Peanut seed specific gene promoter N1YYK3 and application thereof

Abstract

The invention provides a peanut seed specific gene promoter N1YYK3 and application thereof, and relates to the technical field of plant genetic engineering. The promoter N1YYK3 is selected from SEQ ID NO.01, a sequence which is reversely complementary with the SEQ ID NO.01, SEQ ID NO.02, a DNA (deoxyribonucleic acid) or RNA (ribonucleic acid) sequence which is hybridized with the SEQ ID NO.01 or the SEQ ID NO.02, a sequence which is at least 95% consistent with the sequence of the SEQ ID NO.01 or the SEQ ID NO.02, and a DNA or RNA sequence which is complementary with any one of the SEQ ID NO.01 and the SEQ ID NO.02; the promoter 0B3TGP can be utilized or operated to drive the hepatitis B surface antigen HBsAg gene in peanut seed tissue cells to express and efficiently produce the hepatitis B surface antigen HBsAg vaccine.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a peanut seed-specific gene promoter N1YYK3 and an application thereof. Background Art

[0002] A promoter is a DNA sequence that RNA polymerase recognizes, binds to, and starts transcription. It contains conserved sequences required for RNA polymerase specific binding and transcription initiation. Most of them are located upstream of the transcription start site of the structural gene, and the promoter itself is not transcribed. However, some promoters (such as tRNA promoters) are located downstream of the transcription start site, and these DNA sequences can be transcribed. The characteristics of promoters were originally identified by mutations that can increase or decrease the transcription rate of genes. Promoters are generally located upstream of the transcription start site.

[0003] With the rapid development of pharmaceutical technology and genetic engineering technology, in order to meet the low cost and high efficiency in biosynthesis fields such as drug production, plant, animal or microbial cells are used as reactors for genetic modification and gene transformation to efficiently produce heterologous proteins. They are often used in the production of products such as medicinal proteins, antigens and vaccines, and in the cultivation of new varieties of crops with high nutritional value, high active ingredient content or other excellent traits.

[0004] Hepatitis B virus (HBV) infection is prevalent worldwide, but the prevalence of HBV infection varies greatly in different regions.

[0005] Hepatitis B virus (HBV) is the pathogen that causes hepatitis B (abbreviated as HBV). It belongs to the Hepadnaviridae family, which includes two genera: Orthohepadnavirus and Avianhepadnavirus. The Orthohepadnavirus is the one that causes human infection. HBV infection is a global public health issue. With the production and investment of genetically engineered vaccines, the popularity of hepatitis B vaccines has increased year by year, and the infection rate has shown a downward trend.

[0006] When constructing a hepatitis B virus vaccine, the hepatitis B surface antigen HBsAg can be used as an antigen to enter the body to induce an immune response, so that the animal body can quickly produce a targeted immune response when infected with the hepatitis B virus to quickly eliminate the pathogen. There are two different ways for transgenic plants to express exogenous hepatitis B surface antigen: (1) Stable genome integration of exogenous DNA through Agrobacterium T-DNA vector or microparticle bombardment directly mediates stable expression. A large number of transgenic plants can be produced through asexual or sexual reproduction, and multiple genes can also be mediated to produce multivalent vaccines, but the expression level is low. (2) Transient expression using viral vectors. Although the transient expression level is relatively high, it needs to be purified or partially purified before oral consumption. However, the existing technology has the problem of low expression level. Summary of the invention

[0007] In view of the deficiencies in the prior art, the present invention provides a peanut seed-specific gene promoter N1YYK3 and its application, and utilizes the specific gene promoter N1YYK3 to drive the expression of a target gene in peanut seed tissue cells, thereby achieving the purpose of expressing the target gene in specific peanut seed tissue cells and cultivating high-value new crop varieties.

[0008] To achieve the above objectives, the technical solution of the present invention is implemented through the following technical solutions:

[0009] A peanut seed-specific gene promoter N1YYK3, wherein the peanut seed-specific gene promoter N1YYK3 can drive a target gene to be specifically and highly expressed in seed tissue cells in peanut seed tissue cells, and the DNA nucleotide sequence of the specific gene promoter N1YYK3 is selected from any one of the following sequences:

[0010] (1) The DNA nucleotide sequence shown in SEQ ID NO.01:

[0011] GACAGGTGTTGCATCACCTCCACCTCAGTTTCATGCAAAGCCGCCACGACAGCAATGCACCCTCCCTTTGCCAGCTTAACCTCCCTTCATTGCTATATACATTCCCTTCACTTCTCTCTCACTCTTCCTCAAACCCCATCACTTCTTGTCTAAAAATTCTCAAAAGTCACCAGCCACCAAAAACCCATTTACCATT;

[0012] (2) A sequence that is reverse complementary to the DNA nucleotide sequence shown in SEQ ID NO.01, that is, a single-stranded sequence that can form a complete base pairing with the original sequence to form a double-stranded structure and in the opposite direction, such as SEQ ID NO.02:

[0013] AATGGTAAATGGGTTTTTGGTGGCTGGTGACTTTTGAGAATTTTTAGACAAGAAGTGATGGGGTTTGAGGAAGAGTGAGAGAAGTGAAGGGAATGTATATAGCAATGAAGGGAGGTTAAGCTGGCAAAAGGGGAGGGTGCATTGCTGTGTCGTGGCGGCTTTGCATGAAACTGAGGTGGAGGTGATGCAACACCTGTC;

[0014] (3) a nucleic acid DNA or RNA sequence that can hybridize with the sequence of SEQ ID NO.01 or SEQ ID NO.02;

[0015] (4) a sequence having at least 95% sequence identity with any of the sequences described in (1) or (2);

[0016] (5) A DNA or RNA sequence complementary to any of the sequences described in (1) or (2).

[0017] Preferably, the promoter N1YYK3 is obtained by PCR amplification technology.

[0018] Preferably, during the PCR amplification process, the following two primers are configured according to the DNA nucleotide sequence shown in SEQ ID NO.01 for amplification:

[0019] SEQ ID NO.03: GACAGGTGTTGCATCACCTCCACCT;

[0020] SEQ ID NO. 04: AATGGTAAATGGGTTTTTGGTGGCT.

[0021] The specific gene promoter N1YYK3 is used in peanut seed gene editing or transgenic operation to cultivate new varieties.

[0022] Preferably, the application method is to utilize or operate the gene promoter N1YYK3 to drive the expression of the target gene in the peanut seed tissue cells, thereby utilizing the seed cells as a reactor to synthesize related proteins at the molecular biology level.

[0023] Preferably, the specific process of the application is to perform transgenic operation on peanut seeds, use plasmid as a vector, construct a DNA double strand of peanut seed-specific gene promoter N1YYK3-target gene-NOS terminator through enzyme cutting and ligation reaction, and use the plant expression vector to transform the target plant to complete genetic transformation.

[0024] The present invention provides a peanut seed-specific gene promoter N1YYK3 and its application, which has the following advantages over the prior art:

[0025] The present invention provides a new peanut seed-specific gene promoter N1YYK3, which can be used or operated to drive the target gene to be expressed in peanut seed tissue cells, thereby achieving the purpose of expressing the target gene in specific peanut seed tissue cells. The peanut seed tissue cells are used as reactors through the promoter N1YYK3 to enhance the expression of the hepatitis B surface antigen HBsAg gene in the peanut seed tissue cells, thereby producing an antigen vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the electrophoresis diagram of the PCR amplification of the peanut seed-specific gene promoter N1YYK3 in Example 1 of the present invention. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention is clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] Embodiment 1:

[0029] PCR amplification of peanut seed-specific gene promoter N1YYK3:

[0030] 1. Select the DNA nucleotide sequence shown in SEQ ID NO.01 as the peanut seed-specific gene promoter N1YYK3 sequence;

[0031] 2. Configure two primers according to the above sequence:

[0032] SEQ ID NO.03: GACAGGTGTTGCATCACCTCCACCT;

[0033] SEQ ID NO. 04: AATGGTAAATGGGTTTTTGGTGGCT.

[0034] 3. Prepare a DNA amplification system based on Phusion DNA polymerase: The preparation method is to mix the following, and the ratio here is based on a total system volume of 50 μL as an example:

[0035] (1) dd H2O 30.5μL

[0036] (2) 10× Buffer 5 μL

[0037] (3) dNTP (10mmol / L) 1μL

[0038] (4)SEQ ID NO.03 (10μmol / L) 5μL

[0039] (5)SEQ ID NO.04 (10μmol / L)5μL

[0040] (6) MgCl2 (50mmol / L) 0.5μL

[0041] (7) Peanut genomic DNA 2 μL

[0042] (8) Phusion DNA polymerase 1 μL;

[0043] 4. Run the PCR amplification program: Place the above amplification system into the PCR thermal cycler and perform the following thermal cycle steps:

[0044] (1) 98°C, 5 min

[0045] (2) 98°C, 30 seconds

[0046] (3) 55°C, 30 seconds

[0047] (4) 72°C, 3 min

[0048] (5) Repeat steps (2) to (4) for 36 cycles;

[0049] (6) 72°C, keep warm for 20 min;

[0050] The DNA fragment of 0.20 kb was recovered by electrophoresis and blunt-end ligation was performed using pEASY-Blunt. The fragment was transformed into DH5α competent Escherichia coli and sequenced.

[0051] Embodiment 2:

[0052] Using the peanut seed-specific gene promoter N1YYK3 for crop gene editing:

[0053] In the field of plant genetic engineering, when it comes to genetic engineering of hepatitis B oral vaccine bioreactors, hepatitis B surface antigen HBsAg is often used as an antigen to introduce the hepatitis B surface antigen HBsAg gene into the target plant body to efficiently produce hepatitis B surface antigen HBsAg vaccine.

[0054] By utilizing the tissue specificity of the peanut seed-specific gene promoter N1YYK3, the peanut seed-specific gene promoter N1YYK3 can be used or manipulated to drive the expression of the hepatitis B surface antigen HBsAg gene in the peanut seed tissue cells, thereby achieving the purpose of expressing the hepatitis B surface antigen HBsAg gene in the peanut seed tissue cells. In the molecular biology level breeding of agricultural production, this method can be used to use seed cells as reactors to carry out genetic modification and gene transformation to efficiently produce the hepatitis B surface antigen HBsAg vaccine.

[0055] The operation method is as follows: using the pCAMBIA2300 plasmid sequence as a vector, constructing a double-stranded DNA sequence of peanut seed-specific gene promoter N1YYK3-hepatitis B surface antigen HBsAg gene-NOS terminator through enzyme digestion and ligation reaction, and using the plant expression vector to transform the target plant to complete genetic transformation;

[0056] The specific experimental design is:

[0057] 1. Tissue culture and subsequent differentiation induction were performed on the callus of Jihua 65 peanut in MB medium to obtain 20 complete plants of the original variety Jihua 65 peanut and 20 complete plants of the transgenic variety Jihua 65 (genetic transformation positive variety) peanut in which the hepatitis B surface antigen HBsAg gene was inserted using the peanut seed-specific gene promoter N1YYK3-hepatitis B surface antigen HBsAg gene-NOS terminator plasmid sequence. The plants were planted under normal greenhouse conditions for 120 days until the plants matured and bore fruit, and the seeds of the two plants were collected and the seed parts were separated separately;

[0058] 50 experimental mice were fed with 15g of each of the two peanut seeds, 4 times a week for 2 weeks, i.e. 8 times in total. Blood and saliva were collected from the retro-orbital vein 3 days after the last immunization. The levels of HBsAg-specific antibodies on the surface of the serum and mucosa (taking the oral mucosa as an example) of the mice were used as indicators to investigate the enhanced expression of the hepatitis B surface antigen HBsAg gene to produce the antigen vaccine. The specific results are shown in the following table:

[0059]

[0060] It can be seen from the above table that seeds of genetic transformation positive varieties are capable of producing antigen vaccines.

[0061] 2. Verify that the effect of the peanut seed-specific gene promoter N1YYK3 on the enhanced expression of the hepatitis B surface antigen HBsAg gene when used for gene editing to produce antigen vaccines is only specific to peanut seed tissue cells:

[0062] The remaining parts of the complete plants of the original variety Jihua 65 peanut obtained after the above planting and the transgenic variety Jihua 65 (genetic transformation positive variety) peanut variety in which the hepatitis B surface antigen HBsAg gene was inserted using the peanut seed-specific gene promoter N1YYK3-hepatitis B surface antigen HBsAg gene-NOS terminator plasmid sequence, namely the roots, stems, leaves and shells, were detected for HBsAg expression by Western blot. It was found that no protein with the molecular weight consistent with the HBsAg subunit protein and antigenicity was detected in other tissues except the seed part.

[0063] After comparison, it was found that there was no obvious difference in the promotion of the expression of the hepatitis B surface antigen HBsAg gene in the two plants in parts other than seeds. It was found that the expression of the hepatitis B surface antigen HBsAg gene was not significantly enhanced in the remaining plant cells except seeds of the original variety Jihua 65 peanut and the transgenic variety Jihua 65 (genetic transformation positive variety) peanut in which the hepatitis B surface antigen HBsAg gene was inserted using the peanut seed-specific gene promoter N1YYK3-hepatitis B surface antigen HBsAg gene-NOS terminator plasmid sequence.

[0064] Based on the above experiments, it can be concluded that the content of hepatitis B surface antigen HBsAg in 65 peanut seedlings of Jihua inserted with the peanut seed-specific gene promoter N1YYK3-hepatitis B surface antigen HBsAg gene-NOS terminator plasmid sequence was significantly increased compared with the untreated peanut seed tissue cells of the same species under the same growth conditions, while no significant change was found in the content of hepatitis B surface antigen HBsAg in the rest of the plant. Therefore, the peanut seed-specific gene promoter N1YYK3 has obvious tissue specificity and expression enhancement effects on the expression of hepatitis B surface antigen HBsAg gene in seed tissue cells when used for gene editing.

[0065] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A peanut seed-specific gene promoter N1YYK3, characterized in that: The peanut seed-specific gene promoter N1YYK3 can drive the target gene to be specifically and highly expressed in the seed tissue cells in the peanut seed tissue cells, and the DNA nucleotide sequence of the specific gene promoter N1YYK3 is selected from any one of the following sequences: (1) The DNA nucleotide sequence shown in SEQ ID NO.01: GACAGGTGTTGCATCACCTCCACCTCAGTTTCATGCAAAGCCGCCACGACAGCAATGCACCCTCCCTTTGCCAGCTTAACCTCCCTTCATTGCTATATACATTCCCTTCACTTCTCTCTCACTCTTCCTCAAACCCCATCACTTCTTGTCTAAAAATTCTCAAAAGTCACCAGCCACCAAAAACCCATTTACCATT; (2) A sequence that is reverse complementary to the DNA nucleotide sequence shown in SEQ ID NO.01, that is, a single-stranded sequence that can form a complete base pairing with the original sequence to form a double-stranded structure and in the opposite direction, such as SEQ ID NO.02: AATGGTAAATGGGTTTTTGGTGGCTGGTGACTTTTGAGAATTTTTAGACAAGAAGTGATGGGGTTTGAGGAAGAGTGAGAGAAGTGAAGGGAATGTATATAGCAATGAAGGGAGGTTAAGCTGGCAAAAGGGGAGGGTGCATTGCTGTGTCGTGGCGGCTTTGCATGAAACTGAGGTGGAGGTGATGCAACACCTGTC; (3) a nucleic acid DNA or RNA sequence that can hybridize with the sequence of SEQ ID NO.01 or SEQ ID NO.02; (4) a sequence having at least 95% sequence identity with any of the sequences described in (1) or (2); (5) A DNA or RNA sequence complementary to any of the sequences described in (1) or (2).

2. The peanut seed-specific gene promoter N1YYK3 according to claim 1, characterized in that: The promoter N1YYK3 is obtained by PCR amplification technology.

3. The peanut seed-specific gene promoter N1YYK3 according to claim 1, characterized in that: In the PCR amplification process, the following two primers are configured according to the DNA nucleotide sequence shown in SEQ ID NO.01 for amplification: SEQ ID NO.03: GACAGGTGTTGCATCACCTCCACCT; SEQ ID NO. 04: AATGGTAAATGGGTTTTTGGTGGCT.

4. An application of the peanut seed-specific gene promoter N1YYK3 according to any one of claims 1 to 3, characterized in that: The specific gene promoter N1YYK3 is applied to peanut seed gene editing or transgenic operation to cultivate new varieties.

5. The use of a peanut seed-specific gene promoter N1YYK3 according to claim 4, characterized in that: The application method is to use or operate the gene promoter N1YYK3 to drive the target gene to express in peanut seed tissue cells, thereby using the seed cells as reactors to synthesize related proteins at the molecular biology level.

6. The use of a peanut seed-specific gene promoter N1YYK3 according to claim 5, characterized in that: The specific process of the application is to perform genetic modification on peanut seeds, use plasmid as a vector, construct a DNA double chain of peanut seed specific gene promoter N1YYK3-target gene-NOS terminator through enzyme cutting and ligation reaction, and use the plant expression vector to transform the target plant to complete genetic transformation.

Images