Molecular marker for identifying sperm motility of boar and application of molecular marker

Abstract

The invention discloses a molecular marker for identifying sperm motility of boars and application of the molecular marker. The molecular marker is a molecular marker A as shown in SEQ ID NO: 1 and / or a molecular marker B as shown in SEQ ID NO: 4. Experiments prove that the SNP1 site is the 183rd nucleotide from the 5'tail end of SEQ ID NO: 1 in the boar genome, the SNP2 site is the 491st nucleotide from the 5 'tail end of SEQ ID NO: 1 in the boar genome, the SNP3 site is the 285th nucleotide from the 5' tail end of SEQ ID NO: 4 in the boar genome, and the sperm motility traits of the boar can be identified by detecting the genotypes of the to-be-detected boar based on the SNP1 site, the SNP2 site and / or the SNP3 site. The method has an important application value.

Description

Technical Field

[0001] The invention belongs to molecular genetic biology, and in particular relates to a molecular marker for identifying boar sperm motility and an application thereof. Background Art

[0002] Boars are one of the most important factors in the pig industry. The quality of boar semen directly affects the economic benefits of the pig farm. The selection of boar semen traits has an important economic impact on the pig production system. The more semen each boar produces and the higher the semen quality, the more the boar cost will be distributed to sows, and the lower the cost of using excellent boars. With the gradual expansion of the scale of boar stations, the phenomenon of unqualified boar semen quality (such as low ejaculation volume, low density, high deformity rate, dead sperm, etc.) is also common, which seriously affects the sow's conception rate, litter size and the efficiency of boar use. Therefore, improving boar semen quality has become a key issue that needs to be solved in pig production. The survey results of boar stations in Canada, Denmark, the Netherlands, Norway and the United States show that boars eliminated due to semen quality account for 10%-30% of the total number of eliminated boars. The survey results of some boar stations in my country on the reasons for boar elimination show that the proportion of boar elimination due to unqualified semen quality is about 28%.

[0003] Single nucleotide polymorphism (SNP) mainly refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genomic level. Some SNPs have been reported to be significantly correlated with boar sperm motility and sperm abnormality rate. By mining SNPs sites related to boar sperm motility and conducting functional analysis, potential causal mutations affecting boar sperm motility can be screened, and early selection of boar semen quality traits can be performed through molecular marker-assisted selection. In addition, since semen quality traits are low-heritability traits, molecular marker-assisted selection through SNPs can further improve the accuracy of selection. Therefore, identifying key SNPs sites that affect pig sperm motility is of great significance and great economic value for the selection and breeding of boar semen quality traits. Summary of the invention

[0004] The purpose of the present invention is to identify or assist in identifying the motility of boar sperm, and the motility of sperm can be the motility of fresh sperm.

[0005] The present invention firstly protects a method for identifying or assisting in identifying the motility of boar sperm.

[0006] The method for identifying or assisting in identifying boar sperm motility protected by the present invention may specifically be method A1), which may include the following steps: detecting whether the genotype of the boar to be tested based on the SNP1 site is AA homozygous, AC heterozygous or CC homozygous, and then making the following judgment: the sperm motility of the boar whose genotype based on the SNP1 site is AA homozygous or AC heterozygous> the sperm motility of the boar whose genotype based on the SNP1 site is CC homozygous; the SNP1 site is specifically the nucleotide at position 183 from the 5' end of SEQID NO: 1 in the boar genome.

[0007] The method for identifying or assisting in identifying boar sperm motility protected by the present invention may specifically be method A2), which may include the following steps: detecting whether the genotype of the boar to be tested based on the SNP2 site is CC homozygous, CT heterozygous or TT homozygous, and then making the following judgment: the sperm motility of the boar whose genotype based on the SNP2 site is CC homozygous or CT heterozygous>the sperm motility of the boar whose genotype based on the SNP2 site is TT homozygous; the SNP2 site is specifically the 491st nucleotide from the 5' end of SEQID NO: 1 in the boar genome.

[0008] The method for identifying or assisting in identifying boar sperm motility protected by the present invention may specifically be method A3), which may include the following steps: detecting whether the genotype of the boar to be tested based on the SNP3 site is GG homozygous, GA heterozygous or AA homozygous, and then making the following judgment: the sperm motility of the boar whose genotype based on the SNP3 site is GG homozygous or GA heterozygous>the sperm motility of the boar whose genotype based on the SNP3 site is AA homozygous; the SNP3 site is specifically the nucleotide at position 285 from the 5' end of SEQID NO: 4 in the boar genome.

[0009] The method for identifying or assisting in identifying boar sperm motility protected by the present invention may specifically be method B1), which may include the following steps: B1-1) Using the genomic DNA of the boar to be tested as a template, PCR amplification is performed using a primer pair consisting of an upstream primer 1F and a downstream primer 1R to obtain a PCR amplification product 1; the PCR amplification product 1 is sequenced, and then the following judgment is performed: if the 183rd position of the PCR amplification product 1 is only A, the genotype of the boar to be tested based on the SNP1 site is AA homozygous; if the 183rd position of the PCR amplification product 1 is A and C, the genotype of the boar to be tested based on the SNP1 site is AC heterozygous; if the 183rd position of the PCR amplification product 1 is only C, the genotype of the boar to be tested based on the SNP1 site is CC homozygous; B1-2) Based on the result of B1-1), the following judgment is made: the sperm motility of the boar whose genotype at the SNP1 locus is AA homozygous or AC heterozygous is greater than the sperm motility of the boar whose genotype at the SNP1 locus is CC homozygous.

[0010] In the above method, the SNP1 site is specifically the 183rd nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome.

[0011] In the above method, the upstream primer 1F is specifically a single-stranded DNA molecule shown in SEQ ID NO:2.

[0012] In the above method, the downstream primer 1R is specifically a single-stranded DNA molecule shown in SEQ ID NO:3.

[0013] The method for identifying or assisting in identifying boar sperm motility protected by the present invention may specifically be method B2), which may include the following steps: B2-1) Using the genomic DNA of the boar to be tested as a template, PCR amplification is performed using a primer pair consisting of an upstream primer 1F and a downstream primer 1R to obtain a PCR amplification product 1; the PCR amplification product 1 is sequenced, and then the following judgment is performed: if the 491st position of the PCR amplification product 1 is only C, the genotype of the boar to be tested based on the SNP2 site is CC homozygous; if the 491st position of the PCR amplification product 1 is C and T, the genotype of the boar to be tested based on the SNP2 site is CT heterozygous; if the 491st position of the PCR amplification product 1 is only T, the genotype of the boar to be tested based on the SNP2 site is TT homozygous; B2-2) Based on the result of B2-1), the following judgment is made: the sperm motility of the boar whose genotype at the SNP2 locus is CC homozygous or CT heterozygous is greater than the sperm motility of the boar whose genotype at the SNP2 locus is TT homozygous.

[0014] In the above method, the SNP2 site is specifically the 491st nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome.

[0015] In the above method, the upstream primer 1F is specifically a single-stranded DNA molecule shown in SEQ ID NO:2.

[0016] In the above method, the downstream primer 1R is specifically a single-stranded DNA molecule shown in SEQ ID NO:3.

[0017] The method for identifying or assisting in identifying boar sperm motility protected by the present invention may specifically be method B3), which may include the following steps: B3-1) Using the genomic DNA of the boar to be tested as a template, PCR amplification is performed using a primer pair consisting of an upstream primer 2F and a downstream primer 2R to obtain a PCR amplification product 2; the PCR amplification product 2 is sequenced, and then the following judgment is performed: if the 285th position of the PCR amplification product 2 is only G, the genotype of the boar to be tested based on the SNP3 site is a GG homozygous type; if the 285th position of the PCR amplification product 2 is G and A, the genotype of the boar to be tested based on the SNP3 site is a GA heterozygous type; if the 285th position of the PCR amplification product 2 is only A, the genotype of the boar to be tested based on the SNP3 site is an AA homozygous type; B3-2) Based on the result of B3-1), the following judgment is made: the sperm motility of the boar whose genotype at the SNP3 locus is GG homozygous or GA heterozygous is greater than the sperm motility of the boar whose genotype at the SNP3 locus is AA homozygous.

[0018] In the above method, the SNP3 site is specifically the nucleotide at position 285 from the 5' end of SEQ ID NO: 4 in the boar genome.

[0019] In the above method, the upstream primer 2F is specifically a single-stranded DNA molecule shown in SEQ ID NO:5.

[0020] In the above method, the downstream primer 2R is specifically a single-stranded DNA molecule shown in SEQ ID NO:6.

[0021] In any of the above methods, the sperm motility may be the ratio of the number of progressively moving sperm to the total number of sperm. The number of progressively moving sperm and the total number of sperm may be measured by placing the sperm on a microscope stage connected to a computer-assisted sperm analysis (CASA) system.

[0022] The present invention also protects a kit for identifying boar sperm motility, which may include a substance for detecting the genotype of the boar to be tested based on the SNP1 site, a substance for detecting the genotype of the boar to be tested based on the SNP2 site, and / or a substance for detecting the genotype of the boar to be tested based on the SNP3 site; The SNP1 site is the 183rd nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome; The SNP2 site is the 491st nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome; The SNP2 site is the 285th nucleotide from the 5' end of SEQ ID NO: 4 in the boar genome.

[0023] The kit may specifically consist of a substance for detecting the genotype of the boar to be tested based on the SNP1 site, a substance for detecting the genotype of the boar to be tested based on the SNP2 site, and / or a substance for detecting the genotype of the boar to be tested based on the SNP3 site.

[0024] In any of the above-mentioned kits, the "substance for detecting the genotype of the boar to be tested based on the SNP1 site" or the "substance for detecting the genotype of the boar to be tested based on the SNP2 site" can be a primer pair consisting of an upstream primer 1F and a downstream primer 1R; The upstream primer 1F is a single-stranded DNA molecule shown in SEQ ID NO: 2; The downstream primer 1R is a single-stranded DNA molecule shown in SEQ ID NO:3.

[0025] In any of the above-mentioned kits, the “substance for detecting the genotype of the boar to be tested based on the SNP3 site” may be a primer pair consisting of an upstream primer 2F and a downstream primer 2R; The upstream primer 2F is a single-stranded DNA molecule shown in SEQ ID NO: 5; The downstream primer 2R is a single-stranded DNA molecule shown in SEQ ID NO:6.

[0026] Any of the above-mentioned substances for detecting the genotype of the boar to be tested based on the SNP1 site, any of the above-mentioned substances for detecting the genotype of the boar to be tested based on the SNP2 site, or any of the above-mentioned substances for detecting the genotype of the boar to be tested based on the SNP3 site can also be used to determine the nucleotide types of the SNP1 site, SNP2 site, and / or SNP3 site in the boar genome by at least one of the following methods: DNA sequencing, restriction enzyme fragment length polymorphism, single-stranded conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on a single base extension reaction, a chip based on an allele-specific primer extension reaction, a chip based on a "one-step" reaction, a chip based on a primer ligation reaction, a chip based on a restriction endonuclease reaction, a chip based on a protein DNA binding reaction, and / or a chip based on a fluorescent molecule DNA binding reaction.

[0027] In any of the above-mentioned kits, the sperm motility can be the ratio of the number of sperm motile to the total number of sperm. The number of sperm motile and the total number of sperm can be measured by placing the microscope stage connected to a computer-assisted sperm analysis (CASA) system.

[0028] The present invention also protects molecular markers, which may be molecular marker A shown in SEQ ID NO: 1 and / or molecular marker B shown in SEQ ID NO: 4.

[0029] The use of any of the above-mentioned kits or any of the above-mentioned molecular markers in identifying boar sperm motility also falls within the protection scope of the present invention.

[0030] The use of any of the above-mentioned kits or any of the above-mentioned molecular markers in screening boars with different sperm motility also falls within the protection scope of the present invention.

[0031] In any of the above applications, the sperm motility may be the ratio of the number of sperm motile to the total number of sperm. The number of sperm motile and the total number of sperm may be measured by placing the sperm on a microscope stage connected to a computer-assisted sperm analysis (CASA) system.

[0032] The use of any of the above-mentioned kits or any of the above-mentioned molecular markers in identifying boar genotypes also falls within the protection scope of the present invention.

[0033] The application of any of the above-mentioned kits or any of the above-mentioned molecular markers in boar breeding also belongs to the protection scope of the present invention. The goal of boar breeding can be to cultivate boar breeds with excellent sperm quality, and the sperm quality can be sperm motility. Boars with sperm motility greater than 80% are boar individuals with excellent sperm quality.

[0034] Any of the above-mentioned boars can specifically be a Large White boar.

[0035] Any of the above-mentioned “>” may specifically be a statistical “>”.

[0036] Any of the above-mentioned sperm motility may be fresh sperm motility and / or frozen sperm motility.

[0037] Experiments have shown that the method provided by the present invention can be used to detect the genotype of the boar to be tested based on the SNP1 site, the SNP2 site and / or the SNP3 site, and can identify or assist in identifying the boar sperm motility trait: the sperm motility of the Large White pig boar whose genotype based on the SNP1 site is AA homozygous or AC heterozygous> the sperm motility of the Large White pig boar whose genotype based on the SNP1 site is CC homozygous; the sperm motility of the Large White pig boar whose genotype based on the SNP2 site is CC homozygous or CT heterozygous> the sperm motility of the Large White pig boar whose genotype based on the SNP2 site is TT homozygous; the sperm motility of the Large White pig boar whose genotype based on the SNP3 site is GG homozygous or GA heterozygous> the sperm motility of the Large White pig boar whose genotype based on the SNP3 site is AA homozygous; the SNP1 site is the 183rd nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome; the SNP2 site is the nucleotide of SEQ ID NO: 1 in the boar genome. NO: 1 is the 491st nucleotide from the 5' end; SNP3 site is the 285th nucleotide from the 5' end of SEQ ID NO: 4 in the boar genome. The method provided by the present invention is suitable for large-scale group detection and has important application value in the process of boar molecular marker-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the partial sequencing result of a large white boar based on the SNP1 site in step 1 of Example 3. Among them, A is AA homozygous, B is AC heterozygous, and C is CC homozygous.

[0039] Figure 2 This is the partial sequencing result of a large white boar based on the SNP2 site in step 1 of Example 3. Among them, A is CC homozygous, B is CT heterozygous, and C is TT homozygous.

[0040] Figure 3 This is the partial sequencing result of a large white boar based on the SNP3 site in step 1 of Example 3. Among them, A is GG homozygous, B is GA heterozygous, and C is AA homozygous. DETAILED DESCRIPTION

[0041] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0042] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0043] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0044] Example 1. Discovery of three SNP sites in the Large White Pig Genome and acquisition of primer pairs for identifying the three SNP sites 1. Discovery of three SNP loci in the Large White Pig Genome The inventors of the present application conducted a large number of sequence analyses, comparisons and preliminary experiments on the genome sequence of Large White pigs and discovered three SNP sites in the genome of Large White pigs. The three SNP sites were named SNP1 site (also known as A183C site, which is the 183rd nucleotide from the 5' end of SEQ ID NO: 1 in the Large White pig genome, the physical position is position 98280702 on chromosome 6 of pig, and the genotype is AA homozygous, CC homozygous or AC heterozygous), SNP2 site (also known as C491T SNP site, which is the 491st nucleotide from the 5' end of SEQ ID NO: 1 in the Large White pig genome, the physical position is position 98281010 on chromosome 6 of pig, and the genotype is CC homozygous, TT homozygous or CT heterozygous) and SNP3 site (also known as G285A site, which is the 285th nucleotide from the 5' end of SEQ ID NO: 4 in the Large White pig genome, the physical position is position 98281455 on chromosome 6 of pig, and the genotype is GG homozygous, AA homozygous or GA heterozygous).

[0045] SEQ ID NO: 1: CACCCCCTCCTCAGTAACAAGCTCCTACTCTCTTAGGACGTTTCACACACAGAGTATTATTTTACTAAGGGAGCATGTCCTGGTGTCATTTCTAGGGAAACACATGTCCTAGAGGATGTTTAATCTAAAAATTGTAGGGCAAACTTCTAATAATATCAATTAATAATAGGTTACAGGAAAGCMAGCCAGAAGGAGTACCAGCACTGTAAGATTCTAGGATGCCCCCCTACCCCCACCCCACTCCTGCAAACTGCAAAATCAGAGAAAGTGTTTTAGAAGATGCCAAGCGTGGGGAGGTGGGTACCAAGGTTGACCAGAGGTCTAGCCTTGGAAACCTGCCTTTTCAGATTCCCTGTCTGCTAAGTTAATTCAAGATGTCTGGATCCAGTGGAAGGAAAAGTAAAGGAAGAAAAGCTTTTCCCATTGAAAATTCAAAACCTGTTTCCATTTTAATGTTCATAAAAACCTGGGATCAAGAAGCAGTTGGTTCYCCATGAGAACTCCTACTTGGGGATGATGGTTCTTAGAGGATATTGGGATGGGTGCCCTTTGTGGGGACTGGGAGATAGTTATCACCCAGCATGGTGACAGGGCCAGTTGGTACCTTCAAGGCTCAGCAAACCTTAATTGAAAACCTACAATGTAAAAATCAGGAATGAGGTCAGAAGCTGATTAAAGACCTGGAACTCTCCATAACTCTGAGAGCCGTGCTTCAGAGTCCTGTGGTG (M is A or C, Y is C or T) SEQ ID NO:4: GCTTGTTACTGAGGAGGGGGTGTGAATCAGATGGTTCTCGGAATAATATTTATGTCCCCACCTGCCACTGCTCACACAGGAGCCACTCCAAGGACATCCAAAACAGGACTAAATCCCAGAATGACATGAAATATTTTAGTCAGATTTGGTTGGTTTGCATATATGGCCAAAACTTAAAGGAATGTTCCCCAAGTAAAGGTCAGAGATGTAGACAATAGTCCCTAATACATGGGTCCCCTCTTTCACAACAGCCCAGGT CTGCAGCCCATCATCCAACCGCCCTRCACCGATCGGTCAATTAACTTTCCGTGAAGGTTGCTTAGGTACTAAGGCAATGCGCTGAAGAGGTTCTTGAAATTTGGTTAGAAACATAGGAAATCAGAGTGG AAGAATGTTTTAGAATCTCACATATATATAAGTCAGTAAGACTTTTGCACAAATGTAAGAACATTTTACGGTTTTTAACAAAAAAACTCTACTTAATACCTAATAGCCGTTCCCTCCAAATGC (R is A or G) Since genomic DNA is a double-stranded DNA molecule composed of two reverse complementary single-stranded DNA molecules, the DNA molecule encoding the protein is generally named the sense DNA molecule; the DNA molecule that is reverse complementary to the sense DNA molecule is named the antisense DNA molecule. The genotype of all loci is the genotype of the sense DNA.

[0046] 2. Obtaining primer pairs for identifying three SNP sites According to the nucleotide sequences of SNP1 and SNP2 and before and after them, primer pair 1 for identifying SNP1 and SNP2 was designed and synthesized. Primer pair 1 consists of upstream primer 1F and downstream primer 1R, and is used to amplify the target sequence including SNP1 and SNP2.

[0047] According to the SNP3 site and the nucleotide sequence before and after it, a primer pair 2 for identifying the SNP3 site was designed and synthesized. The primer pair 2 consisted of an upstream primer 2F and a downstream primer 2R, and was used to amplify the target sequence including the SNP3 site.

[0048] The nucleotide sequences of upstream primer 1F, downstream primer 1R, upstream primer 2F and downstream primer 2R are shown in Table 1.

[0049]

[0050] Example 2: Establishment of a genotyping method for Large White boars based on three SNP loci 1. Establishment of a genotyping method based on SNP1 locus in Large White boars 1. Extract the genomic DNA from the semen of the Large White pig to be tested.

[0051] 2. Using the genomic DNA of the Large White boar semen to be tested as a template, PCR amplification was performed using a primer pair 1 consisting of an upstream primer 1F and a downstream primer 1R to obtain a PCR amplification product 1.

[0052] The reaction system is 25 μl, consisting of 1 μl of genomic DNA of Large White boar semen to be tested (concentration is 50 ng / μL), 1 μL of upstream primer 1F aqueous solution (concentration is 10 pmol / μL), 1 μL of downstream primer 1R aqueous solution (concentration is 10 pmol / μL), 2.0 μL of dNTP mix (concentration is 10 mmol / L), 0.125 μL of Taq DNA polymerase (concentration is 5 U / μL), 2.5 μL of 10×PCR reaction buffer and water. Taq DNA polymerase is a product of Takara, and the product catalog number is RR001Q. 10×PCR reaction buffer and dNTP mix are components of Taq DNA polymerase.

[0053] The reaction conditions were: 94°C for 30 s; 98°C for 10 s, 55°C for 30 s, 72°C for 60 s, 35 cycles; 72°C for 2 min.

[0054] 3. After completing step 2, sequence the PCR amplification product 1. According to the sequencing results, determine the genotype of the Large White pig boar to be tested based on the SNP1 site. The specific judgment principles are as follows: If the 183rd position of the PCR amplification product 1 of the Large White boar to be tested is only A, the genotype of the Large White boar to be tested based on the SNP1 site is AA homozygous; If the 183rd position of the PCR amplification product 1 of the Large White boar to be tested is only C, the genotype of the Large White boar to be tested based on the SNP1 site is CC homozygous; If the 183rd position of the PCR amplification product 1 of the Large White boar to be tested is A and C, the genotype of the Large White boar to be tested based on the SNP1 site is AC heterozygous.

[0055] 2. Establishment of the genotyping method based on SNP2 locus in Large White boars 1. Extract the genomic DNA from the semen of the Large White pig to be tested.

[0056] 2. Using the genomic DNA of the Large White boar semen to be tested as a template, PCR amplification was performed using a primer pair 1 consisting of an upstream primer 1F and a downstream primer 1R to obtain a PCR amplification product 1.

[0057] The reaction system was 25 μl, consisting of 1 μl of genomic DNA of Large White boar semen to be tested (concentration of 50 ng / μL), 1 μL of upstream primer 1F aqueous solution (concentration of 10 pmol / μL), 1 μL of downstream primer 1R aqueous solution (concentration of 10 pmol / μL), 2.0 μL of dNTP mix (concentration of 10 mmol / L), 0.125 μL of Taq DNA polymerase (concentration of 5 U / μL), 2.5 μL of 10× PCR reaction buffer and water.

[0058] The reaction conditions were: 94°C for 30 s; 98°C for 10 s, 55°C for 30 s, 72°C for 60 s, 35 cycles; 72°C for 2 min.

[0059] 3. After completing step 2, sequence the PCR amplification product 1. According to the sequencing results, determine the genotype of the Large White pig boar to be tested based on the SNP2 site. The specific judgment principles are as follows: If the 491st position of the PCR amplification product 1 of the Large White boar to be tested is only C, the genotype of the Large White boar to be tested based on the SNP2 site is CC homozygous; If the 491st position of the PCR amplification product 1 of the Large White boar to be tested is only T, the genotype of the Large White boar to be tested based on the SNP2 site is TT homozygous; If the 491st position of the PCR amplification product 1 of the Large White boar to be tested is C and T, the genotype of the Large White boar to be tested based on the SNP2 site is a CT heterozygous type.

[0060] 3. Establishment of the genotyping method based on SNP3 locus in Large White boars 1. Extract the genomic DNA from the semen of the Large White pig to be tested.

[0061] 2. Using the genomic DNA of the Large White boar semen to be tested as a template, PCR amplification was performed using primer pair 2 consisting of an upstream primer 2F and a downstream primer 2R to obtain a PCR amplification product 2.

[0062] The reaction system was 25 μl, consisting of 1 μl of genomic DNA of Large White boar semen to be tested (concentration of 50 ng / μL), 1 μL of upstream primer 2F aqueous solution (concentration of 10 pmol / μL), 1 μL of downstream primer 2R aqueous solution (concentration of 10 pmol / μL), 2.0 μL of dNTP mix (concentration of 10 mmol / L), 0.125 μL of Taq DNA polymerase (concentration of 5 U / μL), 2.5 μL of 10× PCR reaction buffer and water.

[0063] The reaction conditions were: 94°C for 30 s; 98°C for 10 s, 55°C for 30 s, 72°C for 60 s, 35 cycles; 72°C for 2 min.

[0064] 3. After completing step 2, sequence the PCR amplification product 2. According to the sequencing results, determine the genotype of the Large White pig boar to be tested based on the SNP3 site. The specific judgment principles are as follows: If the 285th position of the PCR amplification product 2 of the Large White boar to be tested is only G, the genotype of the Large White boar to be tested based on the SNP3 site is GG homozygous; If the 285th position of the PCR amplification product 2 of the Large White boar to be tested is only A, the genotype of the Large White boar to be tested based on the SNP3 site is AA homozygous; If the 285th position of the PCR amplification product 2 of the Large White boar to be tested is G and A, the genotype of the Large White boar to be tested based on the SNP3 site is a GA heterozygous type.

[0065] Example 3: Association analysis between genotype and sperm motility of Large White pigs based on three SNP loci The semen samples (all fresh semen) of 105 large white boars in this embodiment were all provided by Henan Jingwang Boar Station and were from different large white pigs. All large white boars providing semen samples were raised to sexual maturity under normal nutritional levels and feeding conditions.

[0066] 1. Detection of genotypes based on three SNP loci in 105 Large White boars According to the method in Example 2, the semen of the Large White boars to be tested was replaced with semen samples of 105 Large White boars, and other steps remained unchanged, to obtain the genotypes of the 105 Large White boars based on the SNP1 site.

[0067] According to the method in Example 2, the semen of the Large White boars to be tested was replaced with semen samples of 105 Large White boars, and other steps remained unchanged, to obtain the genotypes of the 105 Large White boars based on the SNP2 locus.

[0068] According to the method in Example 2, the semen of the Large White boars to be tested was replaced with semen samples of 105 Large White boars, and the other steps remained unchanged, to obtain the genotypes of the 105 Large White boars based on the SNP3 site.

[0069] Some sequencing results can be found in Figure 1-Figure 3 .

[0070] The quantitative statistical results and genotype frequencies of 105 Large White boars based on 3 SNP loci are shown in Table 2. Based on SNP1, the allele frequency of A is 0.829 and the allele frequency of C is 0.171. Based on SNP2, the allele frequency of C is 0.838 and the allele frequency of T is 0.162. Based on SNP3, the allele frequency of G is 0.852 and the allele frequency of A is 0.148.

[0071]

[0072] 2. Testing the sperm motility of 105 Large White boars The experiment was repeated three times and the results were averaged. Each semen sample was tested according to the following steps: 1. Take a semen sample and dilute it with physiological saline to obtain a semen diluent; 2. Drop 20 μL of semen diluent onto a glass slide, and then place it on a microscope stage connected to a computer-assisted sperm analysis (CASA) system to measure the number of forward-moving sperm and the total number of sperm to obtain sperm motility; Sperm motility = (number of sperm motility / total number of sperm) × 100% Semen samples with sperm motility > 80% constituted the high semen quality group, namely group H.

[0073] Semen samples with sperm motility < 80% constituted the low semen quality group, namely group L.

[0074] The results showed that group H consisted of semen samples from 69 Large White boars, and the average sperm motility of group H was above 94%; group L consisted of semen samples from 36 Large White boars, and the average sperm motility of group L was below 65%.

[0075] It should be noted that, since the proportion of Large White boar individuals with low sperm motility (i.e. low semen quality) in the group is relatively low, the above-mentioned Large White boar individuals in the low semen quality group consisting of semen samples from 36 Large White boars were gradually collected from a group of more than 300 Large White boars.

[0076] 3. Association analysis between genotype and sperm motility of Large White boars based on three SNP loci SPSS 27 software was used to perform association analysis based on the genotypes of the 105 Large White boars obtained in step 1 based on the three SNP loci, specifically the chi-square test. The test results are shown in Tables 3 to 5.

[0077]

[0078] Note: P value is the significance level of the chi-square test, and ** indicates that the difference in sperm motility between different genotypes is extremely significant ( P <0.01).

[0079]

[0080] Note: P value is the significance level of the chi-square test, and ** indicates that the difference in sperm motility between different genotypes is extremely significant ( P <0.01).

[0081]

[0082] Note: P value is the significance level of the chi-square test, and * indicates that there is a significant difference in sperm motility between different genotypes ( P <0.05).

[0083] The results showed that SNP1, SNP2 and SNP3 were significantly associated with sperm motility of Large White boars; specifically as follows: The sperm motility of Large White boars with AA homozygous or AC heterozygous genotype based on SNP1 locus is greater than the sperm motility of Large White boars with CC homozygous genotype based on SNP1 locus; for the sperm motility trait of Large White boars, based on SNP1 locus, the dominant allele is A, and the excellent genotype is AA homozygous or AC heterozygous; The sperm motility of Large White boars with CC homozygous or CT heterozygous genotypes based on SNP2 loci is greater than the sperm motility of Large White boars with TT homozygous genotypes based on SNP2 loci; for the sperm motility trait of Large White boars, based on SNP2 loci, the dominant allele is C, and the superior genotype is CC homozygous or CT heterozygous; The sperm motility of Large White boars with a genotype of GG homozygous or GA heterozygous based on the SNP3 locus is greater than the sperm motility of Large White boars with a genotype of AA homozygous based on the SNP3 locus; for the sperm motility trait of Large White boars, based on the SNP3 locus, the dominant allele is G, and the excellent genotype is GG homozygous or GA heterozygous; The above “>” are all statistically > (i.e., significantly higher at the 0.05 level).

[0084] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. The method for identifying boar sperm motility is method A1), method A2) or method A3): The method A1) comprises the following steps: detecting whether the genotype of the boar to be tested based on the SNP1 site is AA homozygous, AC heterozygous or CC homozygous, and then making the following judgment: the sperm motility of the boar whose genotype based on the SNP1 site is AA homozygous or AC heterozygous> the sperm motility of the boar whose genotype based on the SNP1 site is CC homozygous; the SNP1 site is the nucleotide at position 183 from the 5' end of SEQ ID NO: 1 in the boar genome; The method A2) comprises the following steps: detecting whether the genotype of the boar to be tested based on the SNP2 site is CC homozygous, CT heterozygous or TT homozygous, and then making the following judgment: the sperm motility of the boar whose genotype based on the SNP2 site is CC homozygous or CT heterozygous> the sperm motility of the boar whose genotype based on the SNP2 site is TT homozygous; the SNP2 site is the 491st nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome; The method A3) comprises the following steps: detecting whether the genotype of the boar to be tested based on the SNP3 site is GG homozygous, GA heterozygous or AA homozygous, and then making the following judgment: the sperm motility of the boar whose genotype based on the SNP3 site is GG homozygous or GA heterozygous>the sperm motility of the boar whose genotype based on the SNP3 site is AA homozygous; the SNP3 site is the nucleotide at position 285 from the 5' end of SEQ ID NO: 4 in the boar genome.

2. The method for identifying boar sperm motility is method B1), method B2) or method B3): The method B1) comprises the following steps: B1-1) Using the genomic DNA of the boar to be tested as a template, PCR amplification is performed using a primer pair consisting of an upstream primer 1F and a downstream primer 1R to obtain a PCR amplification product 1; the PCR amplification product 1 is sequenced, and then the following judgment is performed: if the 183rd position of the PCR amplification product 1 is only A, the genotype of the boar to be tested based on the SNP1 site is AA homozygous; if the 183rd position of the PCR amplification product 1 is A and C, the genotype of the boar to be tested based on the SNP1 site is AC heterozygous; if the 183rd position of the PCR amplification product 1 is only C, the genotype of the boar to be tested based on the SNP1 site is CC homozygous; B1-2) Based on the results of B1-1), the following judgment is made: the sperm motility of the boar whose genotype at the SNP1 locus is AA homozygous or AC heterozygous> the sperm motility of the boar whose genotype at the SNP1 locus is CC homozygous; The method B2) comprises the following steps: B2-1) Using the genomic DNA of the boar to be tested as a template, PCR amplification is performed using a primer pair consisting of an upstream primer 1F and a downstream primer 1R to obtain a PCR amplification product 1; the PCR amplification product 1 is sequenced, and then the following judgment is performed: if the 491st position of the PCR amplification product 1 is only C, the genotype of the boar to be tested based on the SNP2 site is CC homozygous; if the 491st position of the PCR amplification product 1 is C and T, the genotype of the boar to be tested based on the SNP2 site is CT heterozygous; if the 491st position of the PCR amplification product 1 is only T, the genotype of the boar to be tested based on the SNP2 site is TT homozygous; B2-2) Based on the results of B2-1), the following judgment is made: the sperm motility of the boar whose genotype at the SNP2 locus is CC homozygous or CT heterozygous is greater than the sperm motility of the boar whose genotype at the SNP2 locus is TT homozygous; The method B3) comprises the following steps: B3-1) Using the genomic DNA of the boar to be tested as a template, PCR amplification is performed using a primer pair consisting of an upstream primer 2F and a downstream primer 2R to obtain a PCR amplification product 2; the PCR amplification product 2 is sequenced, and then the following judgment is performed: if the 285th position of the PCR amplification product 2 is only G, the genotype of the boar to be tested based on the SNP3 site is a GG homozygous type; if the 285th position of the PCR amplification product 2 is G and A, the genotype of the boar to be tested based on the SNP3 site is a GA heterozygous type; if the 285th position of the PCR amplification product 2 is only A, the genotype of the boar to be tested based on the SNP3 site is an AA homozygous type; B3-2) Based on the results of B3-1), the following judgment is made: the sperm motility of the boar whose genotype at the SNP3 site is GG homozygous or GA heterozygous is greater than the sperm motility of the boar whose genotype at the SNP3 site is AA homozygous; The SNP1 site is the 183rd nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome; The SNP2 site is the 491st nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome; The SNP3 site is the 285th nucleotide from the 5' end of SEQ ID NO: 4 in the boar genome; The upstream primer 1F is a single-stranded DNA molecule shown in SEQ ID NO: 2; The downstream primer 1R is a single-stranded DNA molecule shown in SEQ ID NO: 3; The upstream primer 2F is a single-stranded DNA molecule shown in SEQ ID NO: 5; The downstream primer 2R is a single-stranded DNA molecule shown in SEQ ID NO:

6.

3. A kit for identifying boar sperm motility, comprising a substance for detecting the genotype of the boar to be tested based on the SNP1 site, a substance for detecting the genotype of the boar to be tested based on the SNP2 site, and / or a substance for detecting the genotype of the boar to be tested based on the SNP3 site; The SNP1 site is the 183rd nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome; The SNP2 site is the 491st nucleotide from the 5' end of SEQ ID NO: 1 in the boar genome; The SNP2 site is the 285th nucleotide from the 5' end of SEQ ID NO: 4 in the boar genome.

4. The kit according to claim 3, characterized in that: The "substance for detecting the genotype of the boar to be tested based on the SNP1 site" or the "substance for detecting the genotype of the boar to be tested based on the SNP2 site" is a primer pair consisting of an upstream primer 1F and a downstream primer 1R; The "substance for detecting the genotype of the boar to be tested based on the SNP3 site" is a primer pair consisting of an upstream primer 2F and a downstream primer 2R; The upstream primer 1F is a single-stranded DNA molecule shown in SEQ ID NO: 2; The downstream primer 1R is a single-stranded DNA molecule shown in SEQ ID NO: 3; The upstream primer 2F is a single-stranded DNA molecule shown in SEQ ID NO: 5; The downstream primer 2R is a single-stranded DNA molecule shown in SEQ ID NO:

6.

5. Molecular markers, which are the molecular marker A shown in SEQ ID NO: 1 and / or the molecular marker B shown in SEQ ID NO:

4.

6. Use of the kit according to claim 3 or 4 or the molecular marker according to claim 5 in identifying boar sperm motility.

7. Use of the kit according to claim 3 or 4 or the molecular marker according to claim 5 in screening boars with different sperm motility.

8. Use of the kit according to claim 3 or 4 or the molecular marker according to claim 5 in identifying boar genotypes.

9. Use of the kit according to claim 3 or 4 or the molecular marker according to claim 5 in boar breeding.

10. The method according to claim 1 or 2, the kit according to claim 3 or 4, or the use according to any one of claims 6 to 9, characterized in that: The boar is a Large White boar.

Images