An InDel molecular marker for assisting in the identification of drought resistance in sorghum and its application

By using InDel molecular markers for PCR amplification and gel electrophoresis analysis, the problem of insufficient molecular mechanisms in sorghum drought resistance research has been solved, enabling efficient identification of drought resistance traits and accelerating the breeding process.

CN119220725BActive Publication Date: 2025-11-14GRAIN RES INST HEBEI ACAD OF AGRI & FORESTRY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411484440.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-23
Publication Date
2025-11-14
Estimated Expiration
2044-10-23

AI Technical Summary

Technical Problem

Existing technologies lack in-depth exploration of molecular mechanisms in sorghum drought resistance research, and there is a lack of research on the correlation between sorghum drought resistance traits and molecular markers, resulting in low breeding selection efficiency.

Method used

Using InDel molecular markers, PCR amplification was performed using specific primer sequences F:GACATGTCTTAATCGCACGTAC and R:GGTTTTTGCGGCTGATAAAGTG, followed by non-denaturing polyacrylamide gel electrophoresis analysis, to rapidly and accurately identify the drought resistance traits of sorghum.

Benefits of technology

This method enables rapid and accurate identification of drought resistance traits in sorghum, significantly improves the selection efficiency of drought-resistant breeding, and promotes the targeted genetic improvement of drought resistance in sorghum.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119220725B_ABST
    Figure CN119220725B_ABST
Patent Text Reader

Abstract

This invention relates to an InDel molecular marker for assisting in the identification of drought resistance in sorghum and its application, belonging to the technical field of InDel molecular markers. The upstream primer sequence of the molecular marker is F: GACATGTCTTAATCGCACGTAC, and the downstream primer sequence is R: GGTTTTTGCGGCTGATAAAGTG. The InDel molecular marker for sorghum drought resistance is used to identify drought resistance traits in sorghum; a 304bp band indicates strong drought resistance in the material. The InDel molecular marker of this invention can rapidly and accurately identify drought resistance traits in sorghum, significantly improving the selection efficiency of sorghum drought resistance breeding, thereby accelerating the breeding process and achieving targeted genetic improvement of sorghum drought resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the technical field of InDel molecular markers, and relates to an InDel molecular marker for assisting in the identification of drought resistance in sorghum and its application. Background Technology

[0002] Sorghum (Sorghum bicolor (L.) Moench.) is an annual herbaceous plant belonging to the Poaceae family, typically growing in arid and semi-arid regions of the tropics, subtropics, and temperate zones. It ranks fifth in global planting area among major food crops, after rice, corn, wheat, and soybeans. As one of my country's main specialty crops, sorghum has multiple agricultural uses, including brewing, food, animal feed, and broom making. Furthermore, sorghum exhibits strong resilience, demonstrating a certain degree of adaptability to harsh environments such as drought, flooding, saline-alkali land, infertile soil, and high temperatures.

[0003] Drought is a common and severe abiotic stress in agricultural production, characterized by its high frequency, wide range, and long duration. Currently, more than one-third of the world's land area is located in arid and semi-arid regions. In China, the total area of ​​arid, semi-arid, and sub-humid arid zones is close to 3 million square kilometers, accounting for nearly 40% of the country's total land area. Drought stress is a key factor limiting crop yields; it is estimated that approximately 60% of annual crop yield reductions are due to drought. Therefore, research on the drought resistance of sorghum is crucial. The implementation of this project is of great significance.

[0004] In recent years, extensive research has been conducted on the drought resistance of sorghum, revealing significant differences in drought resistance among different sorghum varieties. Currently, research on the drought resistance characteristics of sorghum in China mainly focuses on morphological feature identification and research methods. Some scholars are dedicated to exploring the drought resistance performance of sorghum in the early stages of seed development or in farmland environments and its assessment methods. At the molecular level, Dugas et al. used osmotic pressure to influence sorghum growth and analyzed transcriptome data to reveal the drought resistance mechanism of sorghum and identify corresponding genes. Zhang et al. used transcriptome sequencing to analyze the transcriptomes of sorghum leaves and roots under drought conditions, selecting many significantly altered genes. Enrichment (GO) analysis then identified some transcription factors associated with drought resistance. Wang Zhiheng et al. subjected sweet sorghum to drought stress using PEG-6000 and performed transcriptome sequencing analysis, discovering two metabolic pathways related to drought stress response. This indicates that sweet sorghum enhances its osmotic regulation to cope with drought stress by activating the expression of drought-stress-related proteins and carbohydrate-related genes. Abdelghany et al. studied the drought tolerance of sorghum. They selected four different sorghum materials and performed transcriptome analysis. Their study found that approximately 180 genes in the drought-resistant genotype were differentially regulated under drought stress, with the majority (over 70%) upregulated during drought resistance. The functions of about 70 of these genes were unknown. Fracasso et al. also studied the drought tolerance of sorghum. They selected the drought-resistant variety IS22330 and the drought-susceptible variety IS20351, and observed gene expression in photosynthetic response, water vapor loss, and water use efficiency under arid conditions to understand their differences. The results showed that gene expression generally increased in the drought-resistant type under drought stress, while gene expression decreased in the drought-susceptible type. This led to the identification of three genes as important candidate genes for assessing sorghum drought tolerance.

[0005] Currently, research on sorghum drought resistance mainly focuses on the physiological level, such as changes in physiological and biochemical indicators after drought stress. This research is largely limited to single-omics explorations, such as genomics or transcriptomics, with limited joint analysis of data from different omics groups and a lack of in-depth investigation into its molecular mechanisms. Therefore, there are still many shortcomings in revealing the mechanisms of sorghum drought resistance. There is currently no research on the relationship between drought resistance traits and molecular markers in sorghum. Therefore, developing molecular markers for sorghum drought resistance has significant practical implications for drought-assisted breeding of sorghum. Summary of the Invention

[0006] The present invention aims to provide an InDel molecular marker for assisting in the identification of drought resistance in sorghum and its application.

[0007] The technical solution adopted by this invention to achieve its purpose is as follows:

[0008] An InDel molecular marker for assisting in the identification of drought resistance in sorghum, wherein the upstream primer sequence of the molecular marker is F: GACATGTCTTAATCGCACGTAC, and the downstream primer sequence is R: GGTTTTTGCGGCTGATAAAGTG;

[0009] The InDel molecular markers used to identify drought resistance in sorghum are described above. A 304bp band indicates strong drought resistance, while a lower band (larger band) indicates poor drought resistance.

[0010] Primer pairs used to amplify the InDel molecular marker in sorghum are described, with the upstream primer sequence F: GACATGTCTTAATCGCACGTAC and the downstream primer sequence R: GGTTTTTGCGGCTGATAAAGTG.

[0011] A method for identifying the drought resistance of sorghum includes the following steps:

[0012] (1) Using the DNA from the sorghum sample as a template, the InDel molecular marker was amplified using primers selected from claim 1;

[0013] (2) Electrophoretic pattern analysis: Based on the polyacrylamide gel electrophoresis amplification results of the sample, the band pattern is interpreted. The appearance of a 304bp band pattern indicates that the material has strong drought resistance.

[0014] Furthermore, the amplification is PCR amplification:

[0015] The reaction system included: 5 μl of 2×TaqPCR MasterMix, 0.5 μl of 10 μM upstream primer, 0.5 μl of 10 μM downstream primer, 0.5 μl of DNA template, and 3.5 μl of ddH2O;

[0016] The reaction program was as follows: 95℃ for 2 min; 94℃ for 40 s, 58℃ for 45 s, 72℃ for 1 min and 30 s for 26 cycles; 72℃ for 7 min.

[0017] Furthermore, the polyacrylamide gel is a non-denaturing polyacrylamide gel, with the following formulation:

[0018] 15 ml of 30% gel preparation solution, 10 ml of 5×TBE electrophoresis buffer, 25 ml of H2O, 600 μl of 10% AP, and 40 μl of TEMD.

[0019] Furthermore, the electrophoresis conditions were 120V, 400mA, 30min, 180V, 400mA, 1h15min.

[0020] Further, after electrophoresis, the gel was removed, and holes were marked with the tip of a pipette. The gel was then stained with silver in AgNO3 solution for 10-15 minutes, developed with a colorimetric solution for 5-8 minutes, rinsed twice with water, and then placed on a light box for photographing to obtain the results.

[0021] The application of the molecular marker detection reagent as described in claim 1 in the auxiliary identification of drought-resistant sorghum varieties in breeding.

[0022] Beneficial effects of this invention:

[0023] The InDel molecular marker of this invention can rapidly and accurately identify drought resistance traits in sorghum, significantly improve the selection efficiency of drought resistance breeding of sorghum, thereby accelerating the breeding process and realizing targeted genetic improvement of drought resistance in sorghum. Attached Figure Description

[0024] Figure 1 This is a polyacrylamide gel electrophoresis image.

[0025] Figure 2 This is a 304bp band pattern from polyacrylamide gel electrophoresis. Detailed Implementation

[0026] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0027] Example 1

[0028] 1. Sorghum sample

[0029] Fifty-two different sorghum materials were selected. Sorghum seeds were first soaked in 75% alcohol for 10 minutes, then rinsed with distilled water and placed in petri dishes for germination in an incubator (28℃±2℃). After germination, healthy seedlings with uniform growth were selected and transplanted into seedling trays with a fixed soil composition and weight (e.g., containing 500g vermiculite and 500g sand, mixed and watered with 30ml of water, total weight 1.25g per tray). The seedlings were then cultured in a nursery (28℃±2℃). Seedlings that grew normally to the three-leaf stage were subjected to water control treatment. The control group received normal irrigation, while the drought-treated group received water shortage, with soil moisture content controlled daily until the seedlings reached the five-leaf stage. During this period, phenotypes were observed, and physiological indicators such as plant height, above-ground fresh weight, and above-ground dry weight were measured. Appropriate calculation methods were used to identify the drought resistance of different sorghum materials.

[0030] 2. DNA sample extraction

[0031] 2.1 DNA was extracted using the FastPure Plant DNAIsolation Mini Kit.

[0032] Table 1 Product Components

[0033]

[0034] RNaseA: Enzymatically digests RNA in a sample;

[0035] BufferA1: Provides a sample lysis environment;

[0036] Buffer A2: Removes impurities such as proteins and cell debris;

[0037] BufferA3: Provides the environment for the upper cylinder;

[0038] BufferAW: Removes salt ions from DNA;

[0039] Elution Buffer: Used to elute DNA from the adsorption column;

[0040] FastPure gDNA ColumnsⅣ: Adsorbs genomic DNA;

[0041] Collection Tubes 2ml: Filtrate collection tubes.

[0042] 2.2 Sample Processing

[0043] Liquid nitrogen grinding method

[0044] Take 100mg of fresh plant leaf tissue, add liquid nitrogen and grind it into powder. Transfer the powder to a 1.5ml centrifuge tube.

[0045] 2.3 DNA Extraction

[0046] (1) Immediately add 400 μl BufferA1 and 4 μl RNaseA (10 mg / ml) to the ground sample powder, vortex and mix thoroughly to aid lysis.

[0047] Optional: When the polysaccharide content is particularly high, 2% PVP-40 can be added to Buffer A1; when the polyphenol content is particularly high, 0.2% β-mercaptoethanol can be added to Buffer A1. Both can also be added simultaneously.

[0048] (2) Incubate in a 65℃ water bath for 10 minutes. Invert the centrifuge tube 2-3 times during the water bath to mix the samples.

[0049] (3) Add 130 μl of Buffer A2 to the mixture, mix thoroughly, place on ice for 5 min, centrifuge at 14,000 rpm (18,400×g) for 5-10 min, and carefully aspirate the supernatant into a new 1.5 ml centrifuge tube (self-prepared), being careful not to aspirate interfacial substances.

[0050] (4) Calculate the supernatant volume, add 1.5 times the supernatant volume of Buffer A3 (please check that anhydrous ethanol has been added before use), and immediately mix by pipetting. Flocculent precipitate may form after adding Buffer A3; mix well before proceeding to the next step.

[0051] (5) Transfer the mixture (including the precipitate) obtained in the previous step to FastPure gDNA Columns Ⅳ (the adsorption column has been placed in the collection tube), centrifuge at 12000 rpm (13,400×g) for 30-60 seconds, and discard the filtrate.

[0052] (6) Add 600 μl of BufferAW (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (13,400 × g) for 30 seconds, and discard the filtrate.

[0053] (7) Repeat step 6.

[0054] (8) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm (13,400 × g) for 2 min to remove as much of the wash solution as possible, so as to avoid residual ethanol in the wash solution inhibiting the downstream reaction. After centrifuging the empty column, you can open the cap and let it stand for 2-5 min to allow the residual ethanol to evaporate completely.

[0055] (9) Place the adsorption column in a new 1.5 ml centrifuge tube (self-provided). Add 50-100 μl of preheated Elution Buffer to the center of the membrane of the adsorption column, incubate at room temperature for 3-5 min, and centrifuge at 12,000 rpm (13,400 × g) for 1 min.

[0056] (10) Discard the adsorption column and store the DNA at -20°C.

[0057] 3. Primer synthesis

[0058] The upstream primer sequence is F: GACATGTCTTAATCGCACGTAC.

[0059] The downstream primer sequence is R: GGTTTTTGCGGCTGATAAAGTG;

[0060] 4. PCR amplification

[0061] Table 2

[0062] Components volume 2×TaqPCRMasterMix 5μl Upstream primer (10 μM) 0.5μl Downstream primer (10 μM) 0.5μl Template (DNA) 0.5μl <![CDATA[ddH2O]]> 3.5μl

[0063] Primer amplification conditions were set as follows: 95℃ for 2 min; 94℃ for 40 s, 58℃ for 45 s, 72℃ for 1 min and 30 s for 26 cycles; 72℃ for 7 min.

[0064] Table 3 Sample Sequence Table

[0065]

[0066]

[0067]

[0068] The sample name is the drought resistance ranking of the sample. For example, the drought resistance of sample 1 ranks 38th among these 52 materials.

[0069] 5. Electrophoresis

[0070] The PCR products were detected by electrophoresis on the non-denaturing polyacrylamide gel in Table 4.

[0071] Table 4

[0072]

[0073]

[0074] The electrophoresis buffer was 0.5×TBE, with spaces at both ends to avoid edge effects. The sample loading volume was 1.2 μl, with one 50 bp marker at each end. The electrophoresis conditions were: 120 V, 400 mA, 30 min; 180 V, 400 mA, 1 h 15 min.

[0075] 6. Development

[0076] After electrophoresis, remove the gel, mark the holes with the tip of a pipette, and stain with silver using AgNO3 solution (1.0g AgNO3 dissolved in 1L of water) for 10-15 minutes.

[0077] The colorimetric solution (20g NaOH dissolved in 1L water, with 10ml formaldehyde added) was used to develop the color for 5-8 minutes.

[0078] After rinsing twice with water, place it on a lightbox for taking photos.

[0079] 5. Experimental Results

[0080] The sampling order from left to right is as follows: Samples 1-52. (See attached image) Figure 1 .

[0081] Genotyping of 52 drought-resistant sorghum materials listed in Table 3 was performed using the InDel molecular markers and methods described above. The gel electrophoresis results are shown below. Figure 1 According to the results of polyacrylamide gel electrophoresis, if the amplified band is relatively small, the tested material exhibits drought sensitivity. For example, in wells 6, 11, 13, 22, 30, 34, 36, 39, 40, 41, 43, 50, 51, and 52, the drought resistance ranking among the 52 materials is Sb33, Sb13, Sb42, Sb29, Sb22, Sb27, Sb37, Sb45, Sb32, Sb47, Sb24, Sb44, Sb48, and Sb34, respectively, with an accuracy of 86% for these 52 materials.

Claims

1. A method for identifying the drought resistance of sorghum, characterized in that, Includes the following steps: Using the sorghum sample DNA as a template, the InDel molecular marker was amplified using primer pairs, wherein the upstream primer sequence of the molecular marker was F: GACATGTCTTAATCGCACGTAC, and the downstream primer sequence was R: GGTTTTTGCGGCTGATAAAGTG. Electrophoretic pattern analysis: Based on the polyacrylamide gel electrophoresis amplification results of the samples, the band patterns were interpreted. The appearance of a 304bp band pattern indicates that the material has strong drought resistance.

2. The method for identifying the drought resistance of sorghum according to claim 1, characterized in that, The amplification mentioned is PCR amplification: The reaction system included: 5 μl of 2×Taq PCR MasterMix, 0.5 μl of 10 µM upstream primer, 0.5 μl of 10 µM downstream primer, 0.5 μl of DNA template, and 3.5 μl of ddH2O; The reaction program was as follows: 95℃ for 2 min; 94℃ for 40 s, 58℃ for 45 s, 72℃ for 1 min and 30 s, repeated 26 times; 72℃ for 7 min.

3. The method for identifying the drought resistance of sorghum according to claim 1, characterized in that, The polyacrylamide gel is a non-denaturing polyacrylamide gel, and its formulation is as follows: 15 ml of 30% gel preparation solution, 10 ml of 5×TBE electrophoresis buffer, 25 ml of H2O, 600 μl of 10% AP, and 40 μl of TEMD.

4. The method for identifying the drought resistance of sorghum according to claim 1, characterized in that, The electrophoresis conditions were 120V, 400mA, 30min, 180V, 400mA, 1h15min.

5. The method for identifying the drought resistance of sorghum according to claim 1, characterized in that, After electrophoresis, remove the gel, mark the holes with the tip of a pipette, stain with AgNO3 solution for 10-15 minutes, develop the color with the developing solution for 5-8 minutes, rinse twice with water, and then place it on a light box to take pictures to obtain the results.

Citation Information

Patent Citations

  • Rapid identification of sorghum gene resistant to powdery mildew

    CN104561035A

  • Method for identifying sorghum plant height, SNP (Single Nucleotide Polymorphism) marker SbPH10 and application of SNP marker SbPH10

    CN117568510A