrate preference of the ketool acid reductase.

[0086] With plasmid pACYC- ilvC Using the template, site-directed mutagenesis was performed using primers K75A-F and K75A-R to construct the plasmid pACYC- ilvC K75A The plasmid pACYC- ilvC K75A The bacteria were transformed into the chassis strain DPAL7 to obtain DPAL10. Specific steps are described in Example 1. The OD600 and D-pantothenic acid content in the fermentation broth supernatant of strain DPAL10 after fermentation are as follows: Figure 5 As shown.

[0087] As shown in the figure, compared with strain DPAL6, strain DPAL10 has a slightly higher D-pantothenic acid titer, indicating that it has a slightly higher D-pantothenic acid titer. ilvCA mutation at codon 75 may increase its isomerase activity, thereby resulting in a slight increase in D-pantothenic acid production.

[0088] Example 4: DPAL18 (DPAL7 / pACYC- ilvC V115I Construction and shake-flask fermentation

[0089] Using DPAL7 as the starting strain, site-directed mutagenesis was employed to transform the original Escherichia coli. ilvC The 115th codon, gtg, is mutated to att, changing the amino acid it encodes from valine to isoleucine, thereby altering the substrate preference of the ketool acid reductase.

[0090] With plasmid pACYC- ilvC Using the template, site-directed mutagenesis was performed on it using primers V115I-F and V115I-R to construct the plasmid pACYC- ilvC V115I The plasmid pACYC- ilvC V115I Transformation into the chassis strain DPAL7 yields DPAL18. Refer to Example 1 for specific steps. The OD600 and D-pantothenic acid content in the fermentation broth supernatant of strain DPAL18 after fermentation are as follows: Figure 6 As shown.

[0091] As can be seen from the figure, by analyzing... ilvC Mutation, construction of recombinant plasmid pACYC- ilvC V115I Compared with the DPAL6 strain, the D-pantothenic acid production increased by about 12.04%, the valine accumulation remained almost unchanged, but the isoleucine accumulation decreased by 54.1%, achieving substrate-specific modification of keto-alcoholic acids and strengthening the D-pantothenic synthesis pathway.

[0092] Example 5: DPAL14(DPAL7 / pACYC- ilvC S414A Construction and shake-flask fermentation

[0093] Using DPAL7 as the starting strain, site-directed mutagenesis was employed to transform the original Escherichia coli. ilvC The 414th codon, tct, is mutated to gcg, changing the amino acid it encodes from serine to alanine, thereby altering the substrate preference of the ketool acid reductase.

[0094] With plasmid pACYC- ilvC Using the template, site-directed mutagenesis was performed using primers S414A-F and S414A-R to construct the plasmid pACYC- ilvC S414A The plasmid pACYC- ilvCS414A The bacteria were transformed into the chassis strain DPAL7 to obtain DPAL14. Specific steps are described in Example 1. The OD600 and D-pantothenic acid content in the fermentation broth supernatant of strain DPAL14 after fermentation are as follows: Figure 7 As shown.

[0095] As shown in the figure, compared with strain DPAL6, strain DPAL14 showed a significant increase in OD and yield, which suggests that its enzyme activity may have been improved and the pantothenic acid synthesis pathway may have been enhanced.

[0096] Comparative Example 3: DPAL9(DPAL7 / pACYC- ilvC R68A Construction and shake-flask fermentation

[0097] Using DPAL7 as the starting strain, site-directed mutagenesis was employed to transform the original Escherichia coli. ilvC The 68th codon, cgt, is mutated to gcg, changing the amino acid it encodes from arginine to alanine, thereby altering the substrate preference of the ketool acid reductase.

[0098] With plasmid pACYC- ilvC Using the template, site-directed mutagenesis was performed using primers R68A-F and R68A-R to construct the plasmid pACYC- ilvC R68A The plasmid pACYC- ilvC R68A Transformation into the chassis strain DPAL7 yields DPAL9. Refer to Example 1 for specific steps. The OD600 and D-pantothenic acid content in the fermentation broth supernatant of strain DPAL9 after fermentation are as follows: Figure 8 As shown.

[0099] As shown in the figure, compared with strain DPAL6, strain DPAL9 showed almost no change in D-pantothenic acid, indicating that... ilvC A mutation at position 68 may not have a significant impact on enzyme activity.

[0100] Comparative Example 4: DPAL11(DPAL7 / pACYC- ilvC Q110A Construction and shake-flask fermentation

[0101] Using DPAL7 as the starting strain, site-directed mutagenesis was employed to transform the original Escherichia coli. ilvC The 110th codon, cag, is mutated to gcg, changing the amino acid it encodes from glutamine to alanine, thereby altering the substrate preference of the ketool acid reductase.

[0102] With plasmid pACYC- ilvCUsing the template, site-directed mutagenesis was performed using primers Q110A-F and Q110A-R to construct the plasmid pACYC- ilvC Q110A The plasmid pACYC- ilvC Q110A The bacteria were transformed into the chassis strain DPAL7 to obtain DPAL11. Specific steps are described in Example 1. The OD600 and D-pantothenic acid content in the fermentation broth supernatant of strain DPAL11 after fermentation are as follows: Figure 9 As shown.

[0103] As shown in the figure, compared with strain DPAL6, strain DPAL11 exhibits a lower D-pantothenic acid production, indicating that... ilvC Mutation of codon 110 may reduce its isomerase activity, thereby reducing the production of D-pantothenic acid.

[0104] Comparative Example 5: DPAL12(DPAL7 / pACYC- ilvC H132A Construction and shake-flask fermentation

[0105] Using DPAL7 as the starting strain, site-directed mutagenesis was employed to transform the original Escherichia coli. ilvC The codon at position 132, cac, is mutated to gcg, causing the amino acid it encodes to change from histidine to alanine, thereby altering the substrate preference of the ketool acid reductase.

[0106] With plasmid pACYC- ilvC Using the template, site-directed mutagenesis was performed using primers H132A-F and H132A-R to construct the plasmid pACYC- ilvC H132A The plasmid pACYC- ilvC H132A The bacteria were transformed into the chassis strain DPAL7 to obtain DPAL12. Specific steps are described in Example 1. The OD600 and D-pantothenic acid content in the fermentation broth supernatant of strain DPAL12 after fermentation are as follows: Figure 10 As shown.

[0107] As shown in the figure, compared with strain DPAL6, strain DPAL12 showed a significant increase in OD, but a decrease in D pantothenic acid production, which is presumably due to... ilvC A mutation at codon 132 may reduce its isomerase activity.

[0108] Comparative Example 6: DPAL13(DPAL7 / pACYC- ilvC K155A Construction and shake-flask fermentation

[0109] Using DPAL7 as the starting strain, site-directed mutagenesis was employed to transform the original Escherichia coli. ilvCThe 155th codon, aaa, is mutated to gcg, changing the amino acid it encodes from lysine to alanine, thereby altering the substrate preference of the ketool acid reductase.

[0110] With plasmid pACYC- ilvC Using the template, site-directed mutagenesis was performed using primers K155A-F and K155A-R to construct the plasmid pACYC- ilvC K155A The plasmid pACYC- ilvC K155A The bacteria were transformed into the chassis strain DPAL7 to obtain DPAL13. Specific steps are described in Example 1. The OD600 and D-pantothenic acid content in the fermentation broth supernatant of strain DPAL13 after fermentation are as follows: Figure 11 As shown.

[0111] As shown in the figure, compared with strain DPAL6, strain DPAL13 showed a significant increase in OD, but reduced isomerase activity, resulting in a decrease in D-pantothenic acid production.

[0112] Comparative Example 7: DPAL17(DPAL7 / pACYC- ilvC V43I Construction and shake-flask fermentation

[0113] Using DPAL7 as the starting strain, site-directed mutagenesis was employed to transform the original Escherichia coli. ilvC The 43rd codon gtc is mutated to atc, changing the amino acid it encodes from valine to isoleucine, thereby altering the substrate preference of the ketool acid reductase.

[0114] With plasmid pACYC- ilvC Using the template, site-directed mutagenesis was performed using primers V43I-F and V43I-R to construct the plasmid pACYC- ilvC V43I The plasmid pACYC- ilvC V43I The bacteria were transformed into the substrate strain DPAL7 to obtain DPAL17. Specific steps are described in Example 1. The OD600 and D-pantothenic acid content in the fermentation broth supernatant of strain DPAL17 after fermentation are as follows: Figure 12 As shown.

[0115] As shown in the figure, compared with strain DPAL6, strain DPAL17 showed a significant increase in OD, but it is speculated that... ilvC Mutating the 43rd codon reduces its isomerase activity, resulting in a decrease in D-pantothenic acid production.

[0116] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit of the present invention should fall within the protection scope of the present invention.

Claims

1. A ketohydric acid reductase mutant, characterized in that, It was obtained by mutating valine at position 115 of the amino acid sequence shown in SEQ ID NO.1 to isoleucine.

2. The gene encoding the ketool acid reductase mutant of claim 1.

3. A recombinant vector containing the gene encoding the ketohydric acid reductase mutant as described in claim 2.

4. Genetically engineered bacteria containing the gene encoding the ketohydric acid reductase mutant as described in claim 2.

5. The application of the ketool acid reductase mutant as described in claim 1 in the construction of genetically engineered bacteria that produce high levels of D-pantothenic acid.

6. A method for constructing a genetically engineered bacterium that produces high levels of D-pantothenic acid, characterized in that, include: Knockout of the chassis bacteria genome ilvC Gene, by introducing the encoding gene of the keto-alcohol reductase mutant of claim 1 into a *Trichoderma* bacterium and overexpressing it, a genetically engineered bacterium producing high levels of D-pantothenic acid was constructed, wherein the *Trichoderma* bacterium is... Escherichia coli W3110,Trc- panCpanEpanBilvC / ilvG* / Δ avtA / ilvE* / coaA* / Δ ilvA / Trc-lpd / Δ glk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T .

7. The genetically engineered bacteria that produce high levels of D-pantothenic acid, constructed according to the method described in claim 6.

8. The application of the genetically engineered bacteria with high D-pantothenic acid production as described in claim 7 in the preparation of D-pantothenic acid by microbial fermentation.

Citation Information

Patent Citations

  • D-pantothenic acid producing strain, construction method and application

    CN113637618A

  • Method for fermentative production of L-methionine

    US20090298135A1

  • Increasing methionine yield

    US20100248311A1

  • Genetically engineered bacterium for high yield of D-pantothenic acid based on ilvC mutant, construction method and application

    CN115109737A