Rose RhMORF8 gene and its application

Abstract

The present invention belongs to the field of plant genetic engineering and relates to rose RhMORF8 Gene and its application, the nucleotide sequence of the gene is shown in SEQID NO.1; the amino acid sequence of the protein encoded by the gene is shown in SEQID NO.2. By silencing VIGS in rose petals, the function of RhMORF8 in the response to water loss stress of roses is verified, providing a theoretical basis for breeding drought-resistant rose varieties.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering and relates to rose RhMORF8 Genes and their applications. Background Art

[0002] Water loss stress is an important environmental challenge faced by cut roses during post-harvest circulation and vase placement. It directly leads to a decline in the appearance quality of cut flowers, such as petal shrinkage and color fading, which seriously affects the ornamental value of cut flowers. At the same time, water loss stress will accelerate the aging process of cut flowers, shorten the vase life, and increase the loss rate of cut flowers during circulation and storage. Cut flowers may suffer from varying degrees of water loss stress in various links such as harvesting, pre-cooling, packaging, transportation, and storage, resulting in stiff buds, stiff flowers, wilting, bent necks, and abnormal opening, shortening the vase life. Water loss stress has become the main cause of loss of cut roses during long-distance transportation. Therefore, systematic research on the molecular mechanism of water loss stress tolerance of cut roses is of great theoretical and practical significance for understanding the opening regulation mechanism of rose flowers and solving the problem of post-harvest circulation of cut roses. Summary of the invention

[0003] The purpose of the present invention is to provide rose RhMORF8 Genes and their applications in rose resistance to abiotic stress.

[0004] The present invention provides the following technical solutions:

[0005] In the first aspect, the present invention provides rose RhMORF8 A gene, the nucleotide sequence of which is shown as SEQ ID NO.1; and the amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO.2.

[0006] In a second aspect, the present invention provides an expression vector comprising the rose RhMORF8 Gene.

[0007] In the third aspect, the present invention provides the rose RhMORF8 Application of the gene or the above expression vector in regulating plant stress resistance.

[0008] Preferably, the plant is rose.

[0009] Preferably, the stress is water depletion stress.

[0010] In a fourth aspect, the present invention provides the rose RhMORF8 Application of the gene or the above expression vector in breeding new rose varieties resistant to water loss.

[0011] In a fifth aspect, the present invention provides a method for cultivating a new rose variety resistant to water loss, wherein the rose is overexpressed in the rose. RhMORF8 Gene.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] The present invention separates rose from rose RhMORF8 Gene, and found that it is beneficial for rose to resist water loss stress, and verified by silencing VIGS in rose petals RhMORF8 The function of participating in the rose's response to water depletion stress provides a theoretical basis for breeding rose varieties resistant to water depletion. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the phylogenetic tree analysis of MORF in roses and other species. The phylogenetic tree analysis map was produced using MEGA7. Rose RhMORF8 is marked with a red star. The bootstrap value indicates the degree of dispersion of each branch, and the ruler indicates the branch length;

[0015] Figure 2 The amino acid homology comparison of MORF8 in rose RhMORF8 and other species;

[0016] Figure 3 for RhMORF8 gene Analysis of promoter cis-acting elements;

[0017] Figure 4 For dehydration treatment samples RhMORF8 Expression detection (Note: Values ​​are the mean ± standard deviation of 3 independent replicates, and asterisks indicate significant differences between the control and treatment (independent t-test, *P<0.05; **P<0.01));

[0018] Figure 5 Subcellular localization of RhMORF8 protein in tobacco epidermal cells (Note: co-localization of mCherry-labeled RhMORF8 and GFP-labeled mitochondrial genes, scale bar = 20 μm);

[0019] Figure 6 For different varieties of rose petals disc RhMORF8 VIGS silencing phenotype of genes and recovery rate of petal disc area (Note: (A) Rose petal discs were dehydrated and then rehydrated, and the phenotypes were recorded by taking photos at 24h of dehydration, 6h, 12h, and 24h of rehydration; (B)-(D) The recovery rate of petal disc area of ​​'Gaoyuanhong', 'Carola' and 'Freedom' at 24h of dehydration, 6h, 12h, and 24h of rehydration, the values ​​are the mean ± standard deviation of 3 independent replicates, asterisks indicate significant differences in independent tests, * P < 0.05, ** P < 0.01; (E)-(G) RhMORF8Gene silencing efficiency detection in petal discs of three rose varieties. Expression differences were analyzed by qRT-PCR, and the values ​​are the mean ± standard deviation of three independent replicates. Asterisks indicate significant differences between the control and the treatment (independent t test, *P<0.05; **P<0.01);

[0020] Figure 7 VIGS phenotype, petal disc area recovery rate and water loss stress related indicators of 'Gaoyuanhong' rose petal disc (Note: (a) rose petal discs were dehydrated and then rehydrated, and photos were taken at different time points to record the phenotype; (b) RhMORF8 Detection of silencing efficiency in rose petal discs. Expression differences were analyzed by qRT-PCR. Values ​​are the mean ± SD of 3 independent replicates. Asterisks indicate significant differences in independent tests. * P < 0.05, ** P < 0.01, *** P < 0.001. (c) Recovery rate of petal disc area of ​​'Gaoyuanhong' after 24 h of dehydration and 3 h, 6 h, 9 h, 12 h, and 24 h of rehydration. (d)-(g) Superoxide anion (O) in 'Gaoyuanhong' petal discs after 24 h of dehydration 2- ), hydrogen peroxide (H 2 O 2 ), malondialdehyde and proline content, the values ​​are the mean ± SD of 3 independent replicates, asterisks indicate significant differences in independent tests, * P < 0.05, ** P < 0.01, *** P < 0.001). DETAILED DESCRIPTION

[0021] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0022] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0023] Example 1 Rose RhMORF8 Cloning of full-length gene cDNA

[0024] 1. Materials and Methods

[0025] 1. Plant materials

[0026] 1.1. Rose varieties 'Gaoyuanhong', 'Corolla' and 'Freedom'

[0027] Rose varieties 'Gaoyuanhong', 'Carolla' and 'Freedom' were purchased from Yunnan Flower Market. After being airlifted to Hangzhou, they were immediately placed in water and brought to the laboratory. The cut flower stems were uniformly cut to 30 cm and placed in bottles for 6 hours of equilibration. Flowers with an opening degree of level 2 were selected for subsequent experiments.

[0028] 1.2 Wild-type Nicotiana benthamiana

[0029] Wild-type Nicotiana benthamiana ( Nicotiana benthamiana ) Seeds were provided by the laboratory. After mixing the seeds with vermiculite, they were sown on the surface of moist pure peat substrate, covered with plastic wrap, and placed in an incubator at 21±1℃, 56% humidity, 40000Lux, and 16 / 8 (light / dark, h) for cultivation. When the tobacco has 3-4 true leaves, the plastic wrap was removed and the seedlings were transplanted into an 8cm black square containing a moist substrate of peat: vermiculite: perlite (1:1:1) for growth. Before the tobacco flower buds appear, they are used for transient gene expression.

[0030] 2. Extraction of Rose Genomic DNA

[0031] The rose genomic DNA extraction method referred to the instructions for use of the Plant Genomic DNA Extraction Kit (Beijing Tiangen Biochemical Technology Co., Ltd.).

[0032] 1) After taking the rose petal sample less than 200 mg, put it into a 2 mL grinding tube, add grinding beads, put it into a grinder and grind it at 60 Hz for 1 min. Repeat once and store it in an ultra-low temperature refrigerator after grinding.

[0033] 2) In a fume hood, prepare a mixture of 700 μL of buffer GP1 and 0.1% β-mercaptoethanol per sample and preheat to 65°C.

[0034] 3) Add the preheated mixture into the tube, vortex mix for 1 min, and place in a 65°C water bath for 20 min, inverting 4 times to help lysis.

[0035] 4) Add 700 μL of chloroform in a fume hood, mix thoroughly, and centrifuge at 12,000 rpm for 5 min.

[0036] 5) After transferring the upper aqueous phase to a 2 mL centrifuge tube, add 700 μL of buffer GP2, mix thoroughly and add the mixture to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, and discard the filtrate.

[0037] 6) Add 500 μL buffer GD, centrifuge at 12000 rpm for 30 seconds, discard the filtrate, and repeat once.

[0038] 7) Place the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm for 2 min, discard the filtrate, and leave it open for 5 min.

[0039] 8) Place the adsorption column CB3 in a 1.5 mL centrifuge tube, add 50 μL of elution buffer TE, let stand at room temperature for 5 min, centrifuge at 12000 rpm for 2 min, repeat once, combine the two filtrates and store in an ultra-low temperature refrigerator.

[0040] 3. Total RNA extraction from rose

[0041] The extraction method referred to the instructions for use of the Polysaccharide Polyphenol / Complex Plant RNA Rapid Extraction Kit (Nanjing Borez Biotechnology Co., Ltd.).

[0042] 1) After taking the rose sample less than 200 mg, put it into a 2 mL RNase-free grinding tube, add grinding beads, put it into the grinder, grind at 60 Hz for 1 min, repeat once, and temporarily store it in an ultra-low temperature refrigerator after grinding.

[0043] 2) Preheat the lysis buffer CLB in a 65℃ water bath, then prepare a mixture of 1mL lysis buffer CLB, 2% PVP40000, and 5% β-mercaptoethanol for each sample, invert to mix and preheat. At the same time, precool the low-temperature centrifuge to 4℃, and then preheat the RNase free water in a 90℃ water bath.

[0044] 3) Add the lysis mixture to the sample tube, vortex and mix immediately for 1 minute, then place in a 65℃ water bath for 5-10 minutes, inverting and mixing twice to help lysis. Centrifuge at 13000rpm for 10 minutes.

[0045] 4) Carefully transfer the supernatant to a 1.5 mL RNase-free centrifuge tube, add half the volume of anhydrous ethanol, immediately pipette and mix, transfer to a genomic DNA cleanup column, centrifuge at 13,000 rpm for 2 min, and discard the filtrate.

[0046] 5) Place the cleanup column in a 2 mL RNase-free centrifuge tube, add 500 μL of lysis buffer RLT Plus, and centrifuge at 13,000 rpm for 30 seconds.

[0047] 6) Collect the filtrate, add 245 μL of anhydrous ethanol, immediately pipette and mix, transfer to the RNA adsorption column, centrifuge at 13000 rpm for 2 min, and discard the filtrate.

[0048] 7) Add 700 μL of deproteinized solution RW1 to the RNA adsorption column, let stand at room temperature for 1 min, centrifuge at 13000 rpm for 30 sec, and discard the filtrate.

[0049] 8) Add 500 μL of rinse solution RW to the RNA adsorption column, centrifuge at 13000 rpm for 30 seconds, discard the filtrate and repeat once.

[0050] 9) Place the adsorption column back into the collection tube, centrifuge at 13,000 rpm for 2 min, and leave the tube open for 5 min.

[0051] 10) Place the RNA adsorption column back into a 1.5 mL RNase-free centrifuge tube, add 30 μL RNase free water, let stand at room temperature for 5 min, and centrifuge at 12,000 rpm for 1 min.

[0052] 11) Collect the filtrate and add it back into the RNA adsorption column, let it stand at room temperature for 5 minutes, centrifuge it at 12000 rpm for 1 minute, and store it in an ultra-low temperature refrigerator.

[0053] 4. Synthesis of rose cDNA

[0054] cDNA synthesis method reference Evo M-MLV Instructions for use of the reverse transcription premix kit (Hunan Aikerui Bioengineering Co., Ltd.).

[0055] 1) The RNA concentration (ng / μL) was measured using a Thermo Fisher Nanodrop 2000 spectrophotometer, and the required RNA solution volume was calculated based on the total RNA concentration of 1 μg in each reverse transcription system.

[0056] 2) On ice, prepare the genomic DNA cleanup system in a 200 μL enzyme-free tube (Table 1).

[0057] Table 1 Genomic DNA removal system

[0058] Component name system gDNA cleanup reaction mixture 2μl Total RNA 1000ng Nuclease-free water Make up to 10 μl

[0059] 3) Mix the system and place it in a constant temperature metal bath heater at 42°C for 2 min.

[0060] 4) On ice, prepare the reverse transcription system in the sample tube (Table 2).

[0061] Table 2 Reverse transcription reaction system

[0062] Component name system Step 2) Reaction solution 10μl 5×RT reaction mixture 4μL Nuclease-free water Make up to 20 μl

[0063] 5) Mix the system and place it in a PCR instrument for reaction (Table 3).

[0064] Table 3 PCR reaction procedure

[0065] temperature time Number of cycles 37℃ 15min 1 85℃ 5sec 1 4℃ save /

[0066] 6) Store in a refrigerator at -20℃.

[0067] 5. Target fragment amplification and product recovery

[0068] The target fragment amplification method refers to the instructions for use of the 2×Phanta Flash Master Mix kit (Nanjing Novogene Biotech Co., Ltd.). The amplification product recovery and purification method refers to the instructions for the gel DNA recovery kit (Hangzhou Xinjing Biological Reagent Development Co., Ltd.).

[0069] 1) On ice, prepare the fragment amplification system in a 200 μL centrifuge tube (Table 4).

[0070] Table 4 Target fragment amplification system

[0071] Component name system 2×Phanta Flash Master Mix 12.5μl cDNA 20ng Forward primer RhMORF8-ORF-F (10 μm) 1μl Reverse primer Rh MORF8-ORF-R (10 μm) 1μl Deionized water Make up to 10 μl

[0072] cDNA was used as the amplification template and the primer sequences were shown in Table 5.

[0073] Table 5 RhMORF8 Primers for amplification of gene ORF fragments

[0074] Primer name Primer sequence (5'-3') Forward primer RhMORF8-ORF-F ATGGCTACCCATTTCCTCTCTCG Reverse primer RhMORF8-ORF-F TCAATAACGGTTTTGACCACCA

[0075] 2) Mix the system and place it in a PCR instrument for reaction (Table 6).

[0076] Table 6 PCR reaction program

[0077]

[0078] 3) Analyze the PCR amplification products by gel electrophoresis and recover the target bands.

[0079] 6. Bioinformatics Analysis

[0080] 1) Multiple sequence alignment

[0081] Search and download roses on the NCBI (https: / / www.ncbi.nlm.nih.gov / ) website with BLAST. Rosa chinensis )、Rice( Oryza sativa ), Arabidopsis thaliana ( Arabidopsis thaliana ),apple( Malus domestica ),pear( Pyrus bretschneideri ),Peach( Prunus persica ),tobacco( Nicotiana tabacum ),corn( Zea mays ) and plum blossom ( Prunus mume )MORF family protein sequences. The sequences to be aligned were uploaded to MEGA7.0 software for sequence alignment, and GeneDoc software was used to beautify and modify the sequence alignment results.

[0082] 2) Evolutionary tree construction

[0083] The maximum likelihood (ML) method was used, and the bootstrap method was used for verification, and the bootstrap value was set to 1000. The phylogenetic tree was visualized using MEGA7.0 software, and the iTOL website and AI software were used to beautify and modify the phylogenetic tree.

[0084] 3) Analysis of promoter cis-acting elements

[0085] Download from NCBI (https: / / www.ncbi.nlm.nih.gov / ) RhMORF8 The 3000 bp sequence upstream of the start codon ATG was used to conduct a detailed analysis of the cis-regulatory elements in its promoter region with the help of the online website PlantCARE (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ), and the cis-elements were beautified and modified using AdobePhotoshop 2022 software.

[0086] 7. Construction of sequencing vector

[0087] The vector construction method refers to the instructions for use of the pClone007 Blunt Simple Vector Kit (Beijing Qingke Biotechnology Co., Ltd.).

[0088] 1) On ice, prepare the vector construction system in a 200 μL enzyme-free tube (Table 7).

[0089] Table 7 Blunt-end vector ligation system

[0090] Component name system pClone007 Blunt Simple Vector 1μl 10×Topo mixed solution 1μl Rubber recycling products 100ng Deionized water Make up to 10 μl

[0091] 2) Mix the system and place it in a constant temperature metal bath heater at 25°C for 5 minutes.

[0092] 3) Transform the ligation product into competent E. coli DH5α.

[0093] Example 2: Subcellular localization

[0094] 1. Vector pCambia 2300- RhMORF8-mCherry Construction

[0095] To observe the localization of RhMORF8 protein in Nicotiana benthamiana epidermal cells, homologous recombination was used to construct an overexpression vector carrying mCherry. The vector pCAMBIA2300 (p2300) was double-digested with restriction enzymes Kpn1 and Sa11, and then the mCherry protein was expressed in the epidermal cells of Nicotiana benthamiana. RhMORF8Gene ORF sequence design with vector homology arm primers, rose RhMORF8 The gene ORF fragment was removed from the terminator and inserted into the linearized P2300 vector. It was transformed into E. coli DH5a, and the positive clones were obtained by sequencing and the plasmid was extracted. The p2300- RhMORF8 Obtain linearized plasmid. mCherry Gene ORF sequence design with vector homology arm primers, rose mCherry Gene ORF fragment inserted into linearized P2300- RhMORF8 After transformation into E. coli DH5a, p2300- RhMORF8-mCherry Plasmid. The above p2300- RhMORF8-mCherry The construction process of the vector adopts the existing method, and the amplification primer sequences are shown in Table 8.

[0096] Table 8 Primers used for construction of subcellular localization vector

[0097] Primer name Primer sequences P2300--F 5'-AGCTTTCGCGAGCTCGGTACCATGGCTACCCATTTCCTCTCTCG-3' P2300--R 5'-CTTGCATGCCTGCAGGTCGACATAACGGTTTTGACCACCACCA-3' P2300--F 5'-GGTCAAAACCGTTATGTCGACATGGTGAGCAAGGGCGAGG-3' P2300--R 5'-CTTGCATGCCTGCAGGTCGACTTACTTGTACAGCTCGTCCATGCC-3'

[0098] The expression vector was constructed by homologous recombination. Trelief SoSoo CloningKit Recombination Cloning Kit (Beijing Qingke Biotechnology Co., Ltd.) product instructions. The vector double enzyme digestion method refers to the restriction enzyme QuickCut Kit (Bao Ri Yi Biotechnology (Beijing) Co., Ltd.) instruction manual.

[0099] 1) On ice, prepare the vector double enzyme digestion system in a 200 μL centrifuge tube (Table 9).

[0100] Table 9 Double enzyme digestion system

[0101] Component name system 10× Fast Dicer Buffer 5μl DNA 1 μg Fast Dicer A 1μl Fast-digesting enzyme B 1μl Deionized water Make up to 50 μl

[0102] 2) Mix the system and place it in a constant temperature metal bath heater at 37°C for 30 min.

[0103] 3) After agarose gel electrophoresis, compare the fragment sizes, cut out the correct bands, and perform gel recovery.

[0104] 4) On ice, prepare the homologous recombination system in a 200 μL centrifuge tube (Table 10).

[0105] Table 10 Homologous recombination system

[0106] Component name system 2×SoSoo Mixture 5μl Linearized vector XμL Insert YμL Deionized water Make up to 10 μl

[0107] Note: The amount of vector used is 10-100 ng. The molar ratio of vector X to insert fragment Y solution is 1:2-1:10.

[0108] 5) Mix the system and place it in a constant temperature metal bath heater at 50°C for 15 minutes.

[0109] 6) The ligation product was transformed into E. coli DH5α competent cells and the positive clones were obtained by sequencing.

[0110] 2. Subcellular localization

[0111] (1) The successfully built p2300- RhMORF8-mCherry , as well as the silencing suppressor P19 and the mitochondrial marker gene MT-GFP, were transformed into Agrobacterium GV3101. Single clones were picked for PCR detection, and positive clones were cultured in 10 mL of liquid LB medium (50 mg / L Kan, 25 mg / L Rif) in a 50 mL Erlenmeyer flask at 28°C for 12-16 h, with OD600 between 0.8-1.0;

[0112] (2) Calculate the amount of bacteria collected so that the final OD 600 The amount of each bacterial solution in each combination was calculated based on a final volume of 10 mL. The three bacterial solutions of each group, P19, MT-GFP and pCambia 2300- RhMORF8 - mCherry The volume was 1:1:1, and the bacteria were collected by centrifugation in a 50 mL centrifuge tube at 5000 rpm for 8 min;

[0113] (3) Suspend the bacteria in 10 mL of infection solution (10 mmol / L MES, 200 mmol / L acetosyringone, 10 mmol / L MgCl2, pH = 5.6), mix well, and let stand in the dark for 2-3 h;

[0114] (4) Select healthy tobacco plants and inject the infection solution on the back of the tobacco plants using a 1 mL syringe. Place the injected tobacco plants in a cardboard box covered with wet newspapers and then cover with wet newspapers. After culturing in a dark environment for 36-48 hours, observe the fluorescence signal under a confocal fluorescence microscope.

[0115] 3. Fluorescence quantification

[0116] Real-time quantitative PCR was used to detect the expression of genes, and the internal reference gene RhUBI2 As a reference for the expression level under abiotic stress, the cDNA obtained by reverse transcription was diluted 3 times and subjected to fluorescent quantitative PCR reaction. The PCR amplification program is as follows, see Table 11.

[0117] Table 11 Real-time fluorescence quantitative PCR amplification program

[0118]

[0119] The cDNA samples and the samples to be tested were set up with 3 technical replicates. -△△ct The data were summarized and analyzed using SPSS 22.0.

[0120] Example 3: Virus induced genesilencing (VIGS) in rose petal discs

[0121] The pTRV2 silencing vector was constructed by homologous recombination. The silencing fragment was designed through the website SGN-VIGS. The non-conservative sequence was selected. The silencing fragment was 366 bp (sequence shown in SEQ ID NO.3) and was located at RhMORF8 The pTRV2 vector is composed of the enzyme Bam HI and Eco After double digestion with RI, RhMORF8 The gene silencing fragment was inserted into the linearized pTRV2 silencing vector.

[0122] TRV2- RhMORF8 The sequences of the amplification primers used for vector construction are shown in Table 12.

[0123] Table 12 TRV2- RhMORF8 Amplification primers used in vector construction

[0124] Primer name Primer sequences TRV2--F 5'-GTGAGTAAGGTTACCGAATTCGACCTCCTAGCAACATGAGTCCA-3' TRV2--R 5'-CGTGAGCTCGGTACCGGATCCTATCTCTCTCTGGTGTGTAGGTATTTTG-3'

[0125] After transformation into Escherichia coli DH5α, positive clones were identified and the plasmids were transformed into Agrobacterium GV3101.

[0126] (1) Place the pTRV2- RhMORF8 Activate the Agrobacterium by streaking on solid LB plates (50 mg / L Kan, 25 mg / LRif). Take a single clone and streak it on a new solid LB medium (50 mg / L Kan, 25 mg / LRif) for a second culture. Pick up the colony with a pipette tip and culture it with 10 mL of liquid LB medium (50 mg / L Kan, 25 mg / L Rif) at 28°C, 200 rpm for 12-16 h;

[0127] (2) Use a 500 mL Erlenmeyer flask to dilute the 10 mL bacterial solution at a ratio of 1:50 into 250 mL of fresh liquid LB medium (50 mg / L Kan, 25 mg / L Rif, 10 mM MES and 20 mM acetosyringone) and shake the culture a second time at 28°C for 14-16 h until OD600≈1.5-2.0;

[0128] (3) Calculate the amount of collected bacteria so that the final OD600 is 1.0. Calculate the amount of each bacterial solution in each combination based on the final volume of 400 mL of infection solution. Use a 50 mL centrifuge tube to collect the bacteria at 5000 rpm for 8 min. The two bacterial solutions of each group, pTRV1 and pTRV2 or pTRV2- RhMORF8 The volume is 1:1;

[0129] (4) Each combination was suspended and mixed with 400 mL of infection solution (10 mM / L MES, 20 mM / L acetosyringone, 10 mM / LMgCl2, pH=5.6) and then allowed to stand in the dark for 3 h;

[0130] (5) Place the beaten petal disc in the invading dye solution and pump it in a vacuum pressure pump. When the vacuum pump pressure reaches -25 kPa, let it stand for 1 min, then slowly re-pressurize it, and repeat twice.

[0131] (6) After infection, rinse the infected petal discs with deionized water 6-8 times. Place different biological replicates on moistened filter paper in different culture dishes and keep them in a dark environment at 4°C for 3 days, and then equilibrate them in an incubator (21°C, 12000LUX constant light, 16 / 8 h photoperiod conditions) for 1 day;

[0132] (7) The incubator was set to a temperature of 21°C, a relative humidity of 40-60%, and a constant light intensity of 10,000 LUX. The petal discs were wiped dry with filter paper and then dehydrated for 24 hours. After dehydration, samples were taken to test the silencing efficiency.

[0133] (8) Soak the petal discs that have been dehydrated in deionized water for 24 h. After 3, 6, 9, 12, and 24 h, use filter paper to absorb the moisture from the petals. Then place the petals on the filter paper and take photos to observe the phenotypic changes and calculate the area.

[0134] 2. Results and Analysis

[0135] 1. Rose RhMORF8 Gene cloning and sequence analysis

[0136] Through sequencing and sequence alignment analysis, we obtained the cDNA library of rose leaves. RhMORF The ORF sequence of the gene was sequenced and cloned. The gene is 1194 bp in length and encodes 397 amino acids. The amino acid sequence was analyzed by MEGA7.0. The results showed that ( Figure 1 ), RhMORF8 is closely related to MORF8 of Arabidopsis, rice and other Rosaceae, and is located in the same subgroup; the amino acid sequences of MORF8 of different species were compared using GeneDoc software, and the results showed that ( Figure 2 ) There is a highly conserved MORF box domain at the N-terminus of MORF8. Search on NCBI RhMORF8 The promoter sequence 3000 bp upstream of the start codon ATG was analyzed using the PlantCARE website RhMORF8 Promoter structure, results ( Figure 3 ) This fragment contains cis-regulatory elements related to drought stress and plant hormone response.

[0137] 2. Rose RhMORF8 Gene expression characteristics and protein subcellular localization in rose petals after dehydration treatment

[0138] The cut roses were dehydrated for 3, 6, 12, and 24 hours respectively. RhMORF8 The results ( Figure 4 ) showed that its expression level was down-regulated by 41% after 6h, 45.8% after 12h, and 65.1% after 24h. RhMORF8 The expression of is downregulated in response to water depletion stress.

[0139] RhMORF8 was subcellularly localized in the epidermis of tobacco leaves. The ORF sequence of RhMOR8 was fused to the N-terminus of the mCherry reporter gene without the stop codon to obtain pCambia2300- mCherry-RhMORF8 , using Agrobacterium to transfer GFP-tagged mitochondrial localization protein tags and pCambia2300- mCherry-RhMORF8 The epidermal cells of Nicotiana benthamiana leaves were co-infected for transient expression. Figure 5 ) showed that the red fluorescence signal of RhMORF8 was distributed on the mitochondria and overlapped closely with the green fluorescence signal of the mitochondrial localization protein tag, indicating that the RhMORF8 protein was localized on the mitochondria, which was consistent with the localization results of MORF8 in other species.

[0140] 3. RhMORF8 Functional verification in rose petals under water loss stress

[0141] Transient gene silencing in petals of three different rose varieties (Gaoyuanhong, Corolla, and Liberty) using virus-mediated gene silencing RhMORF8, observed the area recovery of the petal discs after 24h of dehydration, 6h, 12h, and 24h of rehydration. The results showed that ( Figure 6 (E), (F), (G) Compared with the TRV control, the silenced samples of the three different varieties RhMORF8 The gene expression levels were significantly reduced, by about 57.02%, 52.99%, and 72.04%, respectively. After rehydration, the area recovery rate of the petal discs of the three varieties was lower in the experimental group than in the control group. Figure 6 (B) The area recovery rate of the petal discs was significantly lower than that of the control TRV 6 hours after rehydration, and the area recovery rate of the petal discs was extremely significantly lower than that of the control TRV 12 hours after rehydration; Corolla ( Figure 6 (C) The area recovery rate of the petal discs after 6h and 12h of rehydration was significantly lower than that of the control TRV. Figure 6 (D) The area recovery rate of the petal discs 6 hours after rehydration was significantly lower than that of the control TRV, and the area recovery rate of the petal discs 12 hours after rehydration was extremely significantly lower than that of the control TRV.

[0142] Further investigation of the petals of highland red RhMORF8 The cells were silenced, and phenotypic photos, area measurements, and statistics of physiological indicators related to water loss stress were taken at 24 h of water loss and 3 h, 6 h, 9 h, 12 h, and 24 h of water rehydration. The results ( Figure 7 ) showed that the area recovery rate of the petal discs of Plateau Red was significantly lower than that of the control TRV 3-24h after rehydration, and the area recovery rate of the petal discs after rehydration for 12h was extremely significantly lower than that of the control TRV; the superoxide anion (O 2 -), hydrogen peroxide (H 2 O 2 ), malondialdehyde and proline contents were significantly higher than those in the control TRV. RhMORF8 Gene silencing reduces the resistance of rose petals to water depletion stress, RhMORF8 The gene has the function of enhancing the rose petals' resistance to water loss.

Claims

1. Rose RhMORF8 The application of the gene in regulating the resistance of rose to water loss stress, the nucleotide sequence of the gene is shown as SEQ ID NO.1; the amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO.

2.

2. Rose RhMORF8 The gene is used in breeding new varieties of roses resistant to water loss stress. The nucleotide sequence of the gene is shown in SEQID NO.1; the amino acid sequence of the encoded protein is shown in SEQID NO.

2.

3. A method for cultivating a new rose variety resistant to water loss, characterized in that: Super expression of rose in rose RhMORF8 A gene, the nucleotide sequence of which is shown as SEQ ID NO.1; and the amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO.2.

Images