Cloning and application of a SNP molecular marker associated with yak immunoglobulin M

Abstract

The present invention belongs to the field of molecular biological detection technology, and in particular, relates to the cloning of a SNP molecular marker related to yak immune traits and its application. The present invention obtains through screening that the SNP molecular marker related to yak immune traits is located at the 35789017th base on chromosome 28 of the yak reference genome LU_Bosgru_v3.0, and the mutant base is C or T. The molecular marker can determine the immunoglobulin M content of individual yaks. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes, and provides a basis for breeding yaks with high immunity.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological detection, and in particular relates to the cloning and application of a SNP molecular marker associated with yak immunoglobulin M. Background Art

[0002] Yaks are one of the important livestock in the plateau area and an important production resource for herders in the plateau pastoral areas. Yaks have unique biological characteristics, including strong disease resistance, good meat quality, and excellent fur, but diseases pose a serious threat to the health of yaks and cause significant economic losses. Although some diseases can be prevented by improving feeding management and using drugs, vaccines and other measures, these measures have not been able to effectively control the spread of infectious diseases. At the same time, the widespread use of drugs may lead to the development of drug resistance, which in turn affects the safety of livestock products. Improving disease resistance in yak breeding is a key link in fundamentally solving these problems.

[0003] Immunoglobulins are a group of proteins with antibody activity, which are mainly found in plasma, and are also found in other body fluids, tissues and some secretions. Immunoglobulins are divided into five categories, namely immunoglobulin G (IgG), immunoglobulin A (IgA), immunoglobulin M (IgM), immunoglobulin D (IgD) and immunoglobulin E (IgE). Among them, IgM is the one with the largest molecular weight among the five types of immunoglobulins. Its molecular weight is 9×10 5 Dalton, so it is also called macroglobulin. Increased IgM is common in macroglobulinemia, bacterial and parasitic infectious diseases, liver disease, rheumatoid arthritis and cystic fibrosis, etc. Decreased IgM is common in primary agammaglobulinemia, non-IgA and IgG multiple myeloma, Hodgkin's disease, chronic lymphocytic leukemia, protein-losing gastrointestinal disease, etc.

[0004] IgM is also the earliest antibody to appear in the primary humoral immune response and is the "vanguard" of the body's anti-infection. The detection of IgM in serum indicates a recent infection and can be used for early diagnosis of infection. Membrane surface IgM is the main component of the B cell antigen receptor. Only expressing mIgM is a sign of immature B cells. Therefore, IgM can be used as an immune indicator to evaluate the disease resistance and health status of yaks. By monitoring the changes in the immune indicator IgM, it is possible to detect yaks' immune problems in a timely manner and take corresponding measures to improve yaks' disease resistance, prevent and treat diseases.

[0005] With the development of DNA molecular marker technology, it has become possible to study the genetic basis of yaks' disease resistance. Screening out molecular markers related to yaks' disease resistance will help promote disease-resistant breeding. At present, disease-resistant breeding can not only improve yaks' resistance to pathogens, but also reduce the use of drugs and ensure the safety of livestock products. By selecting disease-resistant genes at the molecular level and accurately screening yaks at an early stage, the efficiency of yak disease-resistant breeding will be greatly improved, which has significant economic benefits and research and application value. Summary of the invention

[0006] The purpose of the present invention is to provide SNP molecular markers related to yak immune traits and applications thereof.

[0007] In order to achieve the above object, the present invention proposes the following technical solutions:

[0008] The invention provides a SNP molecular marker associated with yak immunoglobulin M. The SNP molecular marker is located at the 35789017th base on chromosome 28 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

[0009] Preferably, the genotype of the yak with the mutant base C is CC or CT; the genotype of the yak with the mutant base T is TT; the immunoglobulin M content in the yak individual with the genotype CC is higher than the immunoglobulin M content in the yak individual with the genotype TT or CT.

[0010] The present invention also provides the use of the SNP molecular marker in preparing products for detecting yak immunity or yak assisted breeding products.

[0011] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the sequence of the primer pair is shown in SEQ ID NO: 1-2.

[0012] The present invention also provides the use of the primer pair in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0013] The present invention also provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0014] The present invention also provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0015] The present invention also provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0016] (1) Extracting yak genomic DNA;

[0017] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0018] (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immune indicators include immunoglobulin M.

[0019] Preferably, the amplification system in step (2) is 25 μL in total, including: 12.5 μL 2×L-Exp Taq Master Mix, 8.5 μL RNase free water, 1 μL upstream primer, 1 μL downstream primer, and 2 μL template;

[0020] Preferably, the amplification program in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The present invention provides the cloning and application of SNP molecular markers associated with yak immunoglobulin M. Through the research of the present invention, it is found that the SNP site associated with yak immunity is located at the 35789017th base on chromosome 28 of the yak reference genome LU_Bosgru_v3.0 version, the variation type is C / T, and there are 3 genotypes. When the 35789017th base on chromosome 28 is C, the genotype is CC or CT: when the 35789017th base on chromosome 28 is T, the genotype is TT; through the association analysis of different genotypes with immunoglobulin M content, it is found that the immunoglobulin M of yak individuals with CC genotype is significantly higher than that of individuals with TT and CT genotypes (p<0.05), and the immunoglobulin between individuals with TT and CT genotypes does not show significant differences (p>0.05).

[0023] The present invention can determine the immunoglobulin M content of individual yaks by detecting the base at the 35789017th nucleotide site on chromosome 28 of the yak. ​​The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes and provides a basis for breeding yaks with high immunity. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0025] Figure 1 It is the PCR amplification product: M represents Marker; 1, 2, and 3 represent 3 groups of repetitions.

[0026] Figure 2 The peak diagram and sequence obtained after sequencing the PCR product. DETAILED DESCRIPTION

[0027] The invention provides a SNP molecular marker associated with yak immunoglobulin M. The SNP molecular marker is located at the 35789017th base on chromosome 28 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

[0028] In the present invention, the genotype of the yak with the mutant base C is CC or CT; the genotype of the yak with the mutant base T is TT; the content of immunoglobulin in the yak individual with the genotype CC is higher than the content of immunoglobulin M in the yak individual with the genotype TT or CT.

[0029] The present invention also provides the use of the SNP molecular marker in preparing products for detecting yak immunity or yak assisted breeding products.

[0030] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the sequence of the primer pair is shown in SEQ ID NO: 1-2.

[0031] Among them, SEQ ID NO: 1 is an upstream primer, and its sequence is:

[0032] 5'-ATTAACTCAGACAGAGGCCCCA-3';

[0033] SEQ ID NO: 2 is a downstream primer, and its sequence is:

[0034] 5'-CATCGAGAAACAGGCAACGAC-3'.

[0035] The present invention also provides the use of the primer pair in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0036] The present invention also provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0037] The present invention also provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0038] The present invention also provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0039] (1) Extracting yak genomic DNA;

[0040] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0041] (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immune indicators include immunoglobulin M.

[0042] In the present invention, the amplification system described in step (2) is 25 μL in total, including: 2×L-Exp TaqMasterMix 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, template 2 μL;

[0043] In the present invention, the amplification program described in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0044] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0045] Example 1

[0046] 1. Sample collection

[0047] The present invention uses the Niangya yak breed as the detection object, collects 5 mL of blood samples from 191 fasting yaks from a ranch in Jiali County, Nagqu City, Tibet Autonomous Region, and puts them in a clean pro-coagulant vacuum blood collection tube, leaves them to stand for 30 minutes, and then centrifuges them at 3500 r / min for 10 minutes, draws the supernatant into a PE tube, seals it, and stores it in a -20°C low-temperature refrigerator; another 5 mL of blood sample is collected in a blood collection tube added with an EDTA-K2 anticoagulant, quickly mixes the blood samples after collection, temporarily stores them in a sampling box containing an ice pack, and transports them back to the laboratory and stores them in a -20°C refrigerator for genomic DNA extraction.

[0048] 2 Main reagents and instruments

[0049] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genomic DNA extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop 2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebold Technology Co., Ltd.; 2×L-Exp Taq MasterMix (dye plus) was purchased from Hunan Aikerui Bioengineering Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. IgA (MB-4907A), IgG (MB-4616A), and IgM (MB-4908A) detection kits were purchased from Jiangsu Enzyme Biotechnology Co., Ltd.

[0050] 3 Methods

[0051] 3.1 Immunoglobulin IgA, IgG, and IgM detection

[0052] According to the IgA, IgG, and IgM detection kits of Jiangsu Enzyme Biotechnology Co., Ltd., the double antibody one-step sandwich method was used for determination. First, the required strips were taken out from the aluminum foil bag after equilibration at room temperature for 20 minutes, and the remaining strips were sealed with a self-sealing bag and returned to 4°C. Set up standard wells and sample wells, and add 50μL of different concentrations of standard wells to each standard well; first add 10μL of the sample to be tested to the sample well, and then add 40μL of sample diluent; blank wells are not added. In addition to the blank wells, 100μL of horseradish peroxidase (HRP)-labeled detection antibody is added to each well of the standard well and sample well, and the reaction wells are sealed with a sealing film, and incubated at 37°C water bath or constant temperature box for 60min. Discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let stand for 1min, shake off the washing solution, pat dry on absorbent paper, and repeat the washing 5 times (you can also use a plate washer to wash the plate). Add 50μL of substrate A and B to each well and incubate at 37°C in the dark for 15min. Add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 minutes. Finally, draw a standard curve: in an Excel worksheet, use the concentration of the standard as the horizontal axis and the corresponding OD value as the vertical axis to draw a linear regression curve of the standard, and calculate the IgA, IgG, and IgM concentration values ​​of each sample according to the curve equation.

[0053] 3.2 Extraction of genomic DNA from blood

[0054] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was >20ng / μL and OD 260 / OD 280A value between 1.7 and 1.9 meets the experimental requirements and can be stored at -20°C for future use.

[0055] 3.3 Primer design

[0056] With reference to the gene sequence of chromosome 28 of the yak genome LU_Bosgru_v3.0 version (Ensemble accession number: ENSBGRG00000010271), the Pick Primers online tool provided by the NCBI website was used to design specific primers, including the g35789017C>T SNP site.

[0057] Primer sequences

[0058] F: 5'-ATTAACTCAGACAGAGGCCCCA-3' (SEQ ID NO: 1);

[0059] R: 5'-CATCGAGAAACAGGCAACGAC-3' (SEQ ID NO: 2).

[0060] The length of the amplified fragment was 551 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0061] 3.4 PCR amplification and sequencing

[0062] PCR amplification system 25μL: 2×L-Exp Taq Master Mix (dye plus) 12.5μL, RNase free water 8.5μL, upstream primer 1μL, downstream primer 1μL, template 2μL.

[0063] PCR amplification program: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 2 min.

[0064] The PCR products were tested by 1% agarose gel electrophoresis. After the PCR products passed the agarose gel electrophoresis test, they were sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. Figure 1 shown. Figure 1It shows that the length of the sequence obtained by PCR amplification is 551bp. After sequencing, it is found that the nucleotide sequence at position 381 of the amplified product (base 35789017 on chromosome 28 of the genome LU_Bosgru_v3.0 version) has a C / T mutation. The amplified product band is clear without any mixed bands and has good specificity. The site was preliminarily identified as the SNP marker site of yak and named g35789017C>T SNP. The sequence obtained by PCR amplification is shown in SEQ ID NO:3, and the 381st position of the sequence is a C mutation. The fragment size of the PCR amplified product meets the expected size, and the next step of the experiment can be carried out.

[0065] SEQ ID NO:3

[0066] ATTAACTCAGACAGAGGCCCCAAGAGACAGAAACTAAATCAGTCAGATTTCTTGGCCTCATCTGAAGGCTTGTTGTTGCTTAGTTGCTCAGTCGTGTCCAACTCTTTGCGACCCCATGGACTGTTGCCTGCCAGGCTCCTCTGTCCATGGGATTTCCCAAGCAAGAATACTAGAGTGGGTTGCCATTTC CTTCTCCACATCTTCCTGACCAGGGATCGAATTCACACCTCCTGCATTGGCAGGCAGATTCTTTACGATCTGAGCCACCAGGGAAGCCCCCATCTGAAGGCTGGGCTAATATATAATCTCTAAAGCATTATAATTAAGAAGCATTATCCACATTTTCTTCAACATGATCTGTGACTTTCTTAAGCATGAGT C CACGCTGAATGCCAGGCCGCTCTACCCTACCTGGTCTCGCGAGGCGGATGAGAGATGTACACATCATGGCAGTCCCTTTCCTGCGGGATGATGAGCTGTAAGAGCTGAAAGTTCTTGCAGCGAATCAGTAGAGGGCACCCGGTAGCCGTCGTTGCCTGTTTCTCGATG

[0067] The biological analysis software MEGA 11.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0068] 4 Statistical analysis

[0069] According to the genotyping results, the number of individuals with different genotypes at each locus was counted. The Popgen32 software was used to calculate the gene frequency, genotype frequency, effective number of alleles (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test of the g35789017C>T gene, and the polymorphism information content (PIC) was calculated using the PIC (polymorphism information content) calculation software. The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and immunoglobulins IgA, IgG, and IgM, and the results were expressed as "mean ± standard error".

[0070] 5 Results

[0071] 5.1 PCR Amplification and Sequencing Results

[0072] The amplification products of the g35789017C>T SNP locus on chromosome 28 of yaks were detected using 1% agarose gel (see Figure 1 ). The bands were clear without杂带 (unclear in the original Chinese, assuming it means non-specific bands), with good specificity. The size of the PCR product fragment was 551 bp, which was consistent with the expected size, and the next experiment could be carried out.

[0073] The peak map and sequence obtained after purifying and sequencing the PCR products are shown in Figure 2 . As can be seen from Figure 2 , a C-T mutation occurred at the g35789017C>T SNP locus, and there were three genotypes: CC, CT, and TT.

[0074] 5.2 Statistical Analysis Results

[0075] The genotypes and allele frequencies of the g35789017C>T SNP locus on chromosome 28 of yaks were analyzed from the perspective of population genetics. As shown in Table 1, at the g35789017C>T SNP locus, the CC genotype frequency was the highest, being the dominant genotype, and the C allele frequency was 64.4%, showing as the dominant allele. The χ 2 adaptive test showed that the SNP locus significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.459, and the PIC was 0.353. Since 0.25<PIC<0.50, it belonged to moderate polymorphism.

[0076] Table 1 Polymorphism of the g35789017C>T SNP Locus on Chromosome 28 of Yaks

[0077]

[0078] 5.3 Association Analysis between Different Genotypes and Immunoglobulins IgA, IgG, and IgM

[0079] The general linear model in IBM SPSS Statistics26 software was used to analyze the correlation between different genotypes of yaks and the content of immunoglobulins IgA, IgG, and IgM. The results showed that the immunoglobulin IgM of yak individuals with CC genotype was significantly higher than that of individuals with TT and CT genotypes (p<0.05), and there was no significant difference in immunoglobulin IgM between individuals with TT and CT genotypes (p>0.05), indicating that the base of the g35789017C>T site on chromosome 28 of yaks was significantly correlated with yak IgM (p<0.05) and was a SNP marker related to yaks. The results are shown in Table 2.

[0080] Table 2 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0081]

[0082]

[0083] Note: Different lowercase letters between data in the same row indicate significant differences (P<0.05).

[0084] The results are shown in Table 2. The IgM content of yak individuals with CC genotype was significantly higher than that of individuals with TT and CT genotypes (p<0.05), and there was no significant difference in IgM between individuals with TT and CT genotypes (p>0.05), indicating that the base of the g35789017C>T SNP site on chromosome 28 of yak is significantly correlated with yak IgM (p<0.05), and is a SNP marker related to yak IgM.

[0085] The SNP molecular marker described in the present invention is located at the 35789017th base on chromosome 28 of the reference yak genome LU_Bosgru_v3.0 version; the variation type is C / T, named g35789017C>T, and there are three genotypes. When the 35789017th base on chromosome 28 is C, the genotype is CC or CT; when the 35789017th base on chromosome 28 is T, the genotype is TT; the present invention found through the association analysis of different genotypes with IgA, IgG, and IgM contents that the IgM of yak individuals with the CC genotype was significantly higher than that of individuals with TT and CT genotypes (p<0.05), and there was no significant difference in IgM between individuals with TT and CT genotypes (p>0.05). The present invention can determine the IgM content of individual yaks by detecting the base at the 35789017th nucleotide site on chromosome 28 of yaks. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes.

[0086] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting SNP molecular markers in the preparation of an in vitro detection reagent for immune traits of Niangya yak or a detection reagent for immune traits of Niangya yak in assisted breeding, characterized in that: The SNP molecular marker is located at the 35789017th base on chromosome 28 of the Niangya yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T; Among them, the content of immunoglobulin M in Niangya yak individuals with genotype CC is higher than the content of immunoglobulin M in Niangya yak individuals with genotype TT or CT; the immune trait refers to the content of immunoglobulin M.

2. The use according to claim 1, characterized in that: The reagent for detecting the SNP molecular marker is a primer pair, and the primer pair is shown in SEQ ID NO.1~2.

3. A method for marker-assisted selection of immune traits of Niangya yaks for non-diagnostic purposes, characterized in that: The steps include: (1) Extraction of Niangya yak genomic DNA; (2) using the Niangya yak genomic DNA obtained in step (1) as a template, and using the primer pair shown in SEQ ID NO.1-2 to amplify to obtain an amplified product; (3) performing genotyping analysis on the amplified products to obtain Niangya yaks with different genotypes; correlating the genotypes of the Niangya yaks with immune indicators; the immune indicators refer to the content of immunoglobulin M; The primer pair is used to amplify the SNP molecular marker, which is located at the 381st base as shown in SEQ ID No.3, and the mutant base is C or T; wherein the immunoglobulin M content in Niangya yak individuals with a genotype of CC is higher than the immunoglobulin M content in Niangya yak individuals with a genotype of TT or CT.

4. The method according to claim 3, characterized in that The amplification system described in step (2) is 25 μL in total, including: 2× L-Exp Taq Master Mix 12.5μL, RNase free water 8.5μL, upstream primer 1μL, downstream primer 1μL, template 2μL.

5. The method according to claim 3, characterized in that: The amplification program in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

Images