An enzyme mutant with high thermal stability based on deep learning modification
By using deep learning to modify the nitrile hydrolase ZJB09122, which was mutated to F168V/V305L/L194A, the problem of insufficient thermostability of nitrile hydrolase was solved, and the efficient application of nitrile hydrolase in the synthesis of gabapentin was realized.
Patent Information
- Application Number
- CN202411427508.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-14
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2044-10-14
AI Technical Summary
The insufficient thermal stability of existing nitrile hydrolases limits their potential application in the synthesis of fine chemicals such as gabapentin.
The nitrile hydrolase ZJB09122 was modified using deep learning methods. By mutating three sites, F168, V305 and L194, a combined mutant F168V/V305L/L194A was obtained, which improved its thermal stability.
The mutant ZJB09122_M3 exhibits significantly improved thermal stability with a T50 value increase of 5.9℃, demonstrating greater potential in the synthesis of gabapentin.
Smart Images

Figure CN119220526B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering and relates to an enzyme mutant with high thermal stability transformed based on deep learning. Background Art
[0002] Protein engineering is widely used in enzyme modification, primarily through gene modification to alter protein structure to achieve improvements in catalytic efficiency, thermal stability, and substrate specificity. Key approaches include directed evolution, rational design, and semi-rational design. Numerous examples of directed evolution have demonstrated that large-scale screening of random mutations at arbitrary positions within an enzyme using high-throughput screening methods can generate desired mutants. However, due to the size of proteins and the time-consuming nature of screening, directed evolution using error-prone PCR as the primary method is often relatively inefficient. Therefore, computational approaches are needed to rationally or semi-rationally design protein engineering. Artificial intelligence methods such as machine learning and deep learning, which are applied to protein engineering, have demonstrated unique advantages in predicting enzyme structure, addressing stability, selectivity, and catalytic activity, and guiding enzyme design. These methods offer new possibilities for enzyme design and significantly improve experimental efficiency.
[0003] The nitrilase superfamily can be divided into 13 branches based on sequence similarity and structural domain classification. However, only one branch of the nitrilase superfamily possesses the ability to convert nitriles, while the others preferentially exhibit amide hydrolysis or condensation properties. Most superfamily members share a common α-β-β-α structural fold and a Cys-Glu-Lys catalytic site. Nitrilases (EC3.5.5) are enzymes in the nitrilase superfamily that catalyze the conversion of a range of nitriles to the corresponding carboxylic acids in a single step, releasing ammonia. Nitrilase-mediated biocatalytic reactions have the advantages of being environmentally mild, environmentally friendly, and devoid of byproducts, with excellent regioselectivity, chemoselectivity, and stereoselectivity. Compared to traditional chemical pathways that require harsh acid-base reaction conditions and produce undesirable byproducts, nitrilase is a promising alternative to traditional chemical pathways in fine chemical production. Nitrilases have been used to catalyze the production of valuable fine chemicals such as nicotinic acid, (R)-mandelic acid, acrylic acid, glycolic acid, 1,5-dimethyl-2-piperidone, atorvastatin, gabapentin, (R)-baclofen, and (S)-pregabalin. Summary of the Invention
[0004] To improve the thermal stability of nitrilase, the present invention provides a highly thermostable enzyme mutant engineered using deep learning. Using the nitrilase ZJB09122 enzyme as the parent, the present invention simultaneously mutated three sites, F168, V305, and L194, to create the combined mutant F168V / V305L / L194A. This significantly improves the thermal stability of the nitrilase, enhancing its potential in the synthesis of gabapentin.
[0005] The specific technical solutions of the present invention are:
[0006] In one aspect, the present invention provides a nitrilase mutant with high thermal stability, the amino acid sequence of which is shown in SEQ ID NO.1. facilis The nitrilase ZJB09122 was used as the parent and the three sites F168, V305 and L194 were mutated at the same time to obtain the combined mutant F168V / V305L / L194A, which greatly improved the thermal stability of the nitrilase and enhanced the potential of the nitrilase in the synthesis of gabapentin.
[0007] In a second aspect, the present invention provides a gene encoding a nitrilase mutant with high thermal stability.
[0008] Specifically, the present invention provides a nucleotide sequence of a gene encoding a nitrilase mutant with high thermal stability, as shown in SEQ ID NO.2.
[0009] In a third aspect, the present invention provides a recombinant vector comprising the above-mentioned encoding gene.
[0010] In a fourth aspect, the present invention provides a genetically engineered bacterium, wherein the engineered bacterium comprises the above-mentioned encoding gene or the above-mentioned recombinant vector.
[0011] Preferably, the host bacteria of the genetically engineered bacteria is Escherichia coli.
[0012] In a fifth aspect, the present invention provides the use of the aforementioned nitrilase mutant or genetically engineered bacteria in the synthesis of gabapentin. By simultaneously mutating the F168, V305, and L194 sites to F168V, V305L, and L194A, the thermal stability of the nitrilase is significantly improved, thereby enhancing the potential of the nitrilase in the synthesis of gabapentin.
[0013] In a sixth aspect, the present invention provides a D-type amino acid oxidase mutant, the amino acid sequence of the D-type amino acid oxidase mutant is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4.
[0014] In a seventh aspect, the present invention provides a nitroreductase mutant, the amino acid sequence of the nitroreductase mutant is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.6.
[0015] Based on the deep learning transformation method, the D-type amino acid oxidase and nitroreductase can be modified and mutated to improve their thermal stability, which is beneficial for their application in the synthesis of L-phosphinothricin precursors 2-carbonyl-4[hydroxy(methyl)phosphono]butyric acid and 3-amino-2-hydroxyacetophenone.
[0016] Compared with the prior art, the present invention has the following technical effects:
[0017] The present invention uses Acidovorax facilis The nitrilase ZJB09122 from the original source was used as the parent, and a deep learning method was used to screen the combined mutant ZJB09122_M3 through high-throughput screening. The mutant ZJB09122_M3 was obtained by simultaneously mutating the three sites F168V, V305L, and L194A. Specifically, a recombinant strain containing the mutation was constructed, and after induction culture, a nitrilase mutant ZJB09122_M3 with the largest improvement in thermal stability was screened out. The optimal pH of the mutant ZJB09122_M3 of the present invention is between 7.5-8.0; the optimal temperature is between 45-50°C; in a Na2HPO4-NaH2PO4 buffer solution with a pH of 7.0 and a reaction temperature of 45°C, the specific activities of ZJB09122 and ZJB09122_M3 are 7.18 U / mg and 8.16 U / mg, respectively, t 1 / 2 In terms of thermal stability, after ZJB09122 and ZJB09122_M3 were kept at 65℃ for a period of time, the residual enzyme activities were 18.91% and 60.52% of the initial enzyme activities, respectively, and the T 50 The value is 65.0°C, which is 5.9°C higher than that of the wild type ZJB09122 at 59.1°C. Therefore, the nitrilase mutant ZJB09122_M3 of the present invention has the characteristic of high thermal stability, and the high thermal stability nitrilase mutant of the present invention has great application potential in the synthesis of gabapentin. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 Figure 3 is the SDS-PAGE analysis of the highly thermostable nitrilase mutant, where M is a low molecular weight protein marker; A and B are the purified wild-type enzyme ZJB09122 and mutant ZJB09122_M3, respectively;
[0019] Figure 2is the optimal pH for the highly thermostable nitrilase mutant and wild type;
[0020] Figure 3 pH stability of high specific activity thermostable xylanase mutant and wild type;
[0021] Figure 4 is the optimum temperature of the highly thermostable nitrilase mutant and the wild type;
[0022] Figure 5 The thermal stability of the highly thermostable nitrilase mutant and the wild type;
[0023] Figure 6 The thermal stability of the highly thermostable D-amino acid oxidase mutant and the wild type;
[0024] Figure 7 The thermostability of the highly thermostable nitroreductase mutant compared with the wild type. DETAILED DESCRIPTION
[0025] Test materials and detection methods used in the examples:
[0026] 1. Strains and vectors: Expression host E. coli BL21 is kept in this laboratory.
[0027] 2. Enzymes and other biochemical reagents: High-fidelity DNA polymerase was purchased from Vazyme, 1-cyanocyclohexylacetonitrile was purchased from Carbosynth China Ltd., and 1-cyanocyclohexylacetic acid was provided by Zhejiang Yongtai Chemical Co., Ltd. D,L-phosphinothricin was purchased from Sigma Aldrich; 2,4-dinitrophenylhydrazine (DNPH) was purchased from Aladdin Reagents (Shanghai, China), and commercial micrococcal catalase was purchased from Sigma Aldrich (Shanghai, China). m-Nitroacetophenone and 3-amino-2-hydroxyacetophenone were purchased from Aladdin Reagents (Shanghai, China). All other reagents were purchased from common biochemical reagent companies.
[0028] 3. Culture medium:
[0029] 1) LB medium (liquid): 1% peptone, 0.5% yeast extract, 1% NaCl;
[0030] 2) LB medium (solid): 1% peptone, 0.5% yeast extract, 1% NaCl, 1% agar powder.
[0031] 4. Detection method:
[0032] The HPLC analysis method for the product 1-cyanocyclohexylacetic acid was as follows: the chromatographic column was a J&K Scientific C18-H column (4.6×250mm, 5 μm, 120 Å), the mobile phase was a buffer solution (0.58 g / L ammonium dihydrogen phosphate, 1.8375 g / L sodium perchlorate, pH adjusted to 1.8 with perchloric acid, and the solvent was deionized water): acetonitrile = 76:24 (v:v), the flow rate was 1 mL / min, the injection volume was 10 μL, the UV detection wavelength was 215 nm, and the column temperature was 40°C.
[0033] The HPLC analysis method for the product 2-carbonyl-4-[hydroxy(methyl)phosphono]butanoic acid (PPO) was as follows: Welchrom® C18 column, 30°C column temperature, flow rate 1 mL / min, detection wavelength 232 nm, mobile phase A consisting of pure acetonitrile and mobile phase B consisting of 50 mM tetrabutylammonium bromide (NH2)HPO4 (pH 3.8) containing 1‰. Mobile phases A and B were mixed in a ratio of 12:88 (v / v).
[0034] The HPLC analysis method for the product 3-amino-2-hydroxyacetophenone is as follows: chromatographic column / Avantor® phenyl; column temperature / 40°C; flow rate / 1 mL / min; detection wavelength / 235 nm; mobile phase: 13.5 mM trifluoroacetic acid: pure acetonitrile (V / V) = 75:25.
[0035] Definition of pure enzyme activity: Under certain conditions, the amount of enzyme required to catalyze the substrate to produce 1 μmol of product per minute is defined as one activity unit, recorded as U.
[0036] Example 1 Obtaining a gene encoding an enzyme mutant with improved thermostability
[0037] This example uses a deep learning approach to design a nitrilase mutant, ZJB09122_M3, using the nitrilase ZJB09122 enzyme as the parent. The nitrilase mutant ZJB09122_M3 was obtained by simultaneously mutating the three sites of the nitrilase ZJB09122 enzyme, F168, V305, and L194, to F168V, V305L, and L194A. The amino acid sequence of the nitrilase mutant ZJB09122_M3 is shown in SEQ ID NO. 1, and the nucleotide sequence is shown in SEQ ID NO. 2. A person skilled in the art can obtain enzyme mutants based on these sequences.
[0038] Example 2 Obtaining a highly thermostable nitrilase mutant
[0039] In this example, the expression plasmid pET-28b(+)-ZJB09122 was used as a template, and the primer sequences in Table 1 were used to perform point mutations at sites 168, 194, and 305 to obtain the mutant ZJB09122_M3.
[0040] Table 1 Primer sequences
[0041] Serial number Primer name Sequence (5'—3') 1 F168V-f GCTGGGAGCACGTTCAGCCGCTGT 2 F168V-r GTGCTCCCAGCAGTTCAGACCAC 3 L194A-f ATGTCCCCGGCACAACCGGACGTG 4 L194A-r GTCCGGTTGTGCCGGGGACATAG 5 V305L-f GTCCTGTCCCTACAGTTCGACCCG 6 V305L-r GGACAGGACATCAGGGCG
[0042] The PCR (50 μL) amplification system was as follows: 25 μL of 2×PCR buffer, 2 μL of upstream and downstream primers, 1 μL of template plasmid, 1 μL of dNTP, 0.5 μL of high-fidelity enzyme, and ddH2O was added to make up to 50 μL.
[0043] The PCR amplification procedure was as follows: (1) pre-denaturation at 95°C for 5 min, (2) denaturation at 95°C for 30 s, (3) annealing at 60°C for 30 s, (4) extension at 72°C for 5 min, 30 cycles, (5) extension at 72°C for 10 min, and (6) storage at 4°C.
[0044] pET-28b(+)-ZJB09122 and pET-28b(+)-ZJB09122_M3 were transfected into E. coli BL21 to obtain wild-type BL21 / ZJB09122 and BL21 / ZJB09122_M3, respectively. ZJB09122 and ZJB09122_M3 were cultured as follows:
[0045] Pipette 30 μL of glycerol bacterial solution (mass concentration of 30% glycerol: bacterial solution (v / v) = 1:1) into 10 mL of LB medium containing 50 μg / mL kanamycin, and culture in a shaker at 37°C and 180 rpm for 8 h; inoculate the inoculum into a flask containing 100 mL of LB liquid medium at a 2% volume ratio, and add 100 μL of 50 μg / mL kanamycin. Incubate in a shaker at 37°C and 150 rpm until OD600 = 0.4-0.6, then add 100 μL of 0.1 mmol / L IPTG, and culture in a shaker at 28°C and 150 rpm for 14 h. The cultured bacterial liquid was centrifuged at 8000 rpm for 10 min to obtain wet bacteria, and 10 mL of 0.2 mol / L Na2HPO4-NaH2PO4 buffer (pH 7.0) was added and blown to mix well to make a cell suspension. The suspension was placed in an ice water bath at 4°C for ultrasonic disruption. The conditions for ultrasonic disruption were: 400 W, 10 min, disruption for 2 s, and pause for 4 s. The disrupted product was centrifuged at 8000 rpm for 10 min, and the supernatant was taken as the crude enzyme solution. The crude enzyme solution was treated by nickel column affinity chromatography to obtain pure nitrilase enzyme solution for enzymatic property determination and comparison. The protein expression of ZJB09122 and ZJB09122_M3 was detected by SDS-PAGE, as shown in Figure 2. Figure 1 As shown, A is the protein purified from ZJB09122, and B is the protein purified from ZJB09122_M3. The protein sizes are both 42 kDa.
[0046] Example 3 Comparative Analysis of Enzymatic Properties of Highly Thermostable Nitrilase Mutants and Wild Type
[0047] 1. Determination of the optimal pH of highly thermostable nitrilase mutants and wild type
[0048] The nitrilase mutant and wild type purified in Example 2 were reacted at pH 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9.0, respectively, to determine their optimal pH. The results are shown in FIG. Figure 2 The reaction system consisted of adding 0.2 mol / L of the substrate 1-cyanocyclohexylacetonitrile to 1 mL of buffer solutions at different pH values, followed by the addition of 0.01 g of the enzyme. The reaction was then carried out at 35°C for 10 min, and the nitrilase activity was measured. The pH buffer solutions were prepared by mixing citric acid-sodium citrate buffer (pH 4.0-5.0), NaHPO-NaH2PO4 buffer (pH 6.0-8.0), and glycine sodium hydroxide buffer (pH 9.0).
[0049] Depend on Figure 2It can be seen that the optimal reaction pH of the wild-type nitrilase ZJB09122 and the mutant nitrilase ZJB09122_M3 are 7.5 and 8.0, respectively.
[0050] 2. Determination of pH stability of highly thermostable nitrilase mutants and wild type
[0051] The nitrilase mutants and wild-type were diluted with buffer solutions at pH 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9.0, respectively, and then treated in a 35°C water bath for 10 min. The relative residual enzyme activity was then determined at pH 7.0 and 35°C in the following reaction system: 0.2 mol / L substrate 1-cyanocyclohexylacetonitrile, 1 mL pH 7.0 Na2HPO4-NaH2PO4 buffer, 0.01 g enzyme, and the reaction was performed at 35°C for 10 min. The untreated enzyme activity was set as 100% for control. The results are shown in Table 1. Figure 3 .
[0052] The results are as follows Figure 3 As shown, the nitrilase mutant was more stable than the wild type under acidic conditions (pH 5.0-6.5).
[0053] 3. Determination of the optimal temperature of highly thermostable nitrilase mutants and wild type
[0054] The enzymatic reaction was carried out in a 0.2 mol / L Na2HPO4-NaH2PO4 buffer system at different temperatures (30℃, 35℃, 45℃, 50℃, 55℃, 60℃, 65℃, 70℃, 75℃). The results are shown in Figure 4 The enzymatic reaction system was as follows: 0.2 mol / L substrate 1-cyanocyclohexylacetonitrile, 1 mL pH 7.0 NaHPO-NaH2PO4 buffer, 0.01 g enzyme, and the reaction was carried out at different temperatures for 10 min.
[0055] The results are as follows Figure 4 As shown, the optimum temperatures of the recombinant highly thermostable nitrilase mutant and the wild-type nitrilase are 50°C and 45°C, respectively, and the optimum temperature of the mutant is 5°C higher than that of the wild-type.
[0056] 4. Determination of the thermal stability of highly thermostable nitrilase mutants and wild type
[0057] The thermal stability of the nitrilase mutant ZJB09122_M3 and wild-type nitrilase ZJB09122 was determined as follows: both mutant and wild-type nitrilase were incubated at 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, and 75°C for 10 min. The mixture was then incubated with 0.2 mol / L of substrate, and the enzymatic reaction was carried out at 35°C. The reaction system consisted of 0.2 mol / L 1-cyanocyclohexylacetonitrile, 1 mL of pH 7.0 NaHPO-NaH2PO4 buffer, and 0.01 g of enzyme. The reaction was incubated at 35°C for 10 min. The residual enzyme activity was then measured.
[0058] The results are as follows Figure 5 As shown, the T of nitrilase mutant ZJB09122_M3 50 The value was 65.0℃, which was 5.9℃ higher than that of the wild type (59.1℃).
[0059] 5. Determination of the t of the highly thermostable nitrilase mutant and wild-type nitrilase 1 / 2 value
[0060] The purified nitrilase was incubated in 0.2 mol / L NaHPO-NaH2PO4 buffer at 45°C and pH 7.0. Samples were taken at regular intervals to measure the residual activity and determine the half-life of heat inactivation. 1 / 2 The initial and residual activities were measured by HPLC. The first-order rate constant of irreversible thermal denaturation was analyzed based on the slope of the initial activity / residual activity versus time curve, and the half-life (t 1 / 2 The results are shown in Table 2.
[0061] The results are shown in Table 2. At 45°C, the specific activity of the wild type ZJB09122 was 7.18 U / mg, and the specific activity of the mutant ZJB09122_M3 was 8.16 U / mg, which was higher than that of the wild type. 1 / 2 The survival time was 48 h, which was 32 h longer than that of the wild type (16 h).
[0062] Table 2 Specific activity and t of wild type and mutants at 45℃ 1 / 2 Compare
[0063] Specific activity (U / mg) <![CDATA[t 1 / 2 (h)]]> ZJB09122 7.18±0.56 16±0.5 ZJB09122_M3 8.16±0.63 48±1.0
[0064] Example 4 Obtaining a highly thermostable D-amino acid oxidase mutant
[0065] This example is derived from fungi Rasamsonia emersoniiUsing the D-type amino acid oxidase A0A499UB99 as the parent, the A50C, D100S, and A250G mutations were made to generate the mutant A0A499UB99_M3. The amino acid sequence of the D-type amino acid oxidase mutant A0A499UB99-M3 is shown in SEQ ID NO: 3, and the nucleotide sequence is shown in SEQ ID NO: 4. Primer sequences are shown in Table 3, and the PCR amplification system was the same as in Example 2.
[0066] Table 3 Primer sequences
[0067] Serial number Primer name Sequence (5'—3') 1 A50C-f AGTCCGTGGTGTGGTGCAAATTATCTG 2 A50C-r AATTTGCACCACACCACGGACTACAAT 3 D100S-f CGTACCAAAAGCCAGGGTTCTACAACA 4 D100S-r AGAACCCTGGCTTTTGGTACGATTATA 5 A250G-f ACACGTGCAGGTGGTGGTGGTACAA 6 A250G-r ACCACCACCTGCACGTGTCATCAT
[0068] pET-28b(+)-A0A499UB99 and pET-28b(+)-A0A499UB99_M3 were transfected into E. coli BL21 to generate wild-type BL21 / A0A499UB99 and BL21 / A0A499UB99_M3, respectively. A0A499UB99 and A0A499UB99_M3 were then cultured. The following steps were followed:
[0069] 30 μL of glycerol bacterial solution (30% glycerol: bacterial solution (v / v) = 1:1) was pipetted into 10 mL of LB medium containing 50 μg / ml streptomycin sulfate and cultured in a shaker at 37°C and 180 rpm for 8 h; inoculated into a flask containing 100 mL of LB liquid medium at a volume ratio of 2%, and 100 μL of 50 μg / mL kanamycin was added. The flask was cultured in a shaker at 37°C and 150 rpm until the OD 600 =0.4-0.6, add 100 μL of 0.1 mmol / L IPTG and incubate the culture in a shaker at 28°C and 150 rpm for 14 h. Centrifuge the culture at 8000 rpm for 10 min to obtain wet cells.
[0070] Example 5 Comparison of thermal stability of wild-type and mutant D-amino acid oxidase
[0071] The thermal stability of A0A499UB99 and A0A499UB99_M3 was determined by incubating the mutant and wild-type at 35°C, 45°C, 50°C, 55°C, 60°C, 65°C, and 70°C for 10 min. The enzyme-catalyzed reaction was then carried out at 35°C using the following system: 0.1 mol / L racemic glufosinate ammonium, 1 mL pH 7.0 NaHPO-NaH2PO4 buffer, and 0.03 g enzyme. The reaction was continued at 35°C for 10 min. The residual enzyme activity of each enzyme was determined, with the untreated enzyme activity set as 100%.
[0072] The results are as follows Figure 6 As shown, the T of mutant A0A499UB99_M3 50 The value was 53.0℃, which was 4.8℃ higher than that of the wild type (48.2℃).
[0073] Example 6 Obtaining nitroreductase mutants
[0074] This embodiment is based on Bartonella henselae Using wild-type nitroreductase K8099RS04 as the parent, mutant K8099RS04_M3 was obtained by adding mutations at A41G, I59C, and D139C. The amino acid sequence of D-amino acid oxidase mutant K8099RS04_M3 is shown in SEQ ID NO: 5, and the nucleotide sequence is shown in SEQ ID NO: 6. Primer sequences are shown in Table 4, and the PCR amplification system was the same as in Example 2.
[0075] Table 4 Primer sequences
[0076] Serial number Primer name Sequence (5'—3') 1 A41G-f GCTGCTCGTGGTCCATCTGGTACC 2 A41G-r ACCAGATGGACCACGAGCAGCCAG 3 I59C-f ACCGGTAAGTGTCTGCAGAAAGTG 4 I59C-r TTTCTGCAGACACTTACCGGTCAG 5 D139C-f TTCACCATCTGTCACGACATGGAA 6 D139C-r CATGTCGTGACAGATGGTGAACAG
[0077] pET-28b(+)-K8099RS04 and pET-28b(+)-K8099RS04_M3 were transfected into Escherichia coli BL21 to obtain wild-type BL21 / K8099RS04 and BL21 / K8099RS04_M3, respectively. K8099RS04 and K8099RS04_M3 were cultured according to the method of Example 2 to obtain bacteria and enzymes.
[0078] Example 7 Comparison of thermal stability of wild-type and mutant nitroreductase
[0079] The thermal stability of K8099RS04 and K8099RS04_M3 was determined by incubating the mutant and wild-type at 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, and 75°C for 10 min. Afterward, 0.1 mol / L of substrate was added, and the enzymatic reaction was carried out at 35°C. The reaction system consisted of 10 g / L m-nitroacetophenone, 100 mM phosphate buffer, pH 8.0, and 10 g / L lyophilized nitroreductase or its mutant at 35°C for 10 min. The residual enzyme activity of each sample was determined, with the untreated enzyme activity as 100%.
[0080] The results are as follows Figure 7 As shown, the T of mutant A0A499UB99_M3 50 The value was 56.1℃, which was 5.3℃ higher than that of the wild type (50.8℃).
[0081] Unless otherwise specified, the raw materials and equipment used in the present invention are commonly used in the art; the methods used in the present invention are conventional methods in the art unless otherwise specified.
[0082] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still fall within the scope of protection of the technical solution of the present invention.
Claims
1. A highly thermostable enzyme mutant engineered based on deep learning, characterized by: The amino acid sequence is shown in SEQ ID NO.
1.
2. A gene encoding the enzyme mutant according to claim 1.
3. The coding gene according to claim 2, characterized in that: The nucleotide sequence is shown in SEQ ID NO.
2.
4. A recombinant vector, characterized in that: The recombinant vector comprises the coding gene according to claim 2.
5. A genetically engineered bacterium, characterized in that: The engineered bacteria comprises the coding gene according to claim 2 or the recombinant vector according to claim 4.
6. The genetically engineered bacterium according to claim 5, wherein: The host bacteria of the genetically engineered bacteria is Escherichia coli.
7. Use of the enzyme mutant according to claim 1 in the synthesis of gabapentin.
8. Use of the genetically engineered bacteria according to claim 5 in synthesizing gabapentin.
Citation Information
Patent Citations
Recombinant nitrilase, coding gene, mutant, engineering bacteria and application thereof
CN104212784A
Nitrilase mutant and application thereof in preparation of 1-cyanocyclohexyl acetic acid
CN111471668A