System for on-demand regulation of cell behavior based on host-guest recognition space reversible rearrangement of cell receptors and application thereof

Abstract

The application provides a system for on-demand regulation of cell behavior based on host-guest recognition space reversible rearrangement of cell receptors and application thereof, and the system comprises a beta-cyclodextrin polymer, a Met binding nucleic acid aptamer labeled with ferrocene and adamantane. Linear beta-cyclodextrin polymer and cross-linked beta-cyclodextrin polymer are used in the system. The two kinds of beta-cyclodextrin polymers have different regulation effects on cell receptors. The system composed of linear beta-cyclodextrin polymer can sensitively rearrange Met receptors to significantly inhibit HGF-induced Met receptor activation, block related signal pathways and indirectly regulate cell behavior. The system composed of cross-linked beta-cyclodextrin polymer can activate cell receptors and directly regulate cell behavior. The system can be applied to preparation of a detection kit for cell analysis and preparation of a drug for cell regulation to regulate the phosphorylation level of Met receptors, cell proliferation and cell migration behavior on demand.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, and in particular relates to a system for on-demand regulation of cell behavior based on host-guest recognition spatial reversible rearrangement of cell receptors and its application. Background Technology

[0002] Receptor tyrosine kinases (RTKs) are a class of cell membrane receptors closely related to cell signaling and function. Many cellular behaviors in physiological and pathological processes, such as cell proliferation, differentiation, apoptosis, metabolism, and migration, are regulated by RTK receptors. Generally, the oligomerization and spatial arrangement of cell receptors play a crucial role in activating and inhibiting downstream signaling cascades in cells.

[0003] Activation of RTK receptors can promote the development of regenerative therapies, while inhibition of RTK receptors can promote the development of targeted cancer therapies. Therefore, artificially manipulating RTK receptor oligomerization or receptor rearrangement to control cell behavior in a customized manner is of great significance. Currently, several cell regulation strategies based on light control, chain substitution, and pH response have been developed. These strategies achieve reversible and controllable regulation of cell migration and other behaviors by modulating the oligomerization or spatial arrangement of cell receptors. However, overall, related research is still far from sufficient, and it is still necessary to further develop user-defined non-genetic strategies in bioengineering for controllable and reversible manipulation of cell behavior. Summary of the Invention

[0004] The technical problem this invention aims to solve is to overcome the shortcomings of existing technologies and provide a universal and simple method for controllable and reversible regulation of cell receptors (S-CDP-Ad). The most typical member of the RTK receptor family, the mesenchymal-epidermal transition factor (Met) receptor, is selected as the research object. This method is based on host-guest recognition of β-cyclodextrin polymers (β-CDPs) and biomolecular receptor-ligand interactions to reversibly manipulate the arrangement of receptors on the cell membrane surface, thereby achieving on-demand regulation of cell proliferation, migration, and other behaviors. This provides a method and reference for developing user-defined non-genetic strategies to manipulate cell behavior.

[0005] To address the aforementioned technical problems, this invention provides a system for regulating cell behavior based on reversible rearrangement of cell receptors in host-guest recognition space. The system comprises: a β-cyclodextrin polymer and a ferrocene-labeled Met-binding nucleic acid aptamer (SL1-Fc), the gene sequence of which is shown in SEQ ID NO.1.

[0006] Furthermore, in the above-described system, the β-cyclodextrin polymer is a linear β-cyclodextrin polymer (L-β-CDP), and the system also includes HGF.

[0007] Furthermore, in the above system, the β-cyclodextrin polymer is a cross-linked β-cyclodextrin polymer (C-β-CDP).

[0008] The aforementioned system further includes adamantane.

[0009] In the above system, the concentration of the β-cyclodextrin polymer is 100 μM to 500 μM, the concentration of the SL1-Fc is 50 nM to 200 nM, and the concentration of the adamantane is 0.1 mM to 1.0 mM.

[0010] Based on a general technical concept, this invention also provides the application of the described system in the preparation of detection kits for cell analysis. The application method involves analyzing the upstream binding of SL1-Fc / β-CDPs to cells using techniques such as flow cytometry and confocal imaging, and analyzing the regulation of cell behavior by the proposed S-CDP-Ad strategy using Western blot, cell scratch assay, and CCK-8 assay.

[0011] Based on a general technical concept, this invention also provides the application of the described system in the preparation of drugs for cell regulation. The application method involves regulating cell behavior through rearrangement or oligomerization of cell receptors. Furthermore, reversible regulation of cell receptors is achieved through the selective competitive action of β-cyclodextrin polymers to customize cell function on demand.

[0012] Compared with the prior art, the advantages of the present invention are as follows:

[0013] (1) This invention provides a system for indirectly regulating cell behavior based on host-guest recognition spatial rearrangement of cell receptors (SL-CDP), wherein the β-cyclodextrin polymer is L-β-CDP, which programs the cell receptors to achieve on-demand regulation of cell behavior. SL-CDP can sensitively rearrange Met receptors to significantly inhibit HGF-induced Met receptor activation, block related signaling pathways, and indirectly regulate cell behavior. Furthermore, the SL-CDP-Ad strategy of adding adamantane (Ada) to the system allows Ada to competitively dissociate the SL1-Fc / L-β-CDP complex on the cell surface, causing the Met receptor to de-rearrange. Therefore, SL-CDP-Ad can reversibly rearrange cell receptors to customize cell behavior on demand.

[0014] (2) This invention provides a system for directly regulating cell behavior based on host-guest recognition spatial rearrangement of cell receptors (SC-CDP), wherein the β-cyclodextrin polymer is C-β-CDP. SC-CDP exhibits functions similar to HGF and can directly activate Met receptor behavior. Furthermore, an SC-CDP-Ad strategy involving the addition of adamantane (Ada) to the system is employed. After the addition of Ada, Ada competes with SL1-Fc for binding to C-β-CDP, thereby causing de-rearrangement of the cell membrane receptor. Therefore, by alternately adding C-β-CDP and Ada to the system, reversible regulation of cell behavior can be achieved.

[0015] (3) This invention provides a system based on the reversible rearrangement of host-guest recognition space to regulate cell behavior on demand in the preparation of a detection kit for cell analysis. Compared with most existing technologies that can only regulate cell behavior in one direction, S-CDP-Ad here provides a new strategy based on the selective host-guest recognition of β-cyclodextrin polymers to reversibly activate or inhibit cell receptors, so as to regulate the phosphorylation level of Met receptors, cell proliferation and cell migration behavior on demand.

[0016] (4) This invention provides a system for on-demand regulation of cell behavior based on reversible rearrangement of cell receptors by host-guest recognition space in the preparation of drugs for cell regulation. Compared with most existing technologies that can only regulate cell behavior in one direction, S-CDP-Ad here provides a new strategy for reversibly activating or inhibiting cell receptors based on selective host-guest recognition of β-cyclodextrin polymers, so as to regulate the phosphorylation level of Met receptors, cell proliferation and cell migration behavior on demand. Attached Figure Description

[0017] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.

[0018] Figure 1 This is a schematic diagram illustrating how β-cyclodextrin polymers (β-CDPs) with different structures dynamically and reversibly regulate cell behavior through spatial reprogramming of membrane receptor organization using the S-CDP-Ad strategy in this invention.

[0019] Figure 2 The results show the average molecular weight of L-β-CDP and C-β-CDP in Experiment 1 of this invention.

[0020] Figure 3 The results of the hydration particle size investigation of L-β-CDP and C-β-CDP in Experiment 1 of this invention are shown.

[0021] Figure 4The results of flow cytometry analysis of Met protein expression on different cell surfaces in Experiment 2 of this invention are shown.

[0022] Figure 5 This is the result of a Western blot experiment on the expression of Met protein on the surface of different cells in Experiment 2 of this invention.

[0023] Figure 6 The results represent the characterization of the co-localization of SL1-Fc and L-β-CDP on the surface of A549 and HCT116 cells in Experiment 3 of this invention.

[0024] Figure 7 This is the effect of SL-CDP on Met autophosphorylation in Experiment 4 of this invention.

[0025] Figure 8 This is a schematic diagram illustrating the indirect regulation of cell behavior by membrane receptor tissue through spatial reprogramming of the SL-CDP strategy in Example 2.

[0026] Figure 9 This represents the phosphorylation level of the Met receptor in A549 cells under different treatments in Experiment 4 of this invention.

[0027] Figure 10 The phosphorylation level of Met receptor in HCT116 cells under different treatments in Experiment 4 of this invention.

[0028] Figure 11 The results show the relative cell viability values ​​of each group under different treatments in Experiment 5 of this invention.

[0029] Figure 12 This is the result of SL-CDP indirectly regulating the wound healing activity of A549 cells in Experiment 6 of this invention.

[0030] Figure 13 This is the result of SL-CDP indirectly regulating the wound healing activity of SH-SY5Y cells in Experiment 6 of this invention.

[0031] Figure 14 This is the result of SL-CDP indirectly regulating the wound healing activity of HCT116 cells in Experiment 6 of this invention.

[0032] Figure 15 This is a schematic diagram illustrating the reversible regulatory effect of the SL-CDP-Ad strategy on cell behavior in Example 3 of the present invention.

[0033] Figure 16 This is a graph showing the analytical results of the competition between adamantane and the binding of SL1-Fc to L-β-CDP in Experiment 7 of this invention.

[0034] Figure 17This is the result of a Western blot experiment on the regulation of receptors in A549 cells using the SL-CDP-Ad strategy in Experiment 8 of this invention.

[0035] Figure 18 This is the result of a Western blot experiment on receptor regulation in HCT116 cells using the SL-CDP-Ad strategy in Experiment 8 of this invention.

[0036] Figure 19 This is the result of the investigation on the migration behavior of A549 and SH-SY5Y cells mediated by Met signaling indirectly and dynamically reversibly regulated by SL-CDP in Experiment 9 of this invention.

[0037] Figure 20 This is the result of the investigation on the migration behavior of HCT116 cells mediated by Met signaling indirectly and dynamically reversibly regulated by SL-CDP in Experiment 9 of this invention.

[0038] Figure 21 This is a schematic diagram illustrating the mechanism of C-β-CDP's regulation of cell behavior in Example 4.

[0039] Figure 22 This is the characterization result of the co-localization of SL1-Fc and C-β-CDP on the surface of A549 cells in Experiment 10 of this invention.

[0040] Figure 23 This is the characterization result of SC-CDP promoting the aggregation of Met receptors on the surface of A549 cells in Experiment Eleven of this invention.

[0041] Figure 24 This is the result of the Western blot experiment in Experiment Twelve of this invention to detect the direct regulatory effect of SC-CDP on p-Met expression.

[0042] Figure 25 The results of CCK-8 assay for SC-CDP-regulated A549 cell proliferation in Experiment Thirteen of this invention are shown.

[0043] Figure 26 C-β-CDP was used in the SC-CDP-Ad strategy to examine the principle of the reversibility of the process.

[0044] Figure 27 This is a graph showing the analysis results of Ada competing for the binding of SL1-Fc and C-β-CDP in Experiment Fourteen of this invention.

[0045] Figure 28 This is the result of a Western blot experiment on receptor regulation in A549 cells using the SC-CDP-Ad strategy in Experiment 15 of this invention.

[0046] Figure 29The results show the migration rates of A549 and SH-SY5Y cells under different component treatments in Experiment Sixteen of this invention. Detailed Implementation

[0047] The present invention will be further described below with reference to specific preferred embodiments, but this does not limit the scope of protection of the present invention.

[0048] The materials, reagents, and instruments used in the following examples were all commercially available. Unless otherwise specified, the experimental methods used in the following examples are conventional methods in the art. Units mM and μM are mmol / L and μmol / L, respectively.

[0049] All oligonucleotides were synthesized and purified by Sangon Biotech Co., Ltd. (Shanghai, China). Cyclodextrin monomers were purchased from J&K Technologies. Crosslinked β-cyclodextrin polymer (C-β-CDP) and adamantane (Ada) were purchased from Aladdin Biotech Co., Ltd. (Shanghai, China). FITC-adamantane was purchased from Ruixi Biotechnology Co., Ltd. (Xi'an, China). Hoechst nuclear dye and dialysis membrane (8kD) were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). Recombinant human HGF was purchased from Novoprotein (China). Crizotinib was purchased from MedChemExpress (MCE). Cell Counting Kit-8 (CCK-8) was purchased from APExBIO (USA). Met primary antibody and GAPDH primary antibody were purchased from Proteintech (Wuhan, China). Phosphorylated Met (p-Met) primary antibody was purchased from ABclonal Technology (Wuhan, China). Secondary antibody (goat anti-rabbit IgG (H&L)-HRP) was purchased from Abiowell (Changsha, China). RIPA lysis buffer, BCA protein assay kit, phosphatase inhibitor mixture, benzyl sulfonyl fluoride (PMSF), antibody diluent, and SDS-PAGE loading buffer were purchased from Biotech Inc. (Jiangsu, China). Enhanced 3-color regular range protein markers were purchased from SMOBIO (Beijing, China). 0.45 μm PVDF membranes were purchased from Millipore, and ECL substrate solution was purchased from Meilunbio (Dalian, China).

[0050] The sequence of oligonucleotide SL1 (from 5' to 3'): ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAG TCTGAT.

[0051] Example 1

[0052] One of the β-cyclodextrin polymers (β-CDPs) of the present invention is L-β-CDP or C-β-CDP.

[0053] L-β-CDP and C-β-CDP are two β-cyclodextrin polymers with the same average molecular weight but different spatial structures. L-β-CDP is a linear β-cyclodextrin polymer, while C-β-CDP is a cross-linked network β-cyclodextrin polymer. β-CDPs further bind to the Met receptor through host-guest recognition with the Fc group labeled on SL1, thereby reconfiguring the Met receptor. Different configurations of L-β-CDP or C-β-CDP can achieve different spatial programming of the Met receptor, thus regulating Met receptor-related cellular behaviors in different ways.

[0054] Two different configurations of β-CDPs, L-β-CDP and C-β-CDP, were used in the strategy proposed in this invention (S-CDP-Ad) to reversibly program cell receptors in different ways, achieving on-demand regulation of cell behavior. SL-CDP can sensitively rearrange Met receptors to significantly inhibit HGF-induced Met receptor activation, block related signaling pathways, and indirectly regulate cell behavior. SC-CDP exhibits similar function to HGF, directly activating Met receptor behavior. Both types of regulation can be reversibly modulated through simple competitive reactions. L-β-CDP was synthesized according to the reference, and C-β-CDP was purchased from Aladdin Reagents (Shanghai) Co., Ltd.

[0055] Figure 1 This is a schematic diagram illustrating how β-cyclodextrin polymers (β-CDPs) with different structures dynamically and reversibly regulate cell behavior through spatial reprogramming of membrane receptor organization via the S-CDP-Ad strategy. The S-CDP-Ad strategy mainly includes three steps. Figure 1 As shown, firstly, the ferrocene (Fc)-modified Met-binding aptamer (SL1-Fc) binds to the Met receptor on the cell surface. Then, L-β-CDP or C-β-CDP recombines the Met receptor through host-guest recognition with SL1-Fc. Finally, given that adamantane (Ada) and β-CDPs have stronger host-guest recognition capabilities, they can compete with Fc-SL1 for preferential binding to β-CDPs, leading to cell membrane receptor de-rearrangement and thus reversibly regulating cellular behavior on demand.

[0056] Experiment 1: Characterization of the molecular weight and particle size of β-CDPs.

[0057] Given the importance of the spatial arrangement of cell receptors in cellular function, controlling the nanoscale arrangement of ligands to modulate the spatial distribution of cell receptors is a crucial step. Here, two β-CDPs with different structures (L-β-CDP and C-β-CDP) are used to modulate Met receptor function. Both L-β-CDP and C-β-CDP are synthesized by crosslinking β-cyclodextrin (β-CD) monomers with epichlorohydrin. However, the difference lies in the process: L-β-CDP is pre-crosslinked with toluene within the hydrophobic cells of β-CD, resulting in a linear cyclodextrin polymer; while C-β-CDP is obtained directly by crosslinking β-CD monomers with epichlorohydrin, exhibiting a crosslinked network structure. The molecular weight and particle size of the two β-CDPs are characterized.

[0058] Figure 2 The figure shows the results of the average molecular weight analysis for L-β-CDP and C-β-CDP. As can be seen from the figure, the average molecular weights of L-β-CDP and C-β-CDP are 9.65 Kd and 9.18 Kd, respectively, indicating that the number of cyclodextrin monomers in both polymers is approximately 8.

[0059] Figure 3 The results show the hydrated particle size of L-β-CDP and C-β-CDP. As can be seen from the figure, the hydrated particle sizes of L-β-CDP and C-β-CDP are 13.68±0.65 nm and 4.61±0.52 nm, respectively. It is evident that although the two β-CDPs contain similar numbers of cyclodextrin monomers, their particle sizes differ significantly. This may be due to the different structures of the two β-CDPs, indicating that the arrangement and density of cyclodextrin monomers in the two β-CDPs are different.

[0060] Example 2

[0061] A system for regulating cell behavior based on L-β-CDP host-guest recognition spatial rearrangement cell receptors (SL-CDP) includes SL1-Fc, L-β-CDP and HGF.

[0062] SL1-Fc targets the Met receptor on the cell membrane. Through host-guest recognition of SL1-Fc via linear β-cyclodextrin polymer (L-β-CDP), a SL1-Fc / L-β-CDP complex is formed, which spatially rearranges the Met receptor to significantly inhibit HGF-induced Met receptor activation, block related signaling pathways, and indirectly regulate cell behavior.

[0063] SL1-Fc is a Met-binding nucleic acid aptamer labeled with ferrocene (Fc), and its DNA sequence (from 5' to 3') is shown in SEQ ID NO.1:

[0064] 5'-ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT-3'.

[0065] Experiment 2: Characterization of Met protein expression levels on different cell surfaces.

[0066] All cells were cultured in a 37°C incubator with 5% CO2. A549, L02, and HCT116 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin. SH-SY5Y cells were cultured in DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin. To characterize the expression of the Met receptor on different cell surfaces, flow cytometry was used to analyze the binding of the Met binding aptamer FAM-SL1 to different cells. 100 nM FAM-SL1 was incubated with A549, HCT116, L02, and SH-SY5Y cells at 4°C for 20 min. After washing three times with 10 mM PBS buffer, cells were counted by flow cytometry. 4 The data was analyzed using FlowJo software to examine cell binding events.

[0067] Figure 4 The results of flow cytometry show the expression of Met protein on the surface of different cells. As can be seen from the figure, A549 cells showed the highest Met receptor expression, followed by HCT116 cells and L02 cells, while SH-SY5Y cells were Met-negative.

[0068] Figure 5 The Western blot results further characterized the expression of the Met receptor on the surface of four cell types. As can be seen from the figure, the results of the Western blot experiment are the same as those of the flow cytometry.

[0069] Experiment 3: Investigate the co-localization of SL1-Fc / L-β-CDP on the cell surface.

[0070] SL1-Fc and L-β-CDP targeting Met receptors on the cell surface is a first step in altering Met receptor arrangement to customize cellular function. To test the successful execution of SL1-Fc / Met receptor biorecognition and L-β-CDP / SL1-Fc host-guest interactions on the cell surface, confocal fluorescence imaging was used to observe the co-localization of SL1-Fc and L-β-CDP on the cell surface. Cy5-labeled SL1-Fc (Cy5-SL1-Fc) and FITC-labeled L-β-CDP (FITC-L-β-CDP) were used for confocal imaging, and Hoechst dye was used to stain the cell nuclei. A549 or HCT116 cells were seeded in 35 mm confocal culture dishes and cultured overnight. Cells were stained with Hoechst at 37°C for 15 min. Then, cells were treated with Cy5-SL1-Fc at 4°C for 20 min, followed by incubation with FITC-L-β-CDP for 40 min. After three washes, confocal imaging analysis was performed. All images were recorded using a 100× oil immersion lens.

[0071] Figure 6 The figures show the characterization results of the co-localization of SL1-Fc and L-β-CDP on the surface of A549 and HCT116 cells. As can be seen from the figures, there is a clear co-localization signal between Cy5 and FITC channels, mainly concentrated on the cell membrane. This indicates that Cy5-SL1-Fc and FITC-L-β-CDP are successfully anchored on the surface of Met-positive A549 and HCT116 cells through biorecognition and host-guest interactions.

[0072] Experiment 4: Western blot to investigate the regulatory effect of SL-CDP on Met receptors.

[0073] The successful assembly of SL1-Fc and L-β-CDP on the cell surface has been demonstrated above. However, visualization techniques for receptor spatial organization changes are limited. Therefore, we will subsequently evaluate changes in downstream signals of the Met receptor to confirm the regulatory effect of the proposed strategy on the Met receptor.

[0074] Western blot experiments were conducted to investigate the effect of SL-CDP on Met autophosphorylation, and cells treated with different formulations were collected:

[0075] Control group: A549 cells that were not treated in any way.

[0076] SL1+L-β-CDP group: A549 cells treated with SL1-Fc and L-β-CDP.

[0077] Lysis was performed for 30 min in RIPA lysis buffer containing protease and phosphatase inhibitors, followed by denaturation at 99 °C for 5 min. Proteins were separated by 10% denaturing PAGE gel electrophoresis and then transferred to a PVDF membrane. The PVDF membrane was blocked with 5% BSA at room temperature for 1 h. The protein-containing PVDF membrane was then incubated overnight at 4 °C with primary antibodies of Met, p-Met, and GAPDH, followed by incubation with the corresponding secondary antibodies at room temperature for 1 h. Finally, the membrane was exposed through an ECL system and captured using a chemiluminescent gel imaging system. Grayscale analysis was performed using ImageJ software to compare the relative expression levels of each protein.

[0078] Figure 7 The effect of SL-CDP on Met autophosphorylation is shown in the figure. Figure A shows the protein blot of Met signaling protein in A549 cells after different treatments in the absence of HGF; Figure B shows the relative quantification of p-Met and GAPDH in (A).

[0079] As shown in the figure, SL-CDP treatment did not induce significant Met phosphorylation compared to the blank control, indicating that SL-CDP cannot directly activate the Met receptor. This may be because the insufficient SL1 spacing in SL1-Fc / L-β-CDP leads to Met receptor aggregation. Although SL-CDP does not directly regulate Met receptors, it has the potential to indirectly regulate Met receptor function. The Met signaling pathway is closely related to cell growth, survival, and migration cues. Upon binding to the dimerizing inducer HGF, the two Met receptors dimerize, leading to autophosphorylation and subsequently initiating downstream intracellular signaling cascades. Interfering with HGF / Met interaction has proven to be an attractive method for disrupting Met signaling transduction. SL-CDP shows promise in effectively inhibiting HGF-Met binding by rearranging the Met receptor and occupying the Met protein binding site, thereby limiting its dimerization. Figure 8 This is a schematic diagram of this principle.

[0080] To support this hypothesis, Western blot experiments were used to detect the phosphorylation level of the Met receptor in A549 cells under different treatments.

[0081] Control group: A549 cells that were not treated in any way.

[0082] HGF treatment group: A549 cells were treated with HGF only.

[0083] HGF+SL1-Fc group: A549 cells were treated with SL1-Fc and HGF.

[0084] HGF+SL1-Fc+CDP group: A549 cells were treated with SL1-Fc, L-β-CDP and HGF.

[0085] Figure 9 The figure shows the phosphorylation level of the Met receptor in A549 cells under different treatments. Figure A is a Western blot plot; Figure B is a bar chart of the relative expression level of p-Met.

[0086] The same treatment was performed on Met receptor-positive HCT116 cells. Figure 10 The results are shown in Figure A, which is a Western blot of protein expression in HCT116 cells under different treatments; and Figure B is a bar chart of the relative expression level of p-Met.

[0087] from Figure 9 and Figure 10 It can be seen that compared with the SL1 aptamer treatment group alone, the expression of HGF-induced p-Met was significantly reduced after SL-CDP treatment, and its inhibitory effect was comparable to that of the small molecule inhibitor crizotinib.

[0088] Experiment 5: Analysis of the regulatory effect of SL-CDP on cell viability in the presence of HGF.

[0089] Next, the effect of SL-CDP on cell viability in the presence of HGF was investigated using the CCK-8 assay. Cells were cultured in 96-well plates for 24 hours. Cells were treated for 24 hours with different concentrations (10–200 nM) of SL1-Fc, 500 μM L-β-CDP, and 40 ng / mL HGF in fresh culture medium (100 μL). 10 μL of CCK-8 was added to each well and incubated for 1 hour. Absorbance at 450 nm was recorded using a microplate reader. Data are expressed as relative values ​​compared to the absorbance of the blank control.

[0090] Figure 11 The results of the analysis of the relative viability values ​​of each group of cells under different treatments are shown in the figure. It can be seen from the figure that when the L-β-CDP concentration is constant, the cell viability gradually decreases with the increase of SL1-Fc concentration. This may be due to the rearrangement of the Met receptor by L-β-CDP.

[0091] Experiment 6: Evaluation of SL-CDP indirect regulation of Met signaling-mediated cell migration behavior.

[0092] A549, HCT116, and SH-SY5Y cells were seeded in 12-well plates. Once the cell density reached 90%, the cells were starved in 0.2% cell culture medium for 24 h. Subsequently, wounds were created by scraping the cell monolayer with the tip of a 200 μL pipette. Each well was washed three times with 10 mM PBS to remove isolated cells. Each cell group was treated according to different formulations: 100 nM L1-Fc cells were first incubated on the cell surface for 20 min, washed twice with 10 mM PBS, treated with L-β-CDP (500 μM) for 1.0 h, washed twice with PBS, treated with Ada for 1.0 h, and then incubated in HGF for 30 min. Wound areas were recorded using an inverted microscope at t = 0 h and 24 h (10x objective). Wound healing rate was related to cell migration ability. The scratched area was measured using ImageJ software and calculated according to the following formula:

[0093] Scratch healing rate (%) = (0-hour scratch area - 24-hour scratch area) / 0-hour scratch area × 100%.

[0094] Figure 12 The results of the investigation into the Met signaling-mediated cell migration behavior in A549 cells indirectly regulated by SL-CDP are shown. Figure A shows the results of cell wound healing assays after various treatments. Figure B is a bar chart of relative wound healing rates statistically derived from Figure A, expressed as mean ± standard deviation.

[0095] The results showed that, compared with the control group, the wound healing rate of A549 cells incubated with HGF was significantly increased. SL-CDP treatment significantly reduced HGF-induced cell wound healing. The inhibitory effects of SL1 and L-β-CDP alone on HGF-promoted cell wound healing were negligible, indicating that SL-CDP manipulation can effectively block HGF / Met signaling activity.

[0096] Figure 13 This figure shows the results of SL-CDP indirectly regulating the wound healing activity of SH-SY5Y cells. Figure A shows the results of cell wound healing assays after various treatments. Figure B is a bar chart of relative wound healing rates from Figure A, expressed as mean ± standard deviation. The figure shows that the wound healing activity of SH-SY5Y cells is almost unaffected by SL-CDP, likely due to its low Met expression level.

[0097] Figure 14This figure shows the results of SL-CDP indirectly regulating the wound healing activity of HCT116 cells. Figure A shows the results of cell wound healing assays after various treatments. Figure B is a bar chart of relative wound healing rates from Figure A, expressed as mean ± standard deviation. The figures show that the wound healing analysis results of HCT116 cells are almost identical to those of A549 cells.

[0098] These results indicate that L-β-CDP can anchor to Met with the help of SL1-Fc and rearrange the Met receptor in a certain way, thereby interfering with the interaction between the Met receptor and HGF. Therefore, SL-CDP is a powerful strategy to inhibit tumor metastasis by blocking HGF / Met signaling.

[0099] Example 3

[0100] A system for on-demand customization of cell behavior based on L-β-CDP host-guest recognition spatial reversible rearrangement of cell receptors (SL-CDP-Ad) includes L-β-CDP, SL1-Fc, adamantane (Ada), and HGF.

[0101] SL1-Fc targets the Met receptor on the cell membrane. The β-cyclodextrin polymer (L-β-CDP) performs host-guest recognition on SL1-Fc, forming the SL1-Fc / L-β-CDP complex, which rearranges the Met receptor to influence downstream cell function. Ad competitively dissociates the SL1-Fc / L-β-CDP complex on the cell surface, causing the Met receptor to de-rearrange. Therefore, SL-CDP-Ad can reversibly rearrange cell receptors to customize cellular behavior on demand.

[0102] Figure 15 This diagram illustrates the principle of the reversible regulation of cell receptors using the SL-CDP-Ad strategy. As shown, the SL-CDP-Ad strategy comprises three main steps. First, SL1-Fc binds to the Met receptor on the cell surface via biorecognition. L-β-CDP targets SL1-Fc on the cell surface through host-guest recognition, causing spatial rearrangement of the Met receptor and thus blocking HGF activation of the Met receptor. Upon addition of Ada, Ada competes with SL1-Fc for binding to L-β-CDP, thereby causing de-rearrangement of the cell membrane receptor. Therefore, by alternately adding L-β-CDP and Ada to the system, reversible regulation of cell receptors can be achieved.

[0103] SL1-Fc is a ferrocene-labeled Met-binding nucleic acid aptamer, and its DNA sequence (from 5' to 3') is shown in SEQ ID NO.1: ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAG TCTGAT.

[0104] Experiment 7: Investigating the competitive binding of adamantane (Ada) to SL1-Fc and L-β-CDP

[0105] Inspired by the reversible regulation of cell behavior based on DNA strand substitution, the proposed S-CDP-Ad strategy also attempts to reversibly regulate cell behavior based on a simple competitive reaction. Given that Ada has a stronger host-guest recognition interaction with β-cyclodextrin than Fc, Ada can competitively dissociate the SL1-Fc / L-β-CDP complex, achieving spatial de-rearrangement of the Met receptor and thus reversibly regulating Met receptor-related cell behavior.

[0106] The occurrence of the above competitive reaction was verified using a fluorescence method. 600 nM SL1-Cy5 was mixed with 1.5 mM L-β-CDP and reacted at 25 °C for 3 h. Then, different concentrations of Ada (0.1–6.0 mM) were added, and the reaction was continued at 25 °C for another 3 h. Fluorescence intensity was detected using a fluorometer with excitation wavelengths of 650 nm and emission wavelengths ranging from 670 to 750 nm.

[0107] Figure 16 The results of fluorescence analysis investigating the competition between Ada and L-β-CDP binding of Cy5-SL1-Fc are shown in the figure. The figure shows that after binding to L-β-CDP, the fluorescence intensity of Cy5-SL1-Fc is significantly enhanced, which is due to the change in the surrounding environment after Fc enters the β-CD cavity. However, with the increase of Ada concentration in the system, the enhanced fluorescence intensity of Cy5-SL1-Fc gradually decreases, eventually returning to the same level as the initial fluorescence intensity of Cy5-SL1-Fc alone. These results indicate that Ada can replace Fc in occupying the L-β-CDP cavity to dissociate the SL1-Fc / L-β-CDP complex, allowing SL1-Fc to re-integrate in solution and restore its original fluorescence intensity. This preliminarily verifies the feasibility of the SL-CDP-Ad strategy.

[0108] Experiment 8: Western blot investigation of the reversible regulation of Met receptor phosphorylation levels by SL-CDP-Ad.

[0109] The above results preliminarily confirm that Ada and L-β-CDP possess stronger host-guest recognition capabilities, thus enabling the competitive dissociation of the SL1-Fc / L-β-CDP complex. Next, the ability of the SL-CDP-Ad strategy to exert its effects on Met-positive cells was further investigated. Met signaling transduction-related processes were also used to evaluate the reversible regulatory effect of the SL-CDP-Ad strategy on cell behavior.

[0110] Cells were treated and proteins extracted using the following methods: (a) control group; (b) SL1-Fc and L-β-CDP treatment; (c) HGF treatment; (d) SL1-Fc, L-β-CDP, and HGF treatment; (e) SL1-Fc, L-β-CDP, Ada, and HGF treatment; (f) SL1-Fc, L-β-CDP, Ada, L-β-CDP, and HGF treatment. The procedures were the same as in Experiment 4.

[0111] Figure 17 The results of the Western blot experiment are shown in Figure A, which shows the Western blot results of Met signaling protein in A549 cells under different treatment conditions; Figure B shows the relative quantification of p-Met and GAPDH in (A).

[0112] As shown in the figure, HGF-incubated A549 cells had a higher relative amount of p-Met than untreated cells. SL-CDP treatment significantly inhibited HGF-promoted p-Met expression. However, Ada treatment removed the effect of SL-CDP, indicating that HGF could still promote Met receptor phosphorylation, similar to HGF-only treatment. Furthermore, the addition of L-β-CDP after Ada treatment again inhibited HGF-promoted p-Met expression.

[0113] In addition, Western blotting experiments were also performed on HCT116 cells to explore the universality of the SL-CDP-Ad strategy. Figure 18 The results are shown in Figure A, which represents the Western blot results of the Met signaling protein in HCT116 cells under different treatment conditions; Figure B shows the relative quantification of p-Met and GAPDH in (A). The Western blot results are almost identical to those of A549 cells. This demonstrates that the p-Met content in cells can be controlled as needed by adding different formulations to the system.

[0114] Experiment 9: Wound Healing Experiment Analysis: SL-CDP-Ad Reversible Rearrangement of Met Receptors Regulates Cell Migration Behavior on Demand.

[0115] Cells were treated in the following ways: (a) control group; (b) SL1-Fc and L-β-CDP treatment; (c) HGF treatment; (d) SL1-Fc, L-β-CDP, and HGF treatment; (e) SL1-Fc, L-β-CDP, Ada, and HGF treatment; (f) SL1-Fc, L-β-CDP, Ada, L-β-CDP, and HGF treatment. The procedures were the same as in Experiment VI.

[0116] Figure 19The figures show the wound migration rates of A549 and SH-SY5Y cells under different treatments. Figure A represents the wound healing results of A549 cells after various treatments. Figure B is a bar chart of relative wound healing rates from Figure A, expressed as mean ± standard deviation. Figure C is a statistical bar chart of wound healing rates of SH-SY5Y cells after various treatments. The figures show that HGF-incubated A549 cells have a higher wound healing capacity than untreated cells. SL-CDP treatment inhibited HGF-promoted wound healing. However, Ada treatment removed the effect of SL-CDP, so HGF could still significantly enhance cell migration activity, similar to HGF treatment alone. Furthermore, the addition of L-β-CDP after Ada treatment inhibited HGF-induced cell migration. The wound healing activity of SH-SY5Y cells with low Met protein expression was almost unaffected by SL-CDP.

[0117] Figure 20 The figure shows the migration rate of HCT116 cells under different treatments. Figure A represents the wound healing results of HCT116 cells after various treatments. Figure B is a bar chart of the relative wound healing rate from Figure A, expressed as mean ± standard deviation. The results show that SL-CDP-Ad can also be effectively implemented in HCT116 cells. These results indicate that the SL-CDP-Ad strategy can reversibly regulate the behavior of Met receptor-positive cells through the alternating recognition between L-β-CDP and SL1-Fc or Ada.

[0118] Example 4

[0119] A system for regulating cell behavior based on C-β-CDP host-guest recognition spatial rearrangement cell receptors (SC-CDP) includes SL1-Fc and C-β-CDP.

[0120] It has been confirmed that the spatial distribution of receptors is closely related to their function, and different nanoscale arrangements of receptors can affect their function and downstream signaling. Considering that C-β-CDP is structurally more compact than L-β-CDP, SL1-Fc / C-β-CDP may induce a denser receptor arrangement, leading to Met receptor activation.

[0121] Figure 21 This diagram illustrates the mechanism by which C-β-CDP regulates cell behavior. As can be seen from the diagram, SL1-Fc binds to Met receptors on the cell surface, and then C-β-CDP aggregates with Met receptors through host-guest recognition of SL1-Fc, thereby regulating cell behavior.

[0122] Experiment 10: Investigate the co-localization of SL1-Fc / C-β-CDP on the cell surface.

[0123] Similarly, confocal fluorescence imaging was used to observe the co-localization of SL1-Fc and C-β-CDP on the cell surface. Cy5-labeled SL1-Fc (Cy5-SL1-Fc) and FITC-labeled C-β-CDP (FITC-C-β-CDP) were used for confocal imaging, and Hoechst dye was used to stain the cell nuclei. The procedure was the same as in Experiment 3.

[0124] Figure 22 The image shows the characterization results of the co-localization of SL1-Fc and C-β-CDP on the surface of A549 cells. As can be seen from the figure, there is a clear co-localization signal between Cy5 and FITC channels, mainly concentrated on the cell membrane. This indicates that Cy5-SL1-Fc and FITC-C-β-CDP are successfully anchored on the surface of Met-positive A549 cells through biorecognition and host-guest interactions.

[0125] Experiment 11: Confocal imaging to investigate SL1-Fc / C-β-CDP-induced Met receptor aggregation.

[0126] Confocal imaging was also used to characterize SC-CDP-induced Met receptor aggregation. A549 cells were seeded in 35 mm confocal culture dishes and cultured overnight. They were stained with Hoechst at 37 °C for 15 min. Then, the cells were treated with Cy5-SL1-Fc and Cy3-SL1-Fc at 4 °C for 20 min, and confocal imaging analysis was performed in the presence and absence of β-CDPs. All images were recorded at 100× oil immersion.

[0127] Figure 23 The image shows the fluorescence resonance energy transfer (FRET) signals of Cy5-SL1-Fc and Cy3-SL1-Fc in the presence and absence of β-CDPs. The results show that Cy5-SL1-Fc and Cy3-SL1-Fc exhibit strong FRET signals in the presence of C-β-CDPs, while the FRET signals are weaker in the absence of C-β-CDPs. This indicates that C-β-CDPs cause Cy5-SL1-Fc and Cy3-SL1-Fc to aggregate more tightly, thereby inducing Met receptor aggregation. The SL-CDP-induced FRET signal is weaker, possibly because the distance between cyclodextrin monomers in L-β-CDPs is less compact than that in C-β-CDPs, so the distance between ligand SL1s is insufficient to produce a strong FRET signal.

[0128] Experiment 12: Western blot investigation of the regulatory effect of SC-CDP on Met receptors.

[0129] The implementation steps are the same as in Experiment 4.

[0130] Figure 24 The figure shows the results of Western blot analysis to detect the direct regulatory effect of SC-CDP on p-Met expression. Figure A shows the Western blot results of Met signaling proteins in A549 cells under different treatments; Figure B shows the relative quantification of p-Met and GAPDH in (A). The figure shows that at a constant C-β-CDP concentration, the relative expression level of p-Met increases with increasing SL1-Fc (25-200 nM) concentration, indicating that SC-CDP promotes the autophosphorylation of the Met receptor.

[0131] Experiment Thirteen: Analyzing the regulatory effect of SC-CDP on cell proliferation.

[0132] Figure 25 The CCK-8 assay results show that SC-CDP's ability to promote cell proliferation increases with increasing SL1-Fc concentration. These results indicate that SC-CDP can directly activate Met receptor signaling, thereby promoting Met receptor phosphorylation and cell proliferation.

[0133] Example 5

[0134] A system (SC-CDP-Ad) based on C-β-CDP host-guest recognition spatial reversible rearrangement of cell receptors to regulate cell behavior on demand includes SL1-Fc, C-β-CDP and Ada.

[0135] C-β-CDP was also used in the S-CDP-Ad strategy to examine the reversibility of the process (SC-CDP-Ad). See [link to principle] for details. Figure 26 As shown in the figure, SL1-Fc binds to the Met receptor on the cell surface, and then C-β-CDP aggregates on the Met receptor through host-guest recognition with SL1-Fc, thereby activating cell behavior. Upon addition of Ada, Ada competes with SL1-Fc for binding to C-β-CDP, leading to de-rearrangement of the cell membrane receptor. Therefore, by alternately adding C-β-CDP and Ada to the system, reversible regulation of cell behavior can be achieved.

[0136] Experiment Fourteen: Investigating the competitive binding of adamantane (Ada) to SL1-Fc and C-β-CDP

[0137] Fluorescence methods were used to investigate how Ada competitively dissociates the SL1-Fc / C-β-CDP complex, thereby achieving spatial rearrangement of the Met receptor and reversibly regulating Met receptor-related cellular behavior. 600 nM SL1-Cy5 and 1.5 mM C-β-CDP were mixed and reacted at 25 °C for 3 h. Then, different concentrations of Ada (0.1–4.0 mM) were added, and the reaction was continued at 25 °C for another 3 h. Fluorescence intensity was measured using a fluorometer with excitation wavelengths of 650 nm and emission wavelengths ranging from 670 to 750 nm.

[0138] Figure 27 The figure shows the analytical results of Ada competing with C-β-CDP for the binding of SL1-Fc. The figure shows that the fluorescence intensity of Cy5-SL1-Fc is significantly enhanced after binding to C-β-CDP. However, with the increase of Ada concentration in the system, the enhanced fluorescence intensity of Cy5-SL1-Fc gradually decreases, eventually returning to the same level as the initial fluorescence intensity of Cy5-SL1-Fc alone. These results indicate that Ada can replace Fc in occupying the cavity of C-β-CDP to dissociate the SL1-Fc / C-β-CDP complex, allowing SL1-Fc to be re-inactivated in solution and regain its original fluorescence intensity. This preliminarily verifies the feasibility of the SC-CDP-Ad strategy.

[0139] Experiment 15: Western blot experiment to investigate the reversible regulation of Met receptor phosphorylation level by SC-CDP-Ad.

[0140] Western blot experiments were conducted to study the effect of SC-CDP-Ad on Met autophosphorylation. A549 cells treated with different formulations were collected. The procedure was the same as in Experiment 4.

[0141] (a) SL1-Fc treatment group; (b) SL1-Fc and C-β-CDP treatment group; (c) SL1-Fc, C-β-CDP and Ada treatment group; (d) SL1-Fc, C-β-CDP, Ada and C-β-CDP treatment group; (e) HGF treatment group.

[0142] Figure 28 The figure shows the results of the relative content of p-Met in A549 cells under different treatments. In the figure, A is the protein blot of Met signaling protein in A549 cells after various treatments; B is the relative quantification of p-Met and GAPDH in (A).

[0143] As shown in the figure, A549 cells treated with SC-CDP had higher p-Met content than cells treated with SL1-Fc alone. Ada treatment removed the activation effect of SC-CDP, meaning the SC-CDP-Ad treatment group was similar to the control group, indicating that the addition of Ada reversed the activation of Met receptors by SC-CDP. Furthermore, continued addition of C-β-CDP after Ada treatment produced Met activation signals similar to those produced by SC-CDP. Given that the effect of SL1-Fc alone on p-Met levels is negligible, this suggests that the above-mentioned regulatory process is due to SC-CDP altering the distance between receptors. Although direct visualization techniques for receptor aggregation were limited in this study, the observed effects of upstream binding and downstream signal transduction suggest that SC-CDP treatment promotes Met receptor aggregation, rather than simply multivalent binding.

[0144] Experiment 16: Wound Healing Experiment Analysis: SC-CDP-Ad Reversible Rearrangement of Met Receptors Regulates Cell Migration Behavior on Demand.

[0145] Cells were treated in the following ways: (a) SL1-Fc treatment group; (b) SL1-Fc and C-β-CDP treatment group; (c) SL1-Fc, C-β-CDP, and Ada treatment group; (d) SL1-Fc, C-β-CDP, Ada, and C-β-CDP treatment group; (e) HGF treatment group. The procedures were the same as in Experiment VI.

[0146] Figure 29 The figures show the migration rates of A549 and SH-SY5Y cells under different treatments. Figure A represents the results of wound healing assays for A549 cells after various treatments. Figure B is a bar chart of relative wound healing rates from Figure A, expressed as mean ± standard deviation. Figure C is a bar chart of wound healing rates for SH-SY5Y cells after various treatments.

[0147] As shown in the figure, A549 cells treated with SC-CDP exhibited higher wound healing capacity than cells treated with SL1-Fc alone. Ada treatment removed the activation effect of SC-CDP; further addition of C-β-CDP after Ada treatment promoted cell migration. SH-SY5Y cells were used as a negative control, and the results showed no significant difference in cell migration rate under various treatment conditions, likely due to low Met expression in SH-SY5Y cells. These results indicate that the S-CDP-Ad strategy is also applicable to C-β-CDP, and that the SC-CDP-Ad strategy can reversibly regulate the behavior of Met receptor-positive cells through the alternating recognition of C-β-CDP with SL1-Fc or Ada.

[0148] In summary, a non-genetic strategy, S-CDP-Ad, is proposed to customize cell proliferation and migration behaviors in a defined manner by regulating the rearrangement and de-rearrangement of cell surface receptor Met. Both L-β-CDP and C-β-CDP are applicable to the S-CDP-Ad strategy and can achieve dynamic and reversible regulation of cell receptors through simple competitive reactions. SL-CDP can significantly inhibit HGF-induced cell receptor activation, indirectly regulating cell behavior, while SC-CDP can activate cell behavior, directly regulating it. Therefore, by adding different formulations, the arrangement of membrane receptor Met can be manipulated accordingly, regulating downstream intracellular signaling pathways and ultimately controlling cell behavior. This strategy, by altering aptamers to recognize other receptors, can be used to manipulate other cellular physiological processes, thereby broadening opportunities for cancer therapy.

[0149] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention using the methods and techniques disclosed above, or modify them into equivalent embodiments with equivalent changes, without departing from the spirit and technical essence of the present invention. Therefore, any simple modifications, equivalent substitutions, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solutions of the present invention shall still fall within the protection scope of the technical solutions of the present invention.

Claims

1. A system for on-demand regulation of cell behavior based on reversible rearrangement of cell receptors in subject-guest recognition space, characterized in that, The system comprises: a β-cyclodextrin polymer and a ferrocene-labeled Met-binding nucleic acid aptamer, the gene sequence of which is shown in SEQ ID NO.1; the β-cyclodextrin polymer is a linear β-cyclodextrin polymer.

2. The system according to claim 1, characterized in that, The system also includes HGF.

3. A system for on-demand regulation of cell behavior based on reversible rearrangement of cell receptors in subject-guest recognition space, characterized in that, The system comprises: a β-cyclodextrin polymer and a ferrocene-labeled Met-binding nucleic acid aptamer, the gene sequence of which is shown in SEQ ID NO.1; the β-cyclodextrin polymer is a cross-linked β-cyclodextrin polymer.

4. The system according to any one of claims 1 to 3, characterized in that, The system also includes adamantane.

5. The system according to claim 4, characterized in that, The concentration of the β-cyclodextrin polymer is 100 µM to 500 µM; the concentration of the ferrocene-labeled Met-binding nucleic acid aptamer is 50 nM to 200 nM; and the concentration of the adamantane is 0.1 mM to 1.0 mM.

6. The use of the system according to any one of claims 1 to 5 in the preparation of a detection kit for cell analysis.

7. Use of the system according to any one of claims 1 to 5 in the preparation of a medicament for cell regulation.

Images